help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schaiff, W. T.
Right arrow Articles by Sadovsky, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schaiff, W. T.
Right arrow Articles by Sadovsky, Y.
The Journal of Clinical Endocrinology & Metabolism Vol. 85, No. 10 3874-3881
Copyright © 2000 by The Endocrine Society


Original Studies

Peroxisome Proliferator-Activated Receptor-{gamma} Modulates Differentiation of Human Trophoblast in a Ligand-Specific Manner1

W. Timothy Schaiff, Matthew G. Carlson, Steven D. Smith, Roni Levy, D. Michael Nelson and Yoel Sadovsky

Departments of Obstetrics and Gynecology and Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri 63110

Address all correspondence and requests for reprints to: Yoel Sadovsky, M.D., Department of Obstetrics and Gynecology, Washington University School of Medicine, 4566 Scott Avenue, St. Louis, Missouri 63110. E-mail: sadovskyy{at}msnotes.wustl.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The ligand-dependent nuclear receptor peroxisome proliferator-activated receptor-{gamma} (PPAR{gamma}) regulates the differentiation of several tissues and cell types. PPAR{gamma} was recently determined to be essential for murine placental development and differentiation. We therefore assessed the influence of PPAR{gamma} on differentiation of human placental trophoblasts. We initially used immunohistochemistry to examine term human placentas for PPAR{gamma} expression and found that PPAR{gamma} is present in syncytiotrophoblasts and cytotrophoblasts in placental villi. We correlated the expression of PPAR{gamma} with differentiation of primary human trophoblasts and found that 8-bromo-cAMP, a known enhancer of trophoblast differentiation, stimulates PPAR{gamma} activity, but has no effect on PPAR{gamma} expression. We demonstrated that the PPAR{gamma} ligand 15-deoxy-{Delta}12,14-prostaglandin J2 (15{Delta}PGJ2) and the thiazolidinedione troglitazone stimulate PPAR{gamma} activity in the trophoblast cell line BeWo. Importantly, whereas exposure of cultured primary trophoblasts to troglitazone enhances biochemical and morphological trophoblast differentiation, 15{Delta}PGJ2 diminishes trophoblast differentiation. Furthermore, 15{Delta}PGJ2, but not troglitazone, up-regulates p53 expression and promotes trophoblast apoptosis. These data indicate that PPAR{gamma} is expressed in human placental trophoblasts, and that ligand-specific activation of PPAR{gamma} results in opposing effects on trophoblast differentiation. Our results suggest that PPAR{gamma} plays an important role in placental differentiation during human pregnancy.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DURING INTRAUTERINE mammalian development, the fetus exchanges oxygen, nutrients, and waste products with the maternal circulation through the placenta. The syncytiotrophoblast is a multinucleated, terminally differentiated cell mass that covers the surface of placental villi and is therefore in direct contact with maternal blood. Subjacent to the syncytiotrophoblasts are mitotically active cytotrophoblasts that provide a stem cell population capable of terminal differentiation into syncytiotrophoblast through a process of cell-cell fusion. The differentiation of cytotrophoblasts into syncytiotrophoblasts is essential for placental function and, therefore, fetal development.

Peroxisome proliferator-activated receptors (PPARs) are members of the steroid receptor superfamily of nuclear receptors. They consist of three subtypes: PPAR{alpha}, PPAR{gamma}, and PPAR{delta} (1). Each subtype has a distinct tissue distribution, with PPAR{alpha} present in high levels in the kidney, heart, muscle, and liver (2, 3), whereas PPAR{delta} is present in most tissues (2, 4). PPAR{gamma}, in turn, is expressed predominantly in adipose tissue (2, 5, 6, 7) as well as in monocytes, tissue macrophages (8, 9), and placenta (10). Several naturally occurring ligands for PPAR{gamma} have been identified, including fatty acids (11), oxidized low density lipoprotein derivatives (12), and the PG metabolite 15-deoxy-{Delta}12,14-prostaglandin J2 (15{Delta}PGJ2) (13, 14). In addition, the antidiabetic thiazolidinedione drugs function as ligands for PPAR{gamma} (13, 15, 16). PPAR{gamma} plays a role in the differentiation of several cell types, including preadipocytes (5, 13, 17, 18), myoblasts (19), and monocytes (8), and in the terminal differentiation of breast cancer (20) and liposarcoma cells (7). Importantly, mice deficient in PPAR{gamma} exhibit abnormal placental development and trophoblast differentiation (21, 22). Specifically, the placentas of PPAR{gamma}-deficient embryos have a labyrinth that forms an excessively thick layer surrounding the chorionic villi and retains the immature characteristics of the early labyrinthine parenchyma instead of maturing into a normal trilaminar epithelial barrier (21). These placentas also exhibit anomalous placental vasculature. These developmental defects result in embryonic death on embryonic day 10, when maintenance of fetal metabolism transitions from the yolk sac to the labyrinthine placenta. These data underscore the role of PPAR{gamma} in terminal differentiation of murine placental trophoblasts.

Although PPAR{gamma} is essential for normal placental development and trophoblast differentiation in mice, the role of PPAR{gamma} in the human placenta is unknown. We hypothesized that PPAR{gamma} plays an important role in human trophoblast differentiation. Our data demonstrate that PPAR{gamma} is expressed in both cytotrophoblast and syncytiotrophoblast of human trophoblast, and that 8-bromo-cAMP (8-Br-cAMP), a known inducer of trophoblast differentiation, enhances PPAR{gamma} activity. Importantly, we discovered that two types of PPAR{gamma} ligands that stimulate PPAR{gamma} activity in trophoblasts have opposing effects on human trophoblasts, one promoting differentiation and the other hindering differentiation and promoting apoptosis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Immunohistochemistry

Our study was approved by the human studies committee of Washington University (St. Louis, MO). Placentas from term (>37 weeks) uncomplicated pregnancies were collected immediately after delivery, fixed for 1 h in 10% neutral buffered formalin, and embedded in paraffin. Five-micron sections were deparaffinized in xylene and rehydrated in an ethanol gradient. Endogenous peroxidase activity was quenched by incubating the specimens in 3% H2O2 in methanol for 30 min. After equilibrating for 5 min in distilled water, the samples were heated at maximum power in a microwave for 10 min. The slides were washed, blocked for 30 min with normal horse serum, and incubated for 2 h at room temperature with monoclonal mouse antihuman PPAR{gamma} (anti-PPAR{gamma} E-8, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) or with an isotype-matched control antibody supplied in the immunostaining kit (Santa Cruz Biotechnology, Inc.). In some experiments, the anti-PPAR{gamma} antibody was preincubated for 30 min at room temperature with a blocking peptide specific for the anti-PPAR{gamma} antibody (Santa Cruz Biotechnology, Inc.), at approximately 30-fold excess relative to the antigen-binding sites of the antibody. After washes, the slides were incubated for 30 min with a biotinylated antimouse secondary antibody (Vector Laboratories, Inc., Burlingame, CA), followed by 30-min incubation with avidin/biotin-horseradish peroxidase complex (Vector Laboratories, Inc.) and 3-min incubation with diaminobenzidene (Zymed Laboratories, Inc., South San Francisco, CA). The slides were rinsed and counterstained with Mayer’s hematoxylin (Sigma, St. Louis, MO), dehydrated in ethanol, cleared with xylene, and mounted with glass coverslips using Histomount (Zymed Laboratories, Inc.). Paraffin sections were stained for cyclin E as described above, except that monoclonal anticyclin E (Novocastra Laboratories, Newcastle upon Tyne, UK) was used as the primary antibody, Vector NovaRED (Vector Laboratories, Inc.) was used as the substrate, and the sections were not counterstained.

Cell cultures

Primary human cytotrophoblasts were prepared from normal term human placentas using the trypsin-deoxyribonuclease-dispase/Percoll method as described by Kliman (23) with previously published modifications (24). Cultures were plated at a density of 350,000 cells/cm2 and maintained in Earl’s medium 199 containing 10% FBS (HyClone Laboratories, Inc., Logan, UT), 20 mmol/L HEPES (pH 7.4), 0.5 mmol/L L-glutamine (Sigma), penicillin (10 U/mL), streptomycin (10 µg/mL), and fungizone (0.25 µg/mL). In some experiments trophoblasts were grown in Ham’s/Waymouth’s medium (H/W) composed of equal volumes of Ham’s F-12 medium and Waymouth’s medium, supplemented as described above for medium 199. All cultures were maintained at 37 C in a 5% CO2 atmosphere. Medium was changed every 24 h. Where indicated, cultures contained 8-Br-cAMP (Sigma), troglitazone (a gift from Parke-Davis, Ann Arbor, MI), 15-deoxy-{Delta}12,14-prostaglandin J2 (Cayman, Ann Arbor, MI), or bisphenol A diglycidyl ether (BADGE, Fluka, Milwaukee, WI). The choriocarcinoma cell line BeWo (25), provided by Dr. Alan Schwartz (Washington University, St. Louis, MO), was maintained in MEM{alpha} with 10% FBS and antibiotics.

Immunofluorescence and TUNEL

Primary trophoblasts were stained with antidesmosomal and antinuclear antibodies as previously described (24). Briefly, cells were fixed with -20 C methanol for 20 min. After rinsing in phosphate-buffered saline (PBS), the cells were blocked with 2% goat serum in staining buffer (PBS/0.2% BSA/0.02% sodium azide) for 35 min in a humidified chamber at 37 C, then incubated for 35 min at 37 C with a cocktail of monoclonal mouse antihuman desmosome antibody (Sigma) and human antinuclear antibody (Antibodies, Inc., Davis, CA), diluted in staining buffer. The plates were washed, then incubated with a cocktail of fluorescein isothiocyanate-goat antimouse IgG (Fab-specific, Sigma) and tetramethylrhodamine B isothiocyanate-goat antihuman IgG (Sigma) for an additional 35 min at 37 C. After washing, the cells were mounted with Gel/Mount (Biomeda, Foster City, CA) and viewed by epifluorescence using an MRC 1024 confocal microscope and LaserSharp version 3.2 software (Bio-Rad Laboratories, Inc., Hercules, CA). A syncytium was defined as three or more nuclei in the same cytoplasm without intervening surface desmosomal membrane staining. Quantitation was performed by counting the number of syncytia per random field and the number of nuclei per syncytium. Syncytia were counted only when they were entirely contained within the field. At least four fields were counted. Statistical analysis was performed using unpaired Student’s t test with StatView 4.0 software (Abacus Concepts, Berkeley, CA).

For terminal deoxynucleotidyltransferase-mediated deoxy-UTP nick end labeling (TUNEL) staining, cells were dried over a flame, and fixed in 4% formalin for 10 min. Endogenous peroxidase was quenched with 3% H2O2, and cells were washed with PBS. The ApopTag kit (Oncor, Gaithersburg, MD) was used for TUNEL staining. Briefly, cells were incubated in an equilibration buffer for 10 min and then in a 37 C humidified chamber for 1 h with terminal deoxynucleotidyltransferase and deoxy-UTP-digoxigenin. The reaction was stopped, and cells were washed and incubated with antidigoxigenin peroxidase solution, colorized with amino ethylcarbazole (Vector Laboratories, Inc.), counterstained with hematoxylin, and examined by brightfield microscopy. The apoptotic index was defined as the number of TUNEL-positive cells divided by the total number of cells counted.

Western blotting and densitometric analysis

The plates were rinsed with PBS and lysed with 250 µL cold lysis buffer (1% Nonidet P-40, 0.5% deoxycholate, and 0.1% SDS in PBS) containing a protease inhibitor cocktail (Sigma). The plates were scraped, and the lysate was sonicated three times for 10 s each time on ice with a Sonic Dismembrator 50 (Fisher, Pittsburgh, PA). The lysates were centrifuged, and 30 µg protein/lane were separated on 10% SDS-PAGE gels at 80 V for 3 h. After separation, the proteins were transferred to polyvinylidene difluoride membranes (Immobilon-P, Millipore Corp., Bedford, MA) for 3 h, 4 C at 400 mA. The blot was then rinsed briefly with 0.15 mol/L NaCl and 10 mmol/L Tris-HCl, pH 8.0, containing 0.2% Tween-20, blocked for 30 min with 5% powdered milk in 0.15 mol/L NaCl and 10 mmol/L Tris-HCl, pH 8.0, containing 0.2% Tween-20, then incubated overnight at 4 C with primary antibody (mouse monoclonal anti-PPAR{gamma} or mouse monoclonal anti-p53, Santa Cruz Biotechnology, Inc.). The blot was incubated for 1 h with horseradish peroxidase-conjugated goat antimouse IgG secondary antibody (Santa Cruz Biotechnology, Inc.), washed, and processed for luminescence using the Amersham Pharmacia Biotech ECL kit (Amersham Pharmacia Biotech, Arlington Heights, IL). Densitometric analysis was performed using a Molecular Dynamics, Inc. PD densitometer and ImageQuant version 3.3 software (Molecular Dynamics, Inc., Sunnyvale, CA).

hCG concentration determination

Culture supernatants were assayed for hCG using a microparticle immunoassay (Abbott Laboratories, Abbott Park, IL). Values represent hCG secreted per 24-h interval, normalized to total cellular DNA and expressed as the mean ± SD of duplicate samples.

Transient transfection and PPRE reporter assay

The PPREx3-Luc reporter plasmid was constructed by cloning three copies of the acyl-coenzyme A oxidase promoter PPAR response element (PPRE) plus eight nucleotides of the 5'-flanking sequence (AGGGGACCAGGACAAAGGTCA, where the PPRE DR-1 sequence is underlined) (26, 27, 28) into the BamHI polylinker site in a P36-Luc reporter (29) (gift from Dr. Stuart Adler, Washington University, St. Louis, MO) upstream of the firefly luciferase gene. The use of three PPRE elements in the reporter constructs had been previously described (13) and gives a more robust response than a single PPRE and thus a more accurate quantitation of PPAR{gamma} activity. Placental trophoblasts or BeWo cells were plated 1 day before transfection. Transfection was performed according to the calcium-phosphate precipitation method, previously described (30, 31), using 2.0 µg of either PPREx3-Luc or the parent P36 plasmid, 2.0 µg salmon sperm DNA, and 0.02 µg Rous sarcoma virus-ß-galactosidase reporter construct (to normalize for cell viability and transfection efficiency). The luciferase assay was performed 40–48 h after the transfection. Cells were lysed in a lysis buffer that contains 50 mmol/L Tris-2-[N-morpholino]ethanesulfonic acid (pH 7.8), 1 mmol/L dithiothreitol, and 1% Triton X-100. Lysates were assayed for luciferase using a luminometer (Monolight 2010, Analytical Luminescence Laboratory, San Diego, CA) and for ß-galactosidase using a plate reader (Anthos htIII, Salzburg, Austria). All experiments were performed in duplicate and repeated at least three times. Results (mean ± SD) were expressed as the fold increase in relative luciferase units, corrected to ß-galactosidase, and compared to unstimulated cultures.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PPAR{gamma} is expressed in human villous trophoblasts

We first sought to examine the expression of PPAR{gamma} in the human placenta. For this purpose we stained sections of placentas derived from women after uncomplicated term deliveries. As shown in Fig. 1Go, a and b, syncytiotrophoblast nuclei strongly express PPAR{gamma}. Because cytotrophoblasts also appeared to express PPAR{gamma} (Fig. 1aGo), we stained serial sections for either PPAR{gamma} or cyclin E, which is expressed in placental cytotrophoblasts, but not in the syncytiotrophoblast or villous core cells (32). Indeed, cell nuclei that stained positively for cyclin E were also positive for PPAR{gamma} (Fig. 1Go, b and c), demonstrating that cytotrophoblasts express PPAR{gamma}. PPAR{gamma} was also expressed in the nuclei of endothelial cells in villous blood vessels (Fig. 1aGo) and in the nuclei of Hofbauer cells (data not shown), but not in other villous core cells. The specificity of the staining was confirmed in control stains in which staining was performed in the presence of an excess of PPAR{gamma}-blocking peptide (compare Fig. 1Go, d and e), and also in stains in which the primary antibody was omitted (Fig. 1fGo). In addition, no staining was observed when an isotype-matched control antibody was used as the primary antibody (data not shown).



View larger version (138K):
[in this window]
[in a new window]
 
Figure 1. PPAR{gamma} is expressed in human placental trophoblasts and endothelial cells. Formalin-fixed sections of normal term human placenta were stained for PPAR{gamma} (a and b) or cyclin E (c). a, Section of villous with syncytium (S), cytotrophoblasts (Cy), and endothelial cells (E) staining positively for PPAR{gamma}. V, Placental blood vessel. Serial sections were stained for PPAR{gamma} (b) or cyclin E (c); the arrow indicates a cytotrophoblast nucleus appearing in both sections that stained positively for both proteins. d—f, Low power magnification of placental sections stained with anti-PPAR{gamma} (d), anti-PPAR{gamma} with an excess of PPAR{gamma}-blocking peptide (e), or no primary antibody (f). Bar: a—c, 10 µm; d—f, 50 µm.

 
Induction of trophoblast differentiation does not alter PPAR{gamma} expression

Because PPAR{gamma} is expressed in both cytotrophoblast and syncytiotrophoblast, we sought to determine whether its expression is altered during trophoblast differentiation. Trophoblasts were cultured in the presence or absence of 1 mmol/L 8-Br-cAMP, a known stimulant of cytotrophoblast differentiation into syncytiotrophoblast (25, 33). As shown in Fig. 2AGo, 8-Br-cAMP stimulated cytotrophoblast differentiation, demonstrated by the increase in hCG secretion during 72 h of culture. However, trophoblast differentiation was not associated with enhanced PPAR{gamma} expression (Fig. 2BGo). Interestingly, culturing trophoblasts in H/W medium, which hinders cytotrophoblast differentiation (34) (Fig. 2AGo) led to a corresponding diminution of PPAR{gamma} expression (5-fold by 72 h; Fig. 2BGo). These data indicate that although PPAR{gamma} expression is maximal at 24 h of standard culture and cannot be further enhanced by stimulation of differentiation, hindered differentiation is associated with diminished PPAR{gamma} expression. We further determined whether PPAR{gamma} activity changes during trophoblast differentiation. For this purpose we transfected primary trophoblasts with a PPREx3-Luc reporter construct that contained a luciferase gene under the control of three PPRE sites inserted upstream of luciferase (Fig. 2CGo). To control for nonspecific increases in transcription due to cellular activation, we transfected duplicate cultures with the reporter plasmid lacking the PPRE sites. We found that 8-Br-cAMP induced an 8- to 10-fold increase in intrinsic PPAR{gamma} activity, and that this effect was trophoblast specific, because the addition of 8-Br-cAMP did not enhance PPREx3-Luc reporter transcription in CV-1 cells (Fig. 2CGo). Addition of 8-Br-cAMP resulted in minimal (2-fold) stimulation of the P36 control reporter in either primary trophoblasts or CV-1 cells (Fig. 2CGo), suggesting a nonspecific effect by 8-Br-cAMP. Taken together, these data demonstrate that 8-Br-cAMP induces a PPRE-specific increase in transcriptional activity in primary trophoblasts, indicative of increased intrinsic PPAR{gamma} activity. Thus, although intracellular levels of PPAR{gamma} remain unchanged, the activity of PPAR{gamma} increases when trophoblasts are stimulated to differentiate by 8-Br-cAMP.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 2. Effect of trophoblast differentiation on PPAR{gamma} expression and activity. Primary trophoblasts were cultured in medium 199 (control), medium 199 with 8-Br-cAMP (1 mmol/L), or H/W medium. Culture medium was collected at 24, 48, and 72 h of culture, and the cells were lysed. A, Supernatants were analyzed for hCG secretion as described in Materials and Methods. Values (mean ± SD) represent hCG secretion during the 24-h interval ending at the time indicated normalized to total cellular DNA and are representative of experiments using five different placenta. B, Immunoblot of PPAR{gamma} expression in each of the culture paradigms. Data are representative of experiments from four different placenta. C, The effect of 1 mmol/L 8-Br-cAMP on PPREx3-Luc expression, an indicator of PPAR{gamma} activation. PPREx3-Luc or P36-Luc was transfected into either primary trophoblasts or CV-1 cells. Results (mean ± SD), normalized to ß-galactosidase (ß-GAL) activity, are expressed as the fold increase in relative luciferase activity over the control value and represent two independent experiments, each performed in duplicate.

 
PPAR{gamma} ligands exhibit opposing effects on trophoblast differentiation

To determine whether activation of PPAR{gamma} alters the differentiation of human cytotrophoblasts, we cultured trophoblasts in the presence or absence of troglitazone or 15{Delta}PGJ2. We first established that both ligands stimulate PPAR{gamma} activity using the choriocarcinoma cell line BeWo. As shown in Fig. 3AGo, both ligands enhanced luciferase expression from the PPREx3-Luc reporter construct, reflecting PPAR{gamma} activation. Importantly, primary trophoblasts incubated in the presence of troglitazone exhibited a 2- to 5-fold increase in hCG secretion relative to control cultures at 72 h (Fig. 3BGo), indicating enhancement of biochemical differentiation of cytotrophoblasts. In contrast, incubation in the presence of 15{Delta}PGJ2 diminished hCG production from trophoblasts. To eliminate the possibility that a lower concentration of either ligand might have a different effect on trophoblast differentiation, we titrated troglitazone or 15{Delta}PGJ2 in trophoblast cultures. As shown in Fig. 3CGo, troglitazone stimulated hCG secretion at 1.0 and 10 µmol/L, whereas 15{Delta}PGJ2 led to a concentration-dependent decrease in hCG secretion at the same concentrations. Taken together, these data indicate that the disparate effects of the two ligands on trophoblast differentiation were maintained even at a lower concentration. Interestingly, addition of the PPAR{gamma} antagonist BADGE (35) led to a decrease in both basal and troglitazone-induced hCG production (Fig. 3DGo), supporting the idea that prodifferentiation PPAR{gamma} ligands may predominate in native trophoblast cultures. In addition, when trophoblasts were cultured in the presence of both troglitazone and 8-Br-cAMP, an additive increase in hCG secretion was observed compared to that with either substance alone, whereas cultures exposed simultaneously to 15DPGJ2 and 8-Br-cAMP showed only a slight increase in hCG secretion relative to those given 15DPGJ2 alone (data not shown). These results are consistent with the induction of an endogenous ligand by 8-Br-cAMP and indicate that the effect of 15DPGJ2 is dominant over that of 8-Br-cAMP.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 3. Opposing effects of troglitazone and 15{Delta}PGJ2 on biochemical differentiation of trophoblasts. A, PPAR{gamma} ligands stimulate PPAR{gamma} activity in the trophoblast cell line BeWo. BeWo cells were transfected with PPREx3-Luc as described in Materials and Methods. Cells were stimulated with 10 µmol/L troglitazone or 10 µmol/L 15{Delta}PGJ2 during the final 24 h of culture, then assayed as described in Materials and Methods. B, Primary trophoblasts were cultured in medium 199 alone (control) or in medium 199 containing 10 µmol/L 15{Delta}PGJ2 or 10 µmol/L troglitazone. Values (mean ± SD) represent hCG secretion during each 24-h interval ending at the time indicated and are normalized to total cellular DNA. Data are representative of experiments using five different placentas. C, Primary trophoblasts were cultured for 72 h as described above in the presence of troglitazone (0.1–10 µmol/L) or 15{Delta}PGJ2 (0.1–10 µmol/L). Supernatants were then assayed for hCG secretion as described above. Data are representative of experiments from two different placentas. D, Primary trophoblasts were cultured for 72 h in the presence or absence of 3 µmol/L troglitazone with or without the PPAR{gamma} antagonist BADGE (10 and 30 µmol/L). The culture supernatants were assayed for hCG production as described above. Data are representative of experiments using four different placentas.

 
To substantiate the effects of troglitazone and 15{Delta}PGJ2 on trophoblast differentiation, we examined syncytium formation as an indicator of morphological differentiation. As shown in Fig. 4Go, in control cultures most trophoblasts were present as mononucleated cytotrophoblasts at 24 h (1.5 ± 0.6 syncytia/field, 4.3 ± 1.0 nuclei/syncytium), with more abundant, larger syncytia at 48 h (4.3 ± 1.0 syncytia/field; P = 0.001 vs. 24 h; and 11.6 ± 8.4 nuclei/syncytium, P = 0.04 vs. 24 h). Syncytium formation was accelerated in cultures containing troglitazone, yielding 5.8 ± 2.5 syncytia/field (P = 0.01 vs. 24-h control) with 6.9 ± 3.1 nuclei/syncytium at 24 h. Syncytia were larger and more abundant at 48 h, such that each field usually consisted of 2–3 large syncytia (>15 nuclei/syncytium) that extended beyond the edges of the field, making quantitation of random fields impossible. By 72 h, both control and troglitazone-containing cultures consisted of these large syncytia and were indistinguishable from each other. In contrast, trophoblasts cultured in the presence of 15{Delta}PGJ2 showed little syncytium formation throughout the culture period, yielding 0.8 ± 1.3, 1.3 ± 1.4, and 0.8 ± 1.2 syncytia at 24, 48, and 72 h, respectively (P = NS vs. control at 24, P = 0.001 vs. control at 48 h, and qualitatively markedly different at 72 h). Furthermore, each syncytium contained only 3–4 nuclei. Therefore, we concluded that troglitazone enhances biochemical and morphological differentiation of cytotrophoblasts, whereas 15{Delta}PGJ2 abrogates cytotrophoblast differentiation.



View larger version (98K):
[in this window]
[in a new window]
 
Figure 4. Opposing effects of troglitazone (10 µmol/L) and 15{Delta}PGJ2 (10 µmol/L) on morphological differentiation of trophoblasts. Primary trophoblasts were cultured as described in Materials and Methods and in Fig. 3bGo. At 24, 48, and 72 h the cells were fixed, stained with antibodies specific for nuclei (red) and plasma membrane desmosomes (green), and observed by confocal microscopy. Bar, 10 µm.

 
15{Delta}PGJ2 stimulates trophoblast apoptosis

Trophoblasts cultured in the presence of 15{Delta}PGJ2 exhibit small, dense nuclei and nuclear fragments (Fig. 4Go, 15{Delta}PGJ2), suggesting that the trophoblasts may be undergoing apoptosis. Because of this observation and because 15{Delta}PGJ2 has been shown to induce apoptosis in the JEG-3 cell line (36) and in other cells (9, 37, 38), we evaluated whether 15{Delta}PGJ2 induces apoptosis in primary human trophoblasts. As shown in Fig. 5AGo, 15{Delta}PGJ2 enhanced trophoblast apoptosis (apoptotic index, 14.3%) relative to the control (apoptotic index, 4.3%), determined by the TUNEL technique. There was no increase in apoptosis when trophoblasts were incubated with troglitazone (apoptotic index, 3.2%). Because it is known that diverse apoptotic stimuli induce the accumulation and activation of the tumor suppressor protein p53, which, in turn, can activate the apoptotic cascade (39, 40), we examined the effects of 15{Delta}PGJ2 and troglitazone on p53 expression. We found that 15{Delta}PGJ2 induced a 4- to 5-fold increase in p53 expression compared to either control cultures or cultures containing troglitazone (Fig. 5BGo). Taken together, we conclude that the two PPAR{gamma} ligands have opposing effects on trophoblasts, with troglitazone promoting differentiation and 15{Delta}PGJ2 diminishing differentiation and inducing apoptosis.



View larger version (43K):
[in this window]
[in a new window]
 
Figure 5. 15{Delta}PGJ2 induces apoptosis in cultured trophoblasts. Primary trophoblasts were cultured as described in Materials and Methods and Fig. 4Go. Cells were either fixed and stained for TUNEL analysis at 48 h (A) or were lysed at 24 or 48 h and total protein purified for Western analysis of p53 expression (B).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Intact fetal development depends on placental formation and trophoblast differentiation. The molecular mechanisms that underlie these processes are largely unknown. We found that PPAR{gamma}, a nuclear protein that is essential for proper placental development and trophoblast differentiation in the mouse (21, 22), is expressed in human placental cytotrophoblast and syncytiotrophoblast, and that the expression and activity of PPAR{gamma} are associated with trophoblast differentiation. These findings suggest that PPAR{gamma} may play an important function in the differentiation of human trophoblasts. Importantly, PPAR{gamma} is a ligand-dependent nuclear receptor. PPAR{gamma} ligands modulate differentiation (5, 7, 8, 13, 17, 18, 19, 20) and apoptosis (9, 38) in other cell systems. We selected two ligands known to stimulate PPAR{gamma} activity, namely the thiazolidinedione troglitazone and the prostanoid 15{Delta}PGJ2. Surprisingly, we found that whereas troglitazone stimulates biochemical and morphological differentiation of trophoblasts, 15{Delta}PGJ2 hinders differentiation and induces apoptosis. The ability of troglitazone to induce differentiation of human trophoblast, the diminution of hCG production by the PPAR{gamma} antagonist BADGE, and the disrupted differentiation observed in PPAR{gamma}-deficient mice (21) suggest that an endogenous, troglitazone-like ligand predominates during trophoblast differentiation in vivo. The possibility that PPARs play a role in trophoblast differentiation was first reported by Matsuo and Strauss using the choriocarcinoma cell line JEG-3 (41). They demonstrated that when ligands for retinoid X receptor, the heterodimer partner of PPARs, were added to cultures of JEG-3 cells, hCG secretion was enhanced. In addition, when ligands for PPAR{alpha} were added to the cultures, hCG secretion was diminished.

Biochemical and morphological trophoblast differentiation are stimulated by 8-Br-cAMP (25, 33, 42). Whereas 8-Br-cAMP enhances hCG secretion, the intracellular levels of PPAR{gamma} remain constant throughout the culture period. These results suggest that the stimulus for trophoblast differentiation induces an endogenous ligand for PPAR{gamma}. When trophoblasts were cultured in the presence of both troglitazone and 8-Br-cAMP, an additive increase in hCG secretion was observed compared to that with either substance alone (data not shown), supporting the hypothesis that 8-Br-cAMP induces an endogenous PPAR{gamma} ligand. Alternatively, because PPAR{gamma} is inactivated by phosphorylation (43, 44, 45), dephosphorylation and subsequent stimulation of PPAR{gamma} may explain PPAR{gamma} activation during trophoblast differentiation. Experiments are currently underway to determine whether ligand production is enhanced or the phosphorylation state is altered in trophoblasts exposed to 8-Br-cAMP. Interestingly, when trophoblasts are cultured in H/W medium, which is known to hinder trophoblast differentiation, PPAR{gamma} expression is diminished. These data are consistent with those presented by Barak et al. (21), who reported that maturation of the early labyrinthine parenchyma into chorionic villi trophoblast is blocked in mice lacking PPAR{gamma}. Together, it is likely that PPAR{gamma} activity is essential for trophoblast differentiation.

In contrast to troglitazone, the putative natural PPAR{gamma} ligand 15{Delta}PGJ2 hinders trophoblast differentiation and induces apoptosis. The ability of 15{Delta}PGJ2 to induce apoptosis has been documented in monocytes (9) and endothelial cells (38). In addition, Ikai et al. (46) demonstrated that another PGD2 derivative, {Delta}12-PGJ2, increased p53 expression and apoptosis in endothelial cells. Our results are also supported by Clay et al. (37), who found that 15{Delta}PGJ2, but not troglitazone, stimulated apoptosis in breast cancer cell lines. There are at least two explanations for the disparate effects of troglitazone and 15{Delta}PGJ2 on trophoblasts. The first involves ligand- and promoter-specific conformational changes in the protein, which result in altered capacity to physically interact with a distinct set of coregulators, where one coregulator complex stimulates gene expression, and the other represses expression. For example, it is known that the antiestrogen 4-hydroxytamoxifen induces a conformational change in the estrogen receptor (ER) distinct from that induced by estradiol (47, 48). This conformational change inhibits activation via the ligand-dependent AF-2 domain, thus accounting for the antagonistic effects of 4-hydroxytamoxifen on estrogen-mediated ER responses. Studies are currently underway to pursue this possibility. Alternatively, the possibility that one or both PPAR{gamma} ligands may act independently of PPAR{gamma}, as previously suggested using other cells (49, 50, 51, 52), cannot be excluded. Experiments using the combination of 15DPGJ2 and BADGE are unable to resolve this issue because both compounds inhibit hCG secretion in primary trophoblasts. Therefore, when both compounds are added to trophoblast cultures, no increase in hCG secretion is observed (data not shown). Regardless of their mechanism of action, the opposing effects of troglitazone and 15{Delta}PGJ2 on trophoblast differentiation may elucidate the processes that govern trophoblast differentiation and apoptosis.

Our data may have profound clinical implications. Dysfunction of the human placenta may result in fetal growth restriction (53, 54), a condition associated with abnormal trophoblast differentiation and enhanced apoptosis (55). If, in fact, 15{Delta}PGJ2 causes placental trophoblast apoptosis in vivo, it would be intriguing to determine whether 15{Delta}PGJ2 levels are increased in conditions such as fetal growth restriction. In this scenario, inhibition of 15{Delta}PGJ2 production and stimulation of the troglitazone pathway might reverse the apoptotic pathway and support placental development and differentiation.


    Acknowledgments
 
We thank Elena Sadovsky, Qinglin Ou, and Lori Rideout for their assistance during these studies. We thank Parke-Davis for generously providing troglitazone. We also thank Dr. Stuart Adler for the P36 reporter plasmid, Dr. Alan Schwartz for BeWo cells, and Drs. Peter Crawford and Timothy Willson for helpful discussions.


    Footnotes
 
1 This work was supported in part by NIH Grant HD-29190. Back

Received February 29, 2000.

Revised June 22, 2000.

Accepted July 10, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Michalik L, Wahli W. 1999 Peroxisome proliferator-activated receptors: three isotypes for a multitude of functions. Curr Opin Biotechnol. 10:564–570.[CrossRef][Medline]
  2. Kliewer SA, Forman BM, Blumberg B, et al. 1994 Differential expression and activation of a family of murine peroxisome proliferator-activated receptors. Proc Natl Acad Sci USA. 91:7355–7359.[Abstract/Free Full Text]
  3. Braissant O, Foufelle F, Scotto C, Dauca M, Wahli W. 1996 Differential expression of peroxisome proliferator-activated receptors (PPARs): tissue distribution of PPAR-{alpha}, -ß, and -{gamma} in the adult rat. Endocrinology. 137:354–366.[Abstract]
  4. Amri EZ, Bonino F, Ailhaud G, Abumrad NA, Grimaldi PA. 1995 Cloning of a protein that mediates transcriptional effects of fatty acids in preadipocytes. Homology to peroxisome proliferator-activated receptors. J Biol Chem. 270:2367–2371.[Abstract/Free Full Text]
  5. Tontonoz P, Hu E, Graves RA, Budavari AI, Spiegelman BM. 1994 mPPAR{gamma} 2:tissue-specific regulator of an adipocyte enhancer. Genes Dev. 8:1224–1234.[Abstract/Free Full Text]
  6. Chawla A, Schwarz EJ, Dimaculangan DD, Lazar MA. 1994 Peroxisome proliferator-activated receptor (PPAR) {gamma}: adipose- predominant expression and induction early in adipocyte differentiation. Endocrinology. 135:798–800.[Abstract]
  7. Tontonoz P, Singer S, Forman BM, et al. 1997 Terminal differentiation of human liposarcoma cells induced by ligands for peroxisome proliferator-activated receptor {gamma} and the retinoid X receptor. Proc Natl Acad Sci USA. 94:237–241.[Abstract/Free Full Text]
  8. Tontonoz P, Nagy L, Alvarez JG, Thomazy VA, Evans RM. 1998 PPAR{gamma} promotes monocyte/macrophage differentiation and uptake of oxidized LDL. Cell. 93:241–252.[CrossRef][Medline]
  9. Chinetti G, Griglio S, Antonucci M, et al. 1998 Activation of proliferator-activated receptors a and g induces apoptosis of human monocyte-derived macrophages. J Biol Chem. 273:25573–25580.[Abstract/Free Full Text]
  10. Lambe KG, Tugwood JD. 1996 A human peroxisome-proliferator-activated receptor-{gamma} is activated by inducers of adipogenesis, including thiazolidinedione drugs. Eur J Biochem. 239:1–7.[Medline]
  11. Kliewer SA, Sundseth SS, Jones SA, et al. 1997 Fatty acids and eicosanoids regulate gene expression through direct interactions with peroxisome proliferator-activated receptors {alpha} and {gamma}. Proc Natl Acad Sci USA. 94:4318–4323.[Abstract/Free Full Text]
  12. Nagy L, Tontonoz P, Alvarez JG, Chen H, Evans RM. 1998 Oxidized LDL regulates macrophage gene expression through ligand activation of PPAR{gamma}. Cell. 93:229–240.[CrossRef][Medline]
  13. Forman BM, Tontonoz P, Chen J, Brun RP, Spiegelman BM, Evans RM. 1995 15-Deoxy-D12, 14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR{gamma}. Cell. 83:803–812.[CrossRef][Medline]
  14. Kliewer SA, Lenhard JM, Willson TM, Patel I, Morris DC, Lehmann JM. 1995 A prostaglandin J2 metabolite binds peroxisome proliferator-activated receptor {gamma} and promotes adipocyte differentiation. Cell. 83:813–819.[CrossRef][Medline]
  15. Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA. 1995 An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor {gamma} (PPAR {gamma}). J Biol Chem. 270:12953–12956.[Abstract/Free Full Text]
  16. Willson TM, Cobb JE, Cowan DJ, et al. 1996 The structure-activity relationship between peroxisome proliferator-activated receptor {gamma} agonism and the antihyperglycemic activity of thiazolidinediones. J Med Chem. 39:665–668.[CrossRef][Medline]
  17. Tontonoz P, Hu E, Spiegelman BM. 1994 Stimulation of adipogenesis in fibroblasts by PPAR{gamma}2, a lipid-activated transcription factor. Cell. 79:1147–1156.[CrossRef][Medline]
  18. Yu K, Bayona W, Kallen CB, et al. 1995 Differential activation of peroxisome proliferator-activated receptors by eicosanoids. J Biol Chem. 270:23975–23983.[Abstract/Free Full Text]
  19. Hu E, Tontonoz P, Spiegelman BM. 1995 Transdifferentiation of myoblasts by the adipogenic transcription factors PPAR{gamma} and C/EBP{alpha}. Proc Natl Acad Sci USA. 92:9856–9860.[Abstract/Free Full Text]
  20. Mueller E, Sarraf P, Tontonoz P, et al. 1998 Terminal differentiation of human breast cancer through PPAR{gamma}. Mol Cell. 1:465–470.[CrossRef][Medline]
  21. Barak Y, Nelson MC, Ong ES, et al. 1999 PPAR{gamma} is required for placental, cardiac, and adipose tissue development. Mol Cell. 4:585–595.[CrossRef][Medline]
  22. Kubota N, Terauchi Y, Miki H, et al. 1999 PPAR{gamma} mediates high-fat diet-induced adipocyte hypertrophy and insulin resistance. Mol Cell. 4:597–609.[CrossRef][Medline]
  23. Kliman HJ, Nestler JE, Sermasi E, Sanger JM, Strauss JM. 1986 Purification, characterization and in vitro differentiation of cytotrophoblasts from human term placentae. Endocrinology. 118:1567–1582.[Abstract/Free Full Text]
  24. Nelson DM, Johnson RD, Smith SD, Anteby EY, Sadovsky Y. 1999 Hypoxia limits differentiation and up-regulates expression and activity of prostaglandin H synthase 2 in cultured trophoblast from term human placenta. Am J Obstet Gynecol. 180:896–902.[CrossRef][Medline]
  25. Wice B, Menton D, Geuze H, Schwartz AL. 1990 Modulators of cyclic AMP metabolism induce syncytiotrophoblast formation in vitro. Exp Cell Res. 186:306–316.[CrossRef][Medline]
  26. Osumi T, Wen JK, Hashimoto T. 1991 Two cis-acting regulatory sequences in the peroxisome proliferator- responsive enhancer region of rat acyl-CoA oxidase gene. Biochem Biophys Res Commun. 175:866–871.[CrossRef][Medline]
  27. Dreyer C, Krey G, Keller H, Givel F, Helftenbein G, Wahli W. 1992 Control of the peroxisomal ß-oxidation pathway by a novel family of nuclear hormone receptors. Cell. 68:879–887.[CrossRef][Medline]
  28. Juge-Aubry C, Pernin A, Favez T, et al. 1997 DNA binding properties of peroxisome proliferator-activated receptor subtypes on various natural peroxisome proliferator response elements. Importance of the 5'-flanking region. J Biol Chem. 272:25252–25259.[Abstract/Free Full Text]
  29. Mangalam HJ, Albert VR, Ingraham HA, et al. 1989 A pituitary POU domain protein, Pit-1, activates both growth hormone and prolactin promoters transcriptionally. Genes Dev. 3:946–958.[Abstract/Free Full Text]
  30. Anteby EY, Johnson RD, Huang X, Nelson DM, Sadovsky Y. 1997 Transcriptional regulation of prostaglandin-H synthase-2 gene in human trophoblasts. J Clin Endocrinol Metab. 82:2289–2293.[Abstract/Free Full Text]
  31. Chen C, Okayama H. 1987 High-efficiency transformation of mammalian cells by plasmid DNA. Mol Cell Biol. 7:2745–2752.[Abstract/Free Full Text]
  32. Bamberger A, Sudahl S, Bamberger CM, Schulte HM, Loning T. 1999 Expression patterns of the cell-cycle inhibitor p27 and the cell-cycle promoter cyclin E in the human placenta throughout gestation: implications for the control of proliferation. Placenta. 20:401–406.[CrossRef][Medline]
  33. Keryer G, Alsat E, Tasken K, Evain-Brion D. 1998 Cyclic AMP-dependent protein kinases and human trophoblast cell differentiation in vitro. J Cell Sci. 111:995–1004.[Abstract]
  34. Douglas GC, King BF. 1990 Differentiation of human trophoblast cells in vitro as revealed by immunocytochemical staining of desmoplakin and nuclei. J Cell Sci. 96:131–141.[Abstract/Free Full Text]
  35. Wright HM, Clish CB, Mikami T, et al. 2000 A synthetic antagonist for the peroxisome proliferator-activated receptor {gamma} inhibits adipocyte differentiation. J Biol Chem. 275:1873–1877.[Abstract/Free Full Text]
  36. Keelan JA, Sato TA, Marvin KW, Lander J, Gilmour RS, Mitchell MD. 1999 15-Deoxy-D12,14-prostaglandin J2, a ligand for peroxisome proliferator-activated receptor-{gamma}, induces apoptosis in JEG3 choriocarcinoma cells. Biochem Biophys Res Commun. 262:579–585.[CrossRef][Medline]
  37. Clay CE, Namen AM, Atsumi G, et al. 1999 Influence of J series prostaglandins on apoptosis and tumorigenesis of breast cancer cells. Carcinogenesis. 20:1905–1911.[Abstract/Free Full Text]
  38. Bishop-Bailey D, Hla T. 1999 Endothelial cell apoptosis induced by the peroxisome proliferator-activated receptor (PPAR) ligand 15-deoxy-D12,14-prostaglandin J2. J Biol Chem. 274:17042–17048.[Abstract/Free Full Text]
  39. Gottlieb TM, Oren M. 1998 p53 and apoptosis. Semin Cancer Biol. 8:359–368.[CrossRef][Medline]
  40. Asker C, Wiman KG, Selivanova G. 1999 p53-induced apoptosis as a safeguard against cancer. Biochem Biophys Res Commun. 265:1–6.[CrossRef][Medline]
  41. Matsuo H, Strauss III JF. 1994 Peroxisome proliferators and retinoids affect JEG-3 choriocarcinoma cell function. Endocrinology. 135:1135–1145.[Abstract]
  42. Morrish DW, Bhardwaj D, Dabbagh LK, Marusyk H, Sly O. 1987 Epidermal growth factor induces differentiation and secretion of human chorionic gonadotropin and placental lactogen in normal human placenta. J Clin Endocrinol Metab. 65:1282–1290.[Abstract/Free Full Text]
  43. Hu E, Kim JB, Sarraf P, Spiegelman BM. 1996 Inhibition of adipogenesis through MAP kinase-mediated phosphorylation of PPAR{gamma}. Science. 274:2100–2103.[Abstract/Free Full Text]
  44. Adams M, Reginato MJ, Shao D, Lazar MA, Chatterjee VK. 1997 Transcriptional activation by peroxisome proliferator-activated receptor {gamma} is inhibited by phosphorylation at a consensus mitogen-activated protein kinase site. J Biol Chem. 272:5128–5132.[Abstract/Free Full Text]
  45. Camp HS, Tafuri SR. 1997 Regulation of peroxisome proliferator-activated receptor g activity by mitogen-activated protein kinase. J Biol Chem. 272:10811–10816.[Abstract/Free Full Text]
  46. Ikai K, Kudo H, Toda K, Fukushima M. 1998 Induction of apoptosis, p53 and heme oxygenase-1 by cytotoxic prostaglandin D12-PGJ2 in transformed endothelial cells. Prostaglandins Leukot Essent Fatty Acids. 58:295–300.[CrossRef][Medline]
  47. Berry M, Metzger D, Chambon P. 1990 Role of the two activating domains of the oestrogen receptor in the cell-type and promoter-context dependent agonistic activity of the anti-oestrogen 4-hydroxytamoxifen. EMBO J. 9:2811–2818.[Medline]
  48. Webb P, Lopez GN, Uht RM, Kushner PJ. 1995 Tamoxifen activation of the estrogen receptor/AP-1 pathway: potential origin for the cell-specific estrogen-like effects of antiestrogens. Mol Endocrinol. 9:443–456.[Abstract/Free Full Text]
  49. Petrova TV, Akama KT, Van Eldik LJ. 1999 Cyclopentenone prostaglandins suppress activation of microglia: down-regulation of inducible nitric-oxide synthase by 15-deoxy-D12,14- prostaglandin J2. Proc Natl Acad Sci USA. 96:4668–4673.[Abstract/Free Full Text]
  50. Vaidya S, Somers EP, Wright SD, Detmers PA, Bansal VS. 1999 15-Deoxy-D12,14-prostaglandin J2 inhibits the b2 integrin-dependent oxidative burst: Involvement of a mechanism distinct from peroxisome proliferator-activated receptor g ligation. J Immunol. 163:6187–6192.[Abstract/Free Full Text]
  51. Thieringer R, Fenyk-Melody JE, Le Grand CB, et al. 2000 Activation of peroxisome proliferator-activated receptor g does not inhibit IL-6 or TNF-{alpha} responses of macrophages to lipopolysaccharide in vitro or in vivo. J Immunol. 164:1046–1054.[Abstract/Free Full Text]
  52. Wang M, Wise SC, Leff T, Su TZ. 1999 Troglitazone, an antidiabetic agent, inhibits cholesterol biosynthesis through a mechanism independent of peroxisome proliferator-activated receptor-{gamma}. Diabetes. 48:254–260.[Abstract]
  53. Salafia CM. 1997 Placental pathology of fetal growth restriction. Clin Obstet Gynecol. 40:740–749.[CrossRef][Medline]
  54. Kingdom J. 1998 Placental pathology in obstetrics: adaptation or failure of the villous tree? Placenta. 19:347–351.[CrossRef][Medline]
  55. Smith SC, Baker PN, Symonds EM. 1997 Increased placenta apoptosis in intrauterine growth restriction. Am J Obstet Gynecol. 177:1395–1401.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Mol. Pharmacol.Home page
M. Vore and M. Leggas
Progesterone Acts via Progesterone Receptors A and B to Regulate Breast Cancer Resistance Protein Expression
Mol. Pharmacol., March 1, 2008; 73(3): 613 - 615.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. A Desmarais, F. L Lopes, H. Zhang, S. K Das, and B. D Murphy
The Peroxisome Proliferator-Activated Receptor Gamma Regulates Trophoblast Cell Differentiation in Mink (Mustela vison)
Biol Reprod, November 1, 2007; 77(5): 829 - 839.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W. T. Schaiff, F. F. Knapp Jr., Y. Barak, T. Biron-Shental, D. M. Nelson, and Y. Sadovsky
Ligand-Activated Peroxisome Proliferator Activated Receptor {gamma} Alters Placental Morphology and Placental Fatty Acid Uptake in Mice
Endocrinology, August 1, 2007; 148(8): 3625 - 3634.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
M. Cervar-Zivkovic, C. Hu, A. Barton, Y. Sadovsky, G. Desoye, U. Lang, and D.M. Nelson
Endothelin-1 Attenuates Apoptosis in Cultured Trophoblasts From Term Human Placentas
Reproductive Sciences, July 1, 2007; 14(5): 430 - 439.
[Abstract] [PDF]


Home page
Nephrol Dial TransplantHome page
J. Weissgarten, S. Berman, S. Efrati, M. Rapoport, Z. Averbukh, and L. Feldman
Apoptosis and proliferation of cultured mesangial cells isolated from kidneys of rosiglitazone-treated pregnant diabetic rats
Nephrol. Dial. Transplant., May 1, 2006; 21(5): 1198 - 1204.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
K. A. R. Tobin, N. K. Harsem, K. T. Dalen, A. C. Staff, H. I. Nebb, and A. K. Duttaroy
Regulation of ADRP expression by long-chain polyunsaturated fatty acids in BeWo cells, a human placental choriocarcinoma cell line
J. Lipid Res., April 1, 2006; 47(4): 815 - 823.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
M. A. Peraza, A. D. Burdick, H. E. Marin, F. J. Gonzalez, and J. M. Peters
The Toxicology of Ligands for Peroxisome Proliferator-Activated Receptors (PPAR)
Toxicol. Sci., April 1, 2006; 90(2): 269 - 295.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
D. P. Hewitt, P. J. Mark, and B. J. Waddell
Placental Expression of Peroxisome Proliferator-Activated Receptors in Rat Pregnancy and the Effect of Increased Glucocorticoid Exposure
Biol Reprod, January 1, 2006; 74(1): 23 - 28.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
W. T. Schaiff, I. Bildirici, M. Cheong, P. L. Chern, D. M. Nelson, and Y. Sadovsky
Peroxisome Proliferator-Activated Receptor-{gamma} and Retinoid X Receptor Signaling Regulate Fatty Acid Uptake by Primary Human Placental Trophoblasts
J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4267 - 4275.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. D. Mitchell, M. C. Chang, T. Chaiworapongsa, H.-Y. Lan, R. J. A. Helliwell, R. Romero, and T. A. Sato
Identification of 9{alpha},11{beta}-Prostaglandin F2 in Human Amniotic Fluid and Characterization of Its Production by Human Gestational Tissues
J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4244 - 4248.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
E. B. E. Berry, J. A. Keelan, R. J. A. Helliwell, R. S. Gilmour, and M. D. Mitchell
Nanomolar and Micromolar Effects of 15-Deoxy-{Delta}12,14-prostaglandin J2 on Amnion-Derived WISH Epithelial Cells: Differential Roles of Peroxisome Proliferator-Activated Receptors {gamma} and {delta} and Nuclear Factor {kappa}B
Mol. Pharmacol., July 1, 2005; 68(1): 169 - 178.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
T. M Lindstrom and P. R Bennett
15-Deoxy-{Delta}12,14-Prostaglandin J2 Inhibits Interleukin-1{beta}-Induced Nuclear Factor-{kappa}B in Human Amnion and Myometrial Cells: Mechanisms and Implications
J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3534 - 3543.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. Li, J. Dakour, L. J. Guilbert, B. Winkler-Lowen, F. Lyall, and D. W. Morrish
PL74, a Novel Member of the Transforming Growth Factor-{beta} Superfamily, Is Overexpressed in Preeclampsia and Causes Apoptosis in Trophoblast Cells
J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3045 - 3053.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. L. Waite, R. E. Louie, and R. N. Taylor
Circulating Activators of Peroxisome Proliferator-Activated Receptors Are Reduced in Preeclamptic Pregnancy
J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 620 - 626.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
I. Bildirici, C.-R. Roh, W. T. Schaiff, B. M. Lewkowski, D. M. Nelson, and Y. Sadovsky
The Lipid Droplet-Associated Protein Adipophilin Is Expressed in Human Trophoblasts and Is Regulated by Peroxisomal Proliferator-Activated Receptor-{gamma}/Retinoid X Receptor
J. Clin. Endocrinol. Metab., December 1, 2003; 88(12): 6056 - 6062.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
D. M. Nelson, S. D. Smith, T. C. Furesz, Y. Sadovsky, V. Ganapathy, C. A. Parvin, and C. H. Smith
Hypoxia reduces expression and function of system A amino acid transporters in cultured term human trophoblasts
Am J Physiol Cell Physiol, February 1, 2003; 284(2): C310 - C315.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
X. Yan, J.-F. Mouillet, Q. Ou, and Y. Sadovsky
A Novel Domain within the DEAD-Box Protein DP103 Is Essential for Transcriptional Repression and Helicase Activity
Mol. Cell. Biol., January 1, 2003; 23(1): 414 - 423.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Lappas, M. Permezel, H. M. Georgiou, and G. E. Rice
Regulation of Proinflammatory Cytokines in Human Gestational Tissues by Peroxisome Proliferator-Activated Receptor-{gamma}: Effect of 15-Deoxy-{Delta}12,14-PGJ2 and Troglitazone
J. Clin. Endocrinol. Metab., October 1, 2002; 87(10): 4667 - 4672.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
L. Capparuccia, D. Marzioni, A. Giordano, F. Fazioli, M. De Nictolis, N. Busso, T. Todros, and M. Castellucci
PPAR{gamma} expression in normal human placenta, hydatidiform mole and choriocarcinoma
Mol. Hum. Reprod., June 1, 2002; 8(6): 574 - 579.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. L. Schild, W. T. Schaiff, M. G. Carlson, E. J. Cronbach, D. M. Nelson, and Y. Sadovsky
The Activity of PPAR{gamma} in Primary Human Trophoblasts Is Enhanced by Oxidized Lipids
J. Clin. Endocrinol. Metab., March 1, 2002; 87(3): 1105 - 1110.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Mohan, J.R. Malayer, R.D. Geisert, and G.L. Morgan
Expression Patterns of Retinoid X Receptors, Retinaldehyde Dehydrogenase, and Peroxisome Proliferator Activated Receptor Gamma in Bovine Preattachment Embryos
Biol Reprod, March 1, 2002; 66(3): 692 - 700.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
T. Michimata, H. Tsuda, M. Sakai, M. Fujimura, K. Nagata, M. Nakamura, and S. Saito
Accumulation of CRTH2-positive T-helper 2 and T-cytotoxic 2 cells at implantation sites of human decidua in a prostaglandin D2-mediated manner
Mol. Hum. Reprod., February 1, 2002; 8(2): 181 - 187.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. E. Crawford, C. Qi, P. Misra, V. Stellmach, M. S. Rao, J. D. Engel, Y. Zhu, and J. K. Reddy
Defects of the Heart, Eye, and Megakaryocytes in Peroxisome Proliferator Activator Receptor-binding Protein (PBP) Null Embryos Implicate GATA Family of Transcription Factors
J. Biol. Chem., January 25, 2002; 277(5): 3585 - 3592.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Tarrade, K. Schoonjans, L. Pavan, J. Auwerx, C. Rochette-Egly, D. Evain-Brion, and T. Fournier
PPAR{gamma}/RXR{alpha} Heterodimers Control Human Trophoblast Invasion
J. Clin. Endocrinol. Metab., October 1, 2001; 86(10): 5017 - 5024.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Tarrade, K. Schoonjans, J. Guibourdenche, J. M. Bidart, M. Vidaud, J. Auwerx, C. Rochette-Egly, and D. Evain-Brion
PPAR{gamma}/RXR{alpha} Heterodimers Are Involved in Human CG{beta} Synthesis and Human Trophoblast Differentiation
Endocrinology, October 1, 2001; 142(10): 4504 - 4514.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schaiff, W. T.
Right arrow Articles by Sadovsky, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schaiff, W. T.
Right arrow Articles by Sadovsky, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals