The Journal of Clinical Endocrinology & Metabolism Vol. 85, No. 11 4019-4022
Copyright © 2000 by The Endocrine Society
From the Clinical Research Centers |
Insulin Response to Glucose Is Lower in Individuals Homozygous for the Arg 64 Variant of the ß-3-Adrenergic Receptor1
Jeremy Walston,
Kristi Silver2,
Heather Hilfiker,
Ross E. Andersen,
Michael Seibert,
Brock Beamer,
Jesse Roth,
Eric Poehlman and
Alan R. Shuldiner
Division of Geriatric Medicine and Gerontology (J.W., H.H., M.S.,
R.E.A., B.B., J.R.), Johns Hopkins University School of
Medicine, Baltimore, Maryland 21224; Department of Medicine (A.R.S.,
K.S.), Division of Endocrinology, Diabetes and Nutrition at the
University of Maryland, Baltimore, Maryland; and the Department
of Medicine (E.P.), University of Vermont, Burlington, Vermont
Address correspondence and requests for reprints to: Jeremy Walston, M.D., Johns Hopkins Asthma and Allergy Center, Room 5A.24, 5501 Hopkins Bayview Circle, Baltimore, Maryland 21224. Email: jwalston@welch.jhu.edu.
 |
Abstract
|
|---|
Type 2 diabetes mellitus (type 2 DM) is a polygenic disorder with a
variable phenotype that includes both insulin resistance and insulin
secretory dysfunction. The Arg 64 ß-3-adrenergic receptor
variant allele is associated with an earlier age of onset of type 2 DM.
The purpose of this study was to examine the in vivo
pathophysiology of this variant allele to determine its contribution to
the components of glucose metabolism. We used the frequently sampled iv
glucose tolerance tests, minimal model analysis, and analysis of
covariance to examine age- and fat-mass-adjusted differences among
genotypes. The results demonstrate that individuals homozygous for the
Arg 64 allele secrete significantly less insulin in response to a
glucose infusion (562 ± 116 vs. 962 ± 94
pmol/µL), have the highest fasting glucose levels (100.4 ± 1.9
vs. 92.48 ± 1.60 mg/dL), and have lower glucose
effectiveness (0.014 ± 0.003 vs. 0.019 ±
0.002 min-1), compared with those homozygous
for the Trp 64 allele. This first report of decreased acute insulin
release and lower glucose effectiveness in the Arg 64 genotype
may help explain the earlier onset of type 2 DM observed in several
populations of individuals with the Arg64 ß-3-adrenergic receptor
variant allele.
 |
Introduction
|
|---|
TYPE 2 DIABETES mellitus (type 2 DM) is an
increasingly common metabolic disorder with a significant genetic
component (1 , 2). Although some rare monogenic syndromes
similar to type 2 DM have been identified, the most common human
phenotype, characterized by central obesity, insulin resistance, and
later by ß-cell failure, does not exhibit simple Mendelian
inheritance (3, 4, 5, 6). Rather, several gene variants, each
with a modest effect, likely influence the development of both insulin
resistance and insulin secretion abnormalities via several molecular
pathways (7, 8).
One such gene variant that is very common in diverse ethnic groups is
the ß-3-adrenergic receptor (B3AR) Arg 64
allele (9). This Arg 64 allele was initially shown to
associate with an earlier onset of type 2 DM in Pima Indians homozygous
for the variant allele, and later studies confirmed these findings in
diabetic Finns, Mexican Americans, and Japanese cohorts
(9, 10, 11, 12, 13). Other population-based studies have identified
significant associations between this allele and other metabolic
alterations linked to obesity and type 2 DM, including central obesity
(12, 14), insulin resistance (12, 15), and
increased rate of weight gain (15, 16, 17). There have also
been a number of association studies that failed to show a relationship
between the variant allele and traits related to diabetes and obesity
(18, 19, 20). Differences in study design, ethnicity, age,
gender, environment, and lack of statistical power to discern modest
effects of the allele in some studies may help explain these equivocal
results (21).
While one early study showed no differential response to the variant to
a B3AR agonist, several more recent studies have shown
differences between three genotypes (22). Two recent functional study
indicates that the Arg64 B3AR has decreased
ability to activate adenylyl cyclase in vitro (23, 24). Decreased ligand-stimulated lipolysis has been demonstrated
in two populations using omental adipose tissue of humans with the
variant allele, further suggesting functional consequences of this
nonconservative amino acid substitution (25, 26). Although
known physiologic precursors of type 2 DM include both insulin
resistance and insulin secretory dysfunction, no studies have
investigated alterations in insulin secretion as a possible mechanism
of earlier onset of type 2 DM in those with the Arg 64 allele.
The goal of this study is to study subjects prospectively recruited
based on B3AR genotype who are younger, less
obese, and nondiabetic in order to help clarify the pathophysiological
basis of the earlier onset of type 2 DM in subjects with the Arg 64
variant allele without the potential confounding effect of preexisting
diabetes. The prospective study design has allowed us to more carefully
control for variables that influence glucose metabolism, by measuring
body composition with a dual-energy x-ray absorptiometry (DEXA) scan
and monitoring dietary intake before the iv glucose tolerance test
(IVGTT). This study design has allowed us to study a large number of
Arg 64 homozygous subjects, and this is the first study of
prospectively recruited subjects homozygous or heterozygous for the Arg
64 allele to directly measure insulin secretion.
 |
Subjects and Methods
|
|---|
Human subjects
All protocols were approved by the Johns Hopkins Bayview Campus
Institutional Review Board, and all subjects gave written informed
consent for genotyping and for the clinical portion of the study. Most
were recruited at Baltimore metropolitan area health care centers,
community health fairs, and medical school campuses. Those found to be
homozygous for the Arg 64 variant allele were contacted by telephone
and asked to participate in the IVGTT portion of the study at the Johns
Hopkins Bayview Medical Center General Clinical Research Center (GCRC).
Age-, gender-, and ethnic group-matched individuals with the Trp/Trp
and Trp/Arg genotypes were identified and asked to participate in the
clinical protocol. Individuals who were diabetic or severely or
morbidly obese [body mass index (BMI) > 35
kg/m2] were excluded from the clinical portion
of the protocol because of the confounding influences of diabetes
treatment, insulin resistance, and secondary effects on insulin
secretion that are associated with obesity and diabetes.
Methods
After a finger prick with a lancet device, several drops of
blood were collected and stored in 1% EDTA. Genomic DNA was extracted
using the QIAamp Blood Kit (QIAGEN, Santa Clarita, CA).
The B3AR genotype was determined by
PCR/restriction fragment length polymorphism assay developed in
our laboratory using upstream primer 5' (CGCCCAATACCGCCAACAC) 3' and
downstream primer 5' (CCACCAGGAGTCCCATCACC) 3', standard PCR reagents
and conditions, and restriction enzyme digestion using BST N1
(New England Biolabs, Inc., Beverly, MA)
(12).
All subjects invited for further study were instructed to ingest a
carbohydrate-rich diet (250300 g/day for 3 days) and then fast for
12 h before coming to the Johns Hopkins Bayview GCRC. Follow-up of
dietary logs by a registered GCRC dietitian confirmed the appropriate
carbohydrate intake in all study subjects. Anthropomorphic measurements
were taken at the time of admission. Fat mass and lean body mass were
determined by DEXA using a Hologic, Inc. QDR 4500 with
Hologic, Inc. Body Composition Software (Hologic, Inc., Chatham, MA). For the frequently sampled insulin-modified
IVGTT, two 18-gauge antecubital iv catheters were inserted, and normal
saline solution was infused at a rate of 75 mL/h (27, 28).
Baseline samples were drawn at -15, -10, -5, and -1 min for fasting
glucose and insulin measurements. A 50%-dextrose solution was infused
into the contralateral arm at time point 0, over approximately 2 min,
with the quantity in grams determined by body weight in kilograms
x 0.6. Three-milliliter blood samples were drawn over the next 180 min
at time points 2, 3, 4, 5, 6, 8, 10, 14, 19, 22, 25, 30, 40, 50, 70,
100, 130, 160, and 180 min. Plasma glucose was measured during the
study with a Glucose Analyzer 2 (Beckman Instruments, Inc., Brea, CA). Insulin and leptin levels were measured
later from frozen plasma, in the GCRC core laboratory, using the human
insulin-specific RIA and human leptin RIA kits (Linco Research, Inc., St. Charles, MO).
Insulin and glucose data were entered into the minimal model analysis
(MINMOD) program; and values for acute insulin release in response to a
glucose bolus (AIRg), insulin sensitivity (Si), disposition index
(AIRg x Si), and glucose effectiveness (Sg) were calculated
(29). Analysis of covariance was used to examine
differences among genotypes, with adjustment for fat mass, age, and
BMI. Results are reported as adjusted means ± SE.
 |
Results
|
|---|
We identified 20 Arg 64 homozygotes and 186 heterozygotes from
2800 screened subjects, for a total allele frequency of 0.09. Thirteen
of the Arg 64 homozygous subjects agreed to participate in the clinical
part of the study; and age-, gender-, and BMI-matched heterozygotes and
normal homozygotes were identified from the database and were asked to
participate. Of the 62 subjects studied, 35 (66%) were Caucasian, 10
(20%) were African American, 8 (16%) were Asian, and 2 (4%) were
Hispanic. Baseline clinical characteristics of the subjects who were
selected for the study are shown in Table 1
. Because of the study design, which
matched individuals by BMI and age, there were no significant
differences in these values among genotypes. There were also no
significant differences in lean and fat mass, by DEXA scan, among
genotypes.
Individuals homozygous for the Arg 64 allele secreted significantly
less insulin in response to a glucose bolus (AIRg) than did those
homozygous for the Trp allele, with the heterozygous individuals at an
intermediate level (Table 2
). There were
no significant differences in Si, as determined by the MINMOD, among
the three groups (Table 3
). The
disposition index (Di), calculated by multiplying acute insulin release
by the Si value, approached statistical significance, with Arg 64
homozygotes tending to have a lower Di (Table 3
). Sg, a calculated
value that represents the ability of glucose to promote its uptake
independently from the effect of insulin, was lowest in the Arg/Arg
group and highest in the Trp/Trp group. In accord with the IVGTT
results, the Arg/Arg group had a significantly higher level of fasting
glucose, compared with the Trp/Trp group; and the Trp/Arg group had the
lowest levels of fasting insulin (Table 2
). There were no differences
in plasma leptin levels between groups (Table 2
). There were no
significant differences between men and women in the glucose metabolism
measurements (data not shown).
 |
Discussion
|
|---|
Insulin secretion
The major new finding of this study is that individuals homozygous
for the Arg 64 allele secrete significantly lower amounts of insulin in
response to a glucose bolus, compared with those homozygous for the Trp
64 allele. This result may help explain the earlier onset of type 2 DM
observed in several association studies (9, 10, 11, 12, 13). Although
B3ARs have not been clearly identified on islet
cells, evidence from several studies in rodents suggests that they may
play a role in insulin release. Two studies in both mice and rats have
linked specific B3AR agonists to increased insulin secretion (30 ,
31). Furthermore, a B3AR knockout mouse
model showed a markedly decreased ability to secrete insulin in
response to a B3AR agonist (32). A
response to the agonist was, in part, restored in mice with selective
expression of B3AR in white adipose tissue
(32).
Although the mechanisms by which the B3AR may
influence insulin secretion is unknown, epinephrine is known to impair
glucose tolerance in humans, whereas it potentiates glucose-stimulated
insulin secretion from ß-cells (33, 34). Increased cAMP
generation is important in both first- and second-phase insulin
secretion (35). In two of three published studies, the
variant receptor has been shown in vitro to lead to
decreased cAMP generation (24). If lower levels of cAMP
are present in ß-cells of individuals with the variant
B3AR, then insulin release could be decreased.
Further studies of the expression of the receptor in islet cells may
help elucidate the role of the autonomic nervous system and
B3AR on insulin secretion.
Indirect mechanisms may also influence insulin release in the acute
phase. The B3AR is expressed in visceral fat; and
lipolysis studies, in response to a specific B3AR
agonist in human omental fat, have revealed a significantly lower
lipolysis rate in Arg 64 homozygote fat samples (25, 26).
Because free fatty acids (FFA) in the portal system enhance acute
insulin secretion, lower FFA concentrations in those with the variant
allele may, in turn, cause decreased insulin release
(36, 37, 38).
Insulin resistance
Though previous studies have shown an association of the variant
allele with increased insulin resistance, no association of the variant
allele in homozygous or heterozygous form with decreased Si was found
in this study (Table 3
) (11, 12, 15). This also differs
from a recently published study of obese, postmenopausal women, by
Garcia-Rubi, et al., that has shown that prospectively
recruited women heterozygous for the allele were more insulin
resistant, by euglycemic clamp measurements, than those without the
variant allele (39). However, Urhammer, et al.,
in a cross-sectional study, demonstrated no difference in Si among
younger, lean Danes heterozygous for the Arg 64 allele, compared with
Trp 64 homozygotes (40). Other studies, evaluating
younger, leaner cohorts, have also identified no evidence of insulin
resistance between genotypes (19, 20). Thus, evidence from
our study and several others supports the concept that, in older and
more obese cohorts, Arg 64 genotype differences in insulin resistance
emerge that do not exist in younger and leaner cohorts.
Sg
Sg represents the ability of glucose to influence its own uptake
(41). The Sg value calculated by the minimal model method
is controversial (42, 43). Critics have maintained
that the value is overestimated, because it is not completely
independent of insulin secretion (43). Regardless of
whether this mathematical construct accurately reflects the absolute
value of Sg, it is likely that the B3AR plays an
indirect role in increasing glucose uptake independently of insulin
action. Sg increases with increased sympathetic nervous system
activity and is, in general, decreased in those with type 2 DM
(44). A less functional B3AR would
be expected to cause a decrease in Sg. Thus, although the physiology of
Sg is poorly understood, Sg may represent a third measurable component
of glucose metabolism by which decreased B3AR
activity, i.e. the Trp64Arg B3AR, accelerates the onset of
type 2 DM. The differences among genotypes identified here may also
provide a model to better study the role of the sympathetic nervous
system in glucose uptake, independent of insulin action.
Conclusion
A number of previous association studies have demonstrated an
earlier onset of type 2 DM in those with the Arg 64
B3AR allele. The results of this study
demonstrate, for the first time, a significant decrease in the acute
insulin response to glucose in individuals homozygous for the Arg 64
allele, which may, in part, explain the earlier onset of type 2 DM
observed in several association studies. Lower Sg in the Arg 64
homozygous subjects may be a second mechanism whereby the Trp 64Arg
variant affects glucose homeostasis. No differences in Si were observed
between the genotypes, which may be explained by the lower BMI and
comparative youthfulness of the prospectively recruited age-, gender-,
and BMI-matched cohort. This study is the first to demonstrate a role
for the B3AR in insulin secretion and Sg in
humans. Further study of B3AR expression and the influence of the
sympathetic nervous system on insulin secretion and Sg may help advance
our understanding of these processes, which may lead to more targeted
approaches for the prevention and treatment of type 2 DM.
 |
Acknowledgments
|
|---|
Special thanks to the Johns Hopkins Bayview GCRC (NIH
M01-RR-02719) for nursing, nutritionist, administrative, and core
laboratory support that made this study possible.
 |
Footnotes
|
|---|
1 Supported in part by funds from the American Diabetes Association
(to J.W., H.H., and M.S.), Paul Beeson Faculty Scholars program (to
J.W. and A.R.S.), the Brookdale Foundation (to J.W. and B.B.), and the
NIH (Grant DK-52752; to J.W., K.S., E.P., and A.R.S.). 
2 Recipient of Clinical Associate Physician Award
3M-01-RR-2719-1153. 
Received March 28, 2000.
Revised July 5, 2000.
Accepted July 12, 2000.
 |
References
|
|---|
-
King H, Rewers M. 1993 Global estimates for
prevalence of diabetes mellitus and impaired glucose tolerance in
adults. WHO Ad Hoc Diabetes Reporting Group [see
Comments]. Diabetes Care. 16:157177.[Abstract]
-
Harris MI, Hadden WC, Knowler WC, Bennett PH. 1987 Prevalence of diabetes and impaired glucose tolerance and plasma
glucose levels in U.S. population aged 2074 yr. Diabetes. 36:523534.[Abstract]
-
Vionnet N, Stoffel M, Takeda J, et al. 1992 Nonsense mutation in the glucokinase gene causes early-onset
non-insulin-dependent diabetes mellitus. Nature. 356:721722.[CrossRef][Medline]
-
Froguel, P, Zouali H, Vionnet N, et al. 1993 Familial hyperglycemia due to mutations in glucokinase. Definition of a
subtype of diabetes mellitus [see Comments]. N Engl J Med. 328:697702.[Abstract/Free Full Text]
-
Taylor SI, Cama A, Accili D, et al. 1992 Mutations
in the insulin receptor gene. [Review] [197 refs]. Endocr Rev. 13:566595.[Abstract/Free Full Text]
-
Kadowaki T, Kadowaki H, Mori Y, et al. 1994 A
subtype of diabetes mellitus associated with a mutation of
mitochondrial DNA. N Engl J Med. 330:962968.[Abstract/Free Full Text]
-
Rotter J, Vadheim C, Rimoin D. 1990 Genetics of
diabetes mellitus. In: Rifkin H, Porte Jr D, eds. Diabetes mellitus:
theory and practice. Amsterdam: Elsevier; 378413.
-
Shuldiner AR, Silver K. 1996 Candidate genes for
type II diabetes mellitus. In: LeRoith D, Olefsky J, Taylor S, eds.
Diabetes mellitus: a fundamental and clinical text. Lippincott Company;
565574.
-
Silver K, Walston J, Wang Y, Dowse G, Zimmet P,
Shuldiner AR. 1996 Molecular scanning for mutations in the ß
3-adrenergic receptor gene in Nauruans with obesity and
non-insulin-dependent diabetes mellitus. J Clin Endocrinol Metab. 81:41554158.[Abstract/Free Full Text]
-
Walston J, Silver K, Bogardus C, et al. 1995 Time
of onset of non-insulin-dependent diabetes mellitus and genetic
variation in the ß 3-adrenergic- receptor gene [see Comments]. N Engl J Med. 333:343347.[Abstract/Free Full Text]
-
Sakane N, Yoshida T, Yoshioka K, et al. 1996 Genetic variation in the ß 3-adrenergic receptor in Japanese NIDDM
patients [Letter; Comment]. Diabetes Care.19:10341035.
-
Widen E, Lehto M, Kanninen T, Walston J, Shuldiner AR,
Groop LC. 1995 Association of a polymorphism in the ß
3-adrenergic-receptor gene with features of the insulin resistance
syndrome in Finns [see Comments]. N Engl J Med. 333:348351.[Abstract/Free Full Text]
-
Silver K, Mitchell BD, Walston J, et al. 1997 TRP64ARG ß 3-adrenergic receptor and obesity in Mexican Americans. Hum Genet. 101:306311.[CrossRef][Medline]
-
Yoshida T, Sakane N, Umekawa T, Sakai M, Takahashi T,
Kondo M. 1995 Mutation of ß 3-adrenergic-receptor gene and
response to treatment of obesity [Letter]. Lancet. 346:14331434.[Medline]
-
Kadowaki H., Yasuda K, Iwamoto K, et al. 1995 A
mutation in the ß 3- adrenergic receptor gene is associated with
obesity and hyperinsulinemia in Japanese subjects. Biochem Biophys Res
Commun. 215:555560.[CrossRef][Medline]
-
Clement K, Vaisse C, Manning BS, et al. 1995 Genetic variation in the ß 3-adrenergic receptor and an increased
capacity to gain weight in patients with morbid obesity [see
Comments]. N Engl J Med. 333:352354.[Abstract/Free Full Text]
-
Kurabayashi T, Carey DG, Morrison NA. 1996 The ß
3-adrenergic receptor gene Trp64Arg mutation is overrepresented in
obese women. Effects on weight, BMI, abdominal fat, blood pressure, and
reproductive history in an elderly Australian population. Diabetes. 45:13581363.[Abstract]
-
Gagnon J, Mauriege P, Roy S, et al. 1996 The
Trp64Arg mutation of the ß 3-adrenergic receptor gene has no effect
on obesity phenotypes in the Quebec Family Study and Swedish Obese
Subjects cohorts. J Clin Invest. 98:20862093.[Medline]
-
Elbein SC, Hoffman M, Barrett K, et al. 1996 Role
of the ß 3-adrenergic receptor locus in obesity and
non-insulin-dependent diabetes among members of Caucasian families with
a diabetic sibling pair. J Clin Endocrinol Metab. 81:44224427.[Abstract]
-
Awata T, Katayama S. 1996 Genetic variation in the
ß 3-adrenergic receptor in Japanese NIDDM patients [Letter] [see
Comments]. Diabetes Care. 19:271272.
-
Shuldiner AR, Silver K, Roth J, Walston J. 1996 ß
3-Adrenoceptor gene variant in obesity and insulin resistance [Letter;
Comment]. Lancet. 348:15841585.[Medline]
-
Candelore MR, Deng L, Tota ZM, Kelly LJ, Cascieri MA,
Strader CD. 1996 Pharmacological characterization of a recently
described human ß-3-adrenergic receptor mutant. Endocrinology. 137:16382641.
-
Pietri-Rouxel F, St. John MB, Gros J, Strosberg AD. 1997 The biochemical effect of the naturally occurring Trp64>Arg
mutation on human ß 3-adrenoceptor activity. Eur J Biochem. 247:11741179.[Medline]
-
Kimura K, Sasaki N, Asano A, et al. 2000 Mutated
human ß-3-adrenergic receptor (Trp64Arg) lowers the response to
ß-3-adrenergic agonist in transfected 3T3-LI preadipocytes. Horm
Metab Res. 32:9196.
-
Umekawa T, Yoshida T, Sakane N, Kogure A, Kondo M,
Honjyo H. 1999 Trp64Arg mutation of ß 3-adrenoceptor gene
deteriorates lipolysis induced by ß 3-adrenoceptor agonist in human
omental adipocytes. Diabetes. 48:117120.[Abstract]
-
Hoffstedt J, Poirier O, Thorne A, et al. 1999 Polymorphism of the human ß 3-adrenoceptor gene forms a
well-conserved haplotype that is associated with moderate obesity and
altered receptor function. Diabetes. 48:203205.[Medline]
-
Yang YJ, Youn JH, Bergman RN. 1987 Modified
protocols improve insulin sensitivity estimation using the minimal
model. Am J Physiol. 253:E595E602.
-
Saad MF, Anderson RL, Laws A, et al. 1994 A
comparison between the minimal model and the glucose clamp in the
assessment of insulin sensitivity across the spectrum of glucose
tolerance. Insulin resistance atherosclerosis study. Diabetes. 43:11141121.[Abstract]
-
Pacini G, Bergman RN. 1986 MINMOD: a computer
program to calculate insulin sensitivity and pancreatic responsivity
from the frequently sampled intravenous glucose tolerance test. Comput
Methods Programs Biomed. 23:113122.[CrossRef][Medline]
-
Yoshida T, Yoshioka K, Hiraoka N, Umekawa T, Sakane N,
Kondo M. 1994. Effect of CL 316,243, a novel ß 3-adrenoceptor
agonist, on insulin secretion in perfused mouse pancreas. Endocr J. 41:671675.
-
Sennitt MV, Arch JR, Levy AL, Simson DL, Smith SA,
Cawthorne MA. 1985. Anti-hyperglycaemic action of BRL 26830,
a novel ß-adrenoceptor agonist, in mice and rats. Biochem Pharmacol. 34:12791285.
-
Grujic D, Susulic VS, Harper ME, et al 1997.
ß-3-Adrenergic receptors on white and brown adipocytes mediate ß
3-selective agonist-induced effects on energy expenditure, insulin
secretion, and food intake. A study using transgenic and gene knockout
mice. J Biol Chem. 272:1768617693.
-
Avogaro A, Toffolo G, Valerio A, Cobelli C. 1996 Epinephrine exerts opposite effects on peripheral glucose disposal and
glucose-stimulated insulin secretion. A stable label intravenous
glucose tolerance test minimal model study. Diabetes. 45:13731378.[Abstract]
-
Lacey RJ, Cable HC, James RF, London NJ, Scarpello JH,
Morgan NG. 1993 Concentration-dependent effects of adrenaline on
the profile of insulin secretion from isolated human islets of
Langerhans. J Endocrinol. 138:555563.[Abstract/Free Full Text]
-
Rasmussen H, Zawalich KC, Ganesan S, Calle R, Zawalich
WS. 1990 Physiology and pathophysiology of insulin secretion.
[Review] [60 refs]. Diabetes Care. 13:655666.[Abstract]
-
Carpentier A, Mittelman SD, Lamarche B, Bergman RN,
Giacca A, Lewis GF. 1999 Acute enhancement of insulin secretion by
FFA in humans is lost with prolonged FFA elevation. Am J Physiol.
276:E1055E1066.
-
Bollheimer LC, Skelly RH, Chester MW, McGarry JD, Rhodes
CJ. 1998 Chronic exposure to free fatty acid reduces pancreatic
ß cell insulin content by increasing basal insulin secretion that is
not compensated for by a corresponding increase in proinsulin
biosynthesis translation. J Clin Invest. 101:10941101.[Medline]
-
Dobbins RL, Chester MW, Daniels MB, McGarry TD, Stein
DT. 1998 Circulating fatty acids are essential for efficient
glucose-stimulated insulin secretion after prolonged fasting in humans.
Diabetes 47:16131618.
-
Garcia-Rubi E, Starling RD, Tchernof A, et al. 1998 Trp64Arg variant of the ß 3-adrenoceptor and insulin resistance in
obese postmenopausal women. J Clin Endocrinol Metab. 83:40024005.[Abstract/Free Full Text]
-
Urhammer SA, Clausen JO, Hansen T, Pedersen O. 1996 Insulin sensitivity and body weight changes in young white carriers of
the codon 64 amino acid polymorphism of the ß 3-adrenergic receptor
gene. Diabetes. 45:11151120.[Abstract]
-
Best JD, Kahn SE, Ader M, Watanabe RM, Ni TC, Bergman
RN. 1996 Role of glucose effectiveness in the determination of
glucose tolerance. [Review] [102 refs]. Diabetes Care. 19:10181030.[Medline]
-
Cobelli C, Bettini F, Caumo A, Quon MJ. 1998 Overestimation of minimal model glucose effectiveness in presence of
insulin response is due to undermodeling. Am J Physiol.
275:E1031E1036.
-
Regittnig W, Trajanoski Z, Leis HJ, et al. 1999 Plasma and interstitial glucose dynamics after intravenous glucose
injection: evaluation of the single-compartment glucose
distribution assumption in the minimal models. Diabetes. 48:10701081.[Abstract]
-
Walters JM, Ward GM, Barton J, et al. 1997 The
effect of norepinephrine on insulin secretion and glucose effectiveness
in non-insulin-dependent diabetes. Metab Clin Exp. 46:14481453.
This article has been cited by other articles:

|
 |

|
 |
 
S. L. Kirstein and P. A. Insel
Autonomic Nervous System Pharmacogenomics: A Progress Report
Pharmacol. Rev.,
March 1, 2004;
56(1):
31 - 52.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Korc
Diabetes Mellitus in the Era of Proteomics
Mol. Cell. Proteomics,
June 1, 2003;
2(6):
399 - 404.
[Full Text]
[PDF]
|
 |
|