help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Walston, J.
Right arrow Articles by Shuldiner, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Walston, J.
Right arrow Articles by Shuldiner, A. R.
The Journal of Clinical Endocrinology & Metabolism Vol. 85, No. 11 4019-4022
Copyright © 2000 by The Endocrine Society

From the Clinical Research Centers

Insulin Response to Glucose Is Lower in Individuals Homozygous for the Arg 64 Variant of the ß-3-Adrenergic Receptor1

Jeremy Walston, Kristi Silver2, Heather Hilfiker, Ross E. Andersen, Michael Seibert, Brock Beamer, Jesse Roth, Eric Poehlman and Alan R. Shuldiner

Division of Geriatric Medicine and Gerontology (J.W., H.H., M.S., R.E.A., B.B., J.R.), Johns Hopkins University School of Medicine, Baltimore, Maryland 21224; Department of Medicine (A.R.S., K.S.), Division of Endocrinology, Diabetes and Nutrition at the University of Maryland, Baltimore, Maryland; and the Department of Medicine (E.P.), University of Vermont, Burlington, Vermont

Address correspondence and requests for reprints to: Jeremy Walston, M.D., Johns Hopkins Asthma and Allergy Center, Room 5A.24, 5501 Hopkins Bayview Circle, Baltimore, Maryland 21224. Email: jwalston@welch.jhu.edu.


   Abstract
Top
 Abstract
Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Type 2 diabetes mellitus (type 2 DM) is a polygenic disorder with a variable phenotype that includes both insulin resistance and insulin secretory dysfunction. The Arg 64 ß-3-adrenergic receptor variant allele is associated with an earlier age of onset of type 2 DM. The purpose of this study was to examine the in vivo pathophysiology of this variant allele to determine its contribution to the components of glucose metabolism. We used the frequently sampled iv glucose tolerance tests, minimal model analysis, and analysis of covariance to examine age- and fat-mass-adjusted differences among genotypes. The results demonstrate that individuals homozygous for the Arg 64 allele secrete significantly less insulin in response to a glucose infusion (562 ± 116 vs. 962 ± 94 pmol/µL), have the highest fasting glucose levels (100.4 ± 1.9 vs. 92.48 ± 1.60 mg/dL), and have lower glucose effectiveness (0.014 ± 0.003 vs. 0.019 ± 0.002 min-1), compared with those homozygous for the Trp 64 allele. This first report of decreased acute insulin release and lower glucose effectiveness in the Arg 64 genotype may help explain the earlier onset of type 2 DM observed in several populations of individuals with the Arg64 ß-3-adrenergic receptor variant allele.


   Introduction
Top
 Abstract
 Introduction
Subjects and Methods
 Results
 Discussion
 References
 
TYPE 2 DIABETES mellitus (type 2 DM) is an increasingly common metabolic disorder with a significant genetic component (1 , 2). Although some rare monogenic syndromes similar to type 2 DM have been identified, the most common human phenotype, characterized by central obesity, insulin resistance, and later by ß-cell failure, does not exhibit simple Mendelian inheritance (3, 4, 5, 6). Rather, several gene variants, each with a modest effect, likely influence the development of both insulin resistance and insulin secretion abnormalities via several molecular pathways (7, 8).

One such gene variant that is very common in diverse ethnic groups is the ß-3-adrenergic receptor (B3AR) Arg 64 allele (9). This Arg 64 allele was initially shown to associate with an earlier onset of type 2 DM in Pima Indians homozygous for the variant allele, and later studies confirmed these findings in diabetic Finns, Mexican Americans, and Japanese cohorts (9, 10, 11, 12, 13). Other population-based studies have identified significant associations between this allele and other metabolic alterations linked to obesity and type 2 DM, including central obesity (12, 14), insulin resistance (12, 15), and increased rate of weight gain (15, 16, 17). There have also been a number of association studies that failed to show a relationship between the variant allele and traits related to diabetes and obesity (18, 19, 20). Differences in study design, ethnicity, age, gender, environment, and lack of statistical power to discern modest effects of the allele in some studies may help explain these equivocal results (21).

While one early study showed no differential response to the variant to a B3AR agonist, several more recent studies have shown differences between three genotypes (22). Two recent functional study indicates that the Arg64 B3AR has decreased ability to activate adenylyl cyclase in vitro (23, 24). Decreased ligand-stimulated lipolysis has been demonstrated in two populations using omental adipose tissue of humans with the variant allele, further suggesting functional consequences of this nonconservative amino acid substitution (25, 26). Although known physiologic precursors of type 2 DM include both insulin resistance and insulin secretory dysfunction, no studies have investigated alterations in insulin secretion as a possible mechanism of earlier onset of type 2 DM in those with the Arg 64 allele.

The goal of this study is to study subjects prospectively recruited based on B3AR genotype who are younger, less obese, and nondiabetic in order to help clarify the pathophysiological basis of the earlier onset of type 2 DM in subjects with the Arg 64 variant allele without the potential confounding effect of preexisting diabetes. The prospective study design has allowed us to more carefully control for variables that influence glucose metabolism, by measuring body composition with a dual-energy x-ray absorptiometry (DEXA) scan and monitoring dietary intake before the iv glucose tolerance test (IVGTT). This study design has allowed us to study a large number of Arg 64 homozygous subjects, and this is the first study of prospectively recruited subjects homozygous or heterozygous for the Arg 64 allele to directly measure insulin secretion.


   Subjects and Methods
Top
 Abstract
 Introduction
 Subjects and Methods
Results
 Discussion
 References
 
Human subjects

All protocols were approved by the Johns Hopkins Bayview Campus Institutional Review Board, and all subjects gave written informed consent for genotyping and for the clinical portion of the study. Most were recruited at Baltimore metropolitan area health care centers, community health fairs, and medical school campuses. Those found to be homozygous for the Arg 64 variant allele were contacted by telephone and asked to participate in the IVGTT portion of the study at the Johns Hopkins Bayview Medical Center General Clinical Research Center (GCRC). Age-, gender-, and ethnic group-matched individuals with the Trp/Trp and Trp/Arg genotypes were identified and asked to participate in the clinical protocol. Individuals who were diabetic or severely or morbidly obese [body mass index (BMI) > 35 kg/m2] were excluded from the clinical portion of the protocol because of the confounding influences of diabetes treatment, insulin resistance, and secondary effects on insulin secretion that are associated with obesity and diabetes.

Methods

After a finger prick with a lancet device, several drops of blood were collected and stored in 1% EDTA. Genomic DNA was extracted using the QIAamp Blood Kit (QIAGEN, Santa Clarita, CA). The B3AR genotype was determined by PCR/restriction fragment length polymorphism assay developed in our laboratory using upstream primer 5' (CGCCCAATACCGCCAACAC) 3' and downstream primer 5' (CCACCAGGAGTCCCATCACC) 3', standard PCR reagents and conditions, and restriction enzyme digestion using BST N1 (New England Biolabs, Inc., Beverly, MA) (12).

All subjects invited for further study were instructed to ingest a carbohydrate-rich diet (250–300 g/day for 3 days) and then fast for 12 h before coming to the Johns Hopkins Bayview GCRC. Follow-up of dietary logs by a registered GCRC dietitian confirmed the appropriate carbohydrate intake in all study subjects. Anthropomorphic measurements were taken at the time of admission. Fat mass and lean body mass were determined by DEXA using a Hologic, Inc. QDR 4500 with Hologic, Inc. Body Composition Software (Hologic, Inc., Chatham, MA). For the frequently sampled insulin-modified IVGTT, two 18-gauge antecubital iv catheters were inserted, and normal saline solution was infused at a rate of 75 mL/h (27, 28). Baseline samples were drawn at -15, -10, -5, and -1 min for fasting glucose and insulin measurements. A 50%-dextrose solution was infused into the contralateral arm at time point 0, over approximately 2 min, with the quantity in grams determined by body weight in kilograms x 0.6. Three-milliliter blood samples were drawn over the next 180 min at time points 2, 3, 4, 5, 6, 8, 10, 14, 19, 22, 25, 30, 40, 50, 70, 100, 130, 160, and 180 min. Plasma glucose was measured during the study with a Glucose Analyzer 2 (Beckman Instruments, Inc., Brea, CA). Insulin and leptin levels were measured later from frozen plasma, in the GCRC core laboratory, using the human insulin-specific RIA and human leptin RIA kits (Linco Research, Inc., St. Charles, MO).

Insulin and glucose data were entered into the minimal model analysis (MINMOD) program; and values for acute insulin release in response to a glucose bolus (AIRg), insulin sensitivity (Si), disposition index (AIRg x Si), and glucose effectiveness (Sg) were calculated (29). Analysis of covariance was used to examine differences among genotypes, with adjustment for fat mass, age, and BMI. Results are reported as adjusted means ± SE.


   Results
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
Discussion
 References
 
We identified 20 Arg 64 homozygotes and 186 heterozygotes from 2800 screened subjects, for a total allele frequency of 0.09. Thirteen of the Arg 64 homozygous subjects agreed to participate in the clinical part of the study; and age-, gender-, and BMI-matched heterozygotes and normal homozygotes were identified from the database and were asked to participate. Of the 62 subjects studied, 35 (66%) were Caucasian, 10 (20%) were African American, 8 (16%) were Asian, and 2 (4%) were Hispanic. Baseline clinical characteristics of the subjects who were selected for the study are shown in Table 1Go. Because of the study design, which matched individuals by BMI and age, there were no significant differences in these values among genotypes. There were also no significant differences in lean and fat mass, by DEXA scan, among genotypes.


View this table:
[in this window]
[in a new window]
  		Table 1. Clinical characteristics by ß3AR genotype of those completing IVGTT

 
Individuals homozygous for the Arg 64 allele secreted significantly less insulin in response to a glucose bolus (AIRg) than did those homozygous for the Trp allele, with the heterozygous individuals at an intermediate level (Table 2Go). There were no significant differences in Si, as determined by the MINMOD, among the three groups (Table 3Go). The disposition index (Di), calculated by multiplying acute insulin release by the Si value, approached statistical significance, with Arg 64 homozygotes tending to have a lower Di (Table 3Go). Sg, a calculated value that represents the ability of glucose to promote its uptake independently from the effect of insulin, was lowest in the Arg/Arg group and highest in the Trp/Trp group. In accord with the IVGTT results, the Arg/Arg group had a significantly higher level of fasting glucose, compared with the Trp/Trp group; and the Trp/Arg group had the lowest levels of fasting insulin (Table 2Go). There were no differences in plasma leptin levels between groups (Table 2Go). There were no significant differences between men and women in the glucose metabolism measurements (data not shown).


View this table:
[in this window]
[in a new window]
  		Table 2. Age and total fat mass adjusted mean (±SE) glucose, insulin, and leptin, by ß3AR genotype

 

View this table:
[in this window]
[in a new window]
  		Table 3. Summary of IVGTT results by ß3AR genotype

 

   Discussion
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
References
 
Insulin secretion

The major new finding of this study is that individuals homozygous for the Arg 64 allele secrete significantly lower amounts of insulin in response to a glucose bolus, compared with those homozygous for the Trp 64 allele. This result may help explain the earlier onset of type 2 DM observed in several association studies (9, 10, 11, 12, 13). Although B3ARs have not been clearly identified on islet cells, evidence from several studies in rodents suggests that they may play a role in insulin release. Two studies in both mice and rats have linked specific B3AR agonists to increased insulin secretion (30 , 31). Furthermore, a B3AR knockout mouse model showed a markedly decreased ability to secrete insulin in response to a B3AR agonist (32). A response to the agonist was, in part, restored in mice with selective expression of B3AR in white adipose tissue (32).

Although the mechanisms by which the B3AR may influence insulin secretion is unknown, epinephrine is known to impair glucose tolerance in humans, whereas it potentiates glucose-stimulated insulin secretion from ß-cells (33, 34). Increased cAMP generation is important in both first- and second-phase insulin secretion (35). In two of three published studies, the variant receptor has been shown in vitro to lead to decreased cAMP generation (24). If lower levels of cAMP are present in ß-cells of individuals with the variant B3AR, then insulin release could be decreased. Further studies of the expression of the receptor in islet cells may help elucidate the role of the autonomic nervous system and B3AR on insulin secretion.

Indirect mechanisms may also influence insulin release in the acute phase. The B3AR is expressed in visceral fat; and lipolysis studies, in response to a specific B3AR agonist in human omental fat, have revealed a significantly lower lipolysis rate in Arg 64 homozygote fat samples (25, 26). Because free fatty acids (FFA) in the portal system enhance acute insulin secretion, lower FFA concentrations in those with the variant allele may, in turn, cause decreased insulin release (36, 37, 38).

Insulin resistance

Though previous studies have shown an association of the variant allele with increased insulin resistance, no association of the variant allele in homozygous or heterozygous form with decreased Si was found in this study (Table 3Go) (11, 12, 15). This also differs from a recently published study of obese, postmenopausal women, by Garcia-Rubi, et al., that has shown that prospectively recruited women heterozygous for the allele were more insulin resistant, by euglycemic clamp measurements, than those without the variant allele (39). However, Urhammer, et al., in a cross-sectional study, demonstrated no difference in Si among younger, lean Danes heterozygous for the Arg 64 allele, compared with Trp 64 homozygotes (40). Other studies, evaluating younger, leaner cohorts, have also identified no evidence of insulin resistance between genotypes (19, 20). Thus, evidence from our study and several others supports the concept that, in older and more obese cohorts, Arg 64 genotype differences in insulin resistance emerge that do not exist in younger and leaner cohorts.

Sg

Sg represents the ability of glucose to influence its own uptake (41). The Sg value calculated by the minimal model method is controversial (42, 43). Critics have maintained that the value is overestimated, because it is not completely independent of insulin secretion (43). Regardless of whether this mathematical construct accurately reflects the absolute value of Sg, it is likely that the B3AR plays an indirect role in increasing glucose uptake independently of insulin action. Sg increases with increased sympathetic nervous system activity and is, in general, decreased in those with type 2 DM (44). A less functional B3AR would be expected to cause a decrease in Sg. Thus, although the physiology of Sg is poorly understood, Sg may represent a third measurable component of glucose metabolism by which decreased B3AR activity, i.e. the Trp64Arg B3AR, accelerates the onset of type 2 DM. The differences among genotypes identified here may also provide a model to better study the role of the sympathetic nervous system in glucose uptake, independent of insulin action.

Conclusion

A number of previous association studies have demonstrated an earlier onset of type 2 DM in those with the Arg 64 B3AR allele. The results of this study demonstrate, for the first time, a significant decrease in the acute insulin response to glucose in individuals homozygous for the Arg 64 allele, which may, in part, explain the earlier onset of type 2 DM observed in several association studies. Lower Sg in the Arg 64 homozygous subjects may be a second mechanism whereby the Trp 64Arg variant affects glucose homeostasis. No differences in Si were observed between the genotypes, which may be explained by the lower BMI and comparative youthfulness of the prospectively recruited age-, gender-, and BMI-matched cohort. This study is the first to demonstrate a role for the B3AR in insulin secretion and Sg in humans. Further study of B3AR expression and the influence of the sympathetic nervous system on insulin secretion and Sg may help advance our understanding of these processes, which may lead to more targeted approaches for the prevention and treatment of type 2 DM.


   Acknowledgments
 
Special thanks to the Johns Hopkins Bayview GCRC (NIH M01-RR-02719) for nursing, nutritionist, administrative, and core laboratory support that made this study possible.


   Footnotes
 
1 Supported in part by funds from the American Diabetes Association (to J.W., H.H., and M.S.), Paul Beeson Faculty Scholars program (to J.W. and A.R.S.), the Brookdale Foundation (to J.W. and B.B.), and the NIH (Grant DK-52752; to J.W., K.S., E.P., and A.R.S.). Back

2 Recipient of Clinical Associate Physician Award 3M-01-RR-2719-1153. Back

Received March 28, 2000.

Revised July 5, 2000.

Accepted July 12, 2000.


   References
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. King H, Rewers M. 1993 Global estimates for prevalence of diabetes mellitus and impaired glucose tolerance in adults. WHO Ad Hoc Diabetes Reporting Group [see Comments]. Diabetes Care. 16:157–177.[Abstract]
  2. Harris MI, Hadden WC, Knowler WC, Bennett PH. 1987 Prevalence of diabetes and impaired glucose tolerance and plasma glucose levels in U.S. population aged 20–74 yr. Diabetes. 36:523–534.[Abstract]
  3. Vionnet N, Stoffel M, Takeda J, et al. 1992 Nonsense mutation in the glucokinase gene causes early-onset non-insulin-dependent diabetes mellitus. Nature. 356:721–722.[CrossRef][Medline]
  4. Froguel, P, Zouali H, Vionnet N, et al. 1993 Familial hyperglycemia due to mutations in glucokinase. Definition of a subtype of diabetes mellitus [see Comments]. N Engl J Med. 328:697–702.[Abstract/Free Full Text]
  5. Taylor SI, Cama A, Accili D, et al. 1992 Mutations in the insulin receptor gene. [Review] [197 refs]. Endocr Rev. 13:566–595.[Abstract/Free Full Text]
  6. Kadowaki T, Kadowaki H, Mori Y, et al. 1994 A subtype of diabetes mellitus associated with a mutation of mitochondrial DNA. N Engl J Med. 330:962–968.[Abstract/Free Full Text]
  7. Rotter J, Vadheim C, Rimoin D. 1990 Genetics of diabetes mellitus. In: Rifkin H, Porte Jr D, eds. Diabetes mellitus: theory and practice. Amsterdam: Elsevier; 378–413.
  8. Shuldiner AR, Silver K. 1996 Candidate genes for type II diabetes mellitus. In: LeRoith D, Olefsky J, Taylor S, eds. Diabetes mellitus: a fundamental and clinical text. Lippincott Company; 565–574.
  9. Silver K, Walston J, Wang Y, Dowse G, Zimmet P, Shuldiner AR. 1996 Molecular scanning for mutations in the ß 3-adrenergic receptor gene in Nauruans with obesity and non-insulin-dependent diabetes mellitus. J Clin Endocrinol Metab. 81:4155–4158.[Abstract/Free Full Text]
  10. Walston J, Silver K, Bogardus C, et al. 1995 Time of onset of non-insulin-dependent diabetes mellitus and genetic variation in the ß 3-adrenergic- receptor gene [see Comments]. N Engl J Med. 333:343–347.[Abstract/Free Full Text]
  11. Sakane N, Yoshida T, Yoshioka K, et al. 1996 Genetic variation in the ß 3-adrenergic receptor in Japanese NIDDM patients [Letter; Comment]. Diabetes Care.19:1034–1035.
  12. Widen E, Lehto M, Kanninen T, Walston J, Shuldiner AR, Groop LC. 1995 Association of a polymorphism in the ß 3-adrenergic-receptor gene with features of the insulin resistance syndrome in Finns [see Comments]. N Engl J Med. 333:348–351.[Abstract/Free Full Text]
  13. Silver K, Mitchell BD, Walston J, et al. 1997 TRP64ARG ß 3-adrenergic receptor and obesity in Mexican Americans. Hum Genet. 101:306–311.[CrossRef][Medline]
  14. Yoshida T, Sakane N, Umekawa T, Sakai M, Takahashi T, Kondo M. 1995 Mutation of ß 3-adrenergic-receptor gene and response to treatment of obesity [Letter]. Lancet. 346:1433–1434.[Medline]
  15. Kadowaki H., Yasuda K, Iwamoto K, et al. 1995 A mutation in the ß 3- adrenergic receptor gene is associated with obesity and hyperinsulinemia in Japanese subjects. Biochem Biophys Res Commun. 215:555–560.[CrossRef][Medline]
  16. Clement K, Vaisse C, Manning BS, et al. 1995 Genetic variation in the ß 3-adrenergic receptor and an increased capacity to gain weight in patients with morbid obesity [see Comments]. N Engl J Med. 333:352–354.[Abstract/Free Full Text]
  17. Kurabayashi T, Carey DG, Morrison NA. 1996 The ß 3-adrenergic receptor gene Trp64Arg mutation is overrepresented in obese women. Effects on weight, BMI, abdominal fat, blood pressure, and reproductive history in an elderly Australian population. Diabetes. 45:1358–1363.[Abstract]
  18. Gagnon J, Mauriege P, Roy S, et al. 1996 The Trp64Arg mutation of the ß 3-adrenergic receptor gene has no effect on obesity phenotypes in the Quebec Family Study and Swedish Obese Subjects cohorts. J Clin Invest. 98:2086–2093.[Medline]
  19. Elbein SC, Hoffman M, Barrett K, et al. 1996 Role of the ß 3-adrenergic receptor locus in obesity and non-insulin-dependent diabetes among members of Caucasian families with a diabetic sibling pair. J Clin Endocrinol Metab. 81:4422–4427.[Abstract]
  20. Awata T, Katayama S. 1996 Genetic variation in the ß 3-adrenergic receptor in Japanese NIDDM patients [Letter] [see Comments]. Diabetes Care. 19:271–272.
  21. Shuldiner AR, Silver K, Roth J, Walston J. 1996 ß 3-Adrenoceptor gene variant in obesity and insulin resistance [Letter; Comment]. Lancet. 348:1584–1585.[Medline]
  22. Candelore MR, Deng L, Tota ZM, Kelly LJ, Cascieri MA, Strader CD. 1996 Pharmacological characterization of a recently described human ß-3-adrenergic receptor mutant. Endocrinology. 137:1638–2641.
  23. Pietri-Rouxel F, St. John MB, Gros J, Strosberg AD. 1997 The biochemical effect of the naturally occurring Trp64–>Arg mutation on human ß 3-adrenoceptor activity. Eur J Biochem. 247:1174–1179.[Medline]
  24. Kimura K, Sasaki N, Asano A, et al. 2000 Mutated human ß-3-adrenergic receptor (Trp64Arg) lowers the response to ß-3-adrenergic agonist in transfected 3T3-LI preadipocytes. Horm Metab Res. 32:91–96.
  25. Umekawa T, Yoshida T, Sakane N, Kogure A, Kondo M, Honjyo H. 1999 Trp64Arg mutation of ß 3-adrenoceptor gene deteriorates lipolysis induced by ß 3-adrenoceptor agonist in human omental adipocytes. Diabetes. 48:117–120.[Abstract]
  26. Hoffstedt J, Poirier O, Thorne A, et al. 1999 Polymorphism of the human ß 3-adrenoceptor gene forms a well-conserved haplotype that is associated with moderate obesity and altered receptor function. Diabetes. 48:203–205.[Medline]
  27. Yang YJ, Youn JH, Bergman RN. 1987 Modified protocols improve insulin sensitivity estimation using the minimal model. Am J Physiol. 253:E595–E602.
  28. Saad MF, Anderson RL, Laws A, et al. 1994 A comparison between the minimal model and the glucose clamp in the assessment of insulin sensitivity across the spectrum of glucose tolerance. Insulin resistance atherosclerosis study. Diabetes. 43:1114–1121.[Abstract]
  29. Pacini G, Bergman RN. 1986 MINMOD: a computer program to calculate insulin sensitivity and pancreatic responsivity from the frequently sampled intravenous glucose tolerance test. Comput Methods Programs Biomed. 23:113–122.[CrossRef][Medline]
  30. Yoshida T, Yoshioka K, Hiraoka N, Umekawa T, Sakane N, Kondo M. 1994. Effect of CL 316,243, a novel ß 3-adrenoceptor agonist, on insulin secretion in perfused mouse pancreas. Endocr J. 41:671–675.
  31. Sennitt MV, Arch JR, Levy AL, Simson DL, Smith SA, Cawthorne MA. 1985. Anti-hyperglycaemic action of BRL 26830, a novel ß-adrenoceptor agonist, in mice and rats. Biochem Pharmacol. 34:1279–1285.
  32. Grujic D, Susulic VS, Harper ME, et al 1997. ß-3-Adrenergic receptors on white and brown adipocytes mediate ß 3-selective agonist-induced effects on energy expenditure, insulin secretion, and food intake. A study using transgenic and gene knockout mice. J Biol Chem. 272:17686–17693.
  33. Avogaro A, Toffolo G, Valerio A, Cobelli C. 1996 Epinephrine exerts opposite effects on peripheral glucose disposal and glucose-stimulated insulin secretion. A stable label intravenous glucose tolerance test minimal model study. Diabetes. 45:1373–1378.[Abstract]
  34. Lacey RJ, Cable HC, James RF, London NJ, Scarpello JH, Morgan NG. 1993 Concentration-dependent effects of adrenaline on the profile of insulin secretion from isolated human islets of Langerhans. J Endocrinol. 138:555–563.[Abstract/Free Full Text]
  35. Rasmussen H, Zawalich KC, Ganesan S, Calle R, Zawalich WS. 1990 Physiology and pathophysiology of insulin secretion. [Review] [60 refs]. Diabetes Care. 13:655–666.[Abstract]
  36. Carpentier A, Mittelman SD, Lamarche B, Bergman RN, Giacca A, Lewis GF. 1999 Acute enhancement of insulin secretion by FFA in humans is lost with prolonged FFA elevation. Am J Physiol. 276:E1055–E1066.
  37. Bollheimer LC, Skelly RH, Chester MW, McGarry JD, Rhodes CJ. 1998 Chronic exposure to free fatty acid reduces pancreatic ß cell insulin content by increasing basal insulin secretion that is not compensated for by a corresponding increase in proinsulin biosynthesis translation. J Clin Invest. 101:1094–1101.[Medline]
  38. Dobbins RL, Chester MW, Daniels MB, McGarry TD, Stein DT. 1998 Circulating fatty acids are essential for efficient glucose-stimulated insulin secretion after prolonged fasting in humans. Diabetes 47:1613–1618.
  39. Garcia-Rubi E, Starling RD, Tchernof A, et al. 1998 Trp64Arg variant of the ß 3-adrenoceptor and insulin resistance in obese postmenopausal women. J Clin Endocrinol Metab. 83:4002–4005.[Abstract/Free Full Text]
  40. Urhammer SA, Clausen JO, Hansen T, Pedersen O. 1996 Insulin sensitivity and body weight changes in young white carriers of the codon 64 amino acid polymorphism of the ß 3-adrenergic receptor gene. Diabetes. 45:1115–1120.[Abstract]
  41. Best JD, Kahn SE, Ader M, Watanabe RM, Ni TC, Bergman RN. 1996 Role of glucose effectiveness in the determination of glucose tolerance. [Review] [102 refs]. Diabetes Care. 19:1018–1030.[Medline]
  42. Cobelli C, Bettini F, Caumo A, Quon MJ. 1998 Overestimation of minimal model glucose effectiveness in presence of insulin response is due to undermodeling. Am J Physiol. 275:E1031–E1036.
  43. Regittnig W, Trajanoski Z, Leis HJ, et al. 1999 Plasma and interstitial glucose dynamics after intravenous glucose injection: evaluation of the single-compartment glucose distribution assumption in the minimal models. Diabetes. 48:1070–1081.[Abstract]
  44. Walters JM, Ward GM, Barton J, et al. 1997 The effect of norepinephrine on insulin secretion and glucose effectiveness in non-insulin-dependent diabetes. Metab Clin Exp. 46:1448–1453.



This article has been cited by other articles:


Home page
 Pharmacol. Rev.Home page
S. L. Kirstein and P. A. Insel
Autonomic Nervous System Pharmacogenomics: A Progress Report
Pharmacol. Rev., March 1, 2004; 56(1): 31 - 52.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. ProteomicsHome page
M. Korc
Diabetes Mellitus in the Era of Proteomics
Mol. Cell. Proteomics, June 1, 2003; 2(6): 399 - 404.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Walston, J.
Right arrow Articles by Shuldiner, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Walston, J.
Right arrow Articles by Shuldiner, A. R.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals