| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Modulates Differentiation of Human Trophoblast in a Ligand-Specific Manner1
Departments of Obstetrics and Gynecology and Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri 63110
Address all correspondence and requests for reprints to: Yoel Sadovsky, M.D., Department of Obstetrics and Gynecology, Washington University School of Medicine, 4566 Scott Avenue, St. Louis, Missouri 63110. E-mail: sadovskyy{at}msnotes.wustl.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(PPAR) regulates the differentiation of several tissues
and cell types. PPAR was recently determined to be essential for
murine placental development and differentiation. We therefore assessed
the influence of PPAR on differentiation of human placental
trophoblasts. We initially used immunohistochemistry to examine term
human placentas for PPAR expression and found that PPAR is
present in syncytiotrophoblasts and cytotrophoblasts in placental
villi. We correlated the expression of PPAR with differentiation of
primary human trophoblasts and found that 8-bromo-cAMP, a known
enhancer of trophoblast differentiation, stimulates PPAR activity,
but has no effect on PPAR expression. We demonstrated that the
PPAR ligand 15-deoxy-
12,14-prostaglandin
J2 (15PGJ2) and the thiazolidinedione
troglitazone stimulate PPAR activity in the trophoblast
cell line BeWo. Importantly, whereas exposure of cultured primary
trophoblasts to troglitazone enhances biochemical and
morphological trophoblast differentiation, 15PGJ2
diminishes trophoblast differentiation. Furthermore,
15PGJ2, but not troglitazone, up-regulates
p53 expression and promotes trophoblast apoptosis. These data indicate
that PPAR is expressed in human placental trophoblasts, and that
ligand-specific activation of PPAR results in opposing effects on
trophoblast differentiation. Our results suggest that PPAR plays an
important role in placental differentiation during human pregnancy. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Peroxisome proliferator-activated receptors (PPARs) are members of the
steroid receptor superfamily of nuclear receptors. They consist of
three subtypes: PPAR
, PPAR, and PPAR
(1). Each subtype has a
distinct tissue distribution, with PPAR present in high levels in
the kidney, heart, muscle, and liver (2, 3), whereas PPAR is present
in most tissues (2, 4). PPAR, in turn, is expressed predominantly in
adipose tissue (2, 5, 6, 7) as well as in monocytes, tissue macrophages
(8, 9), and placenta (10). Several naturally occurring ligands for
PPAR have been identified, including fatty acids (11), oxidized low
density lipoprotein derivatives (12), and the PG
metabolite 15-deoxy-12,14-prostaglandin
J2 (15PGJ2) (13, 14). In addition, the antidiabetic thiazolidinedione drugs function as
ligands for PPAR (13, 15, 16). PPAR plays a role in the
differentiation of several cell types, including preadipocytes (5, 13, 17, 18), myoblasts (19), and monocytes (8), and in the terminal
differentiation of breast cancer (20) and liposarcoma cells (7).
Importantly, mice deficient in PPAR exhibit abnormal placental
development and trophoblast differentiation (21, 22). Specifically, the
placentas of PPAR-deficient embryos have a labyrinth that forms an
excessively thick layer surrounding the chorionic villi and retains the
immature characteristics of the early labyrinthine parenchyma instead
of maturing into a normal trilaminar epithelial barrier (21). These
placentas also exhibit anomalous placental vasculature. These
developmental defects result in embryonic death on embryonic day 10,
when maintenance of fetal metabolism transitions from the yolk sac to
the labyrinthine placenta. These data underscore the role of PPAR in
terminal differentiation of murine placental trophoblasts.
Although PPAR is essential for normal placental development and
trophoblast differentiation in mice, the role of PPAR in the human
placenta is unknown. We hypothesized that PPAR plays an important
role in human trophoblast differentiation. Our data demonstrate that
PPAR is expressed in both cytotrophoblast and syncytiotrophoblast of
human trophoblast, and that 8-bromo-cAMP (8-Br-cAMP), a known inducer
of trophoblast differentiation, enhances PPAR activity. Importantly,
we discovered that two types of PPAR ligands that stimulate PPAR
activity in trophoblasts have opposing effects on human trophoblasts,
one promoting differentiation and the other hindering differentiation
and promoting apoptosis.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Our study was approved by the human studies committee of
Washington University (St. Louis, MO). Placentas from term (>37 weeks)
uncomplicated pregnancies were collected immediately after delivery,
fixed for 1 h in 10% neutral buffered formalin, and embedded in
paraffin. Five-micron sections were deparaffinized in xylene and
rehydrated in an ethanol gradient. Endogenous peroxidase activity was
quenched by incubating the specimens in 3%
H2O2 in methanol for 30
min. After equilibrating for 5 min in distilled water, the samples were
heated at maximum power in a microwave for 10 min. The slides were
washed, blocked for 30 min with normal horse serum, and incubated for
2 h at room temperature with monoclonal mouse antihuman PPAR
(anti-PPAR E-8, Santa Cruz Biotechnology, Inc., Santa
Cruz, CA) or with an isotype-matched control antibody supplied in the
immunostaining kit (Santa Cruz Biotechnology, Inc.). In
some experiments, the anti-PPAR antibody was preincubated for 30 min
at room temperature with a blocking peptide specific for the
anti-PPAR antibody (Santa Cruz Biotechnology, Inc.), at
approximately 30-fold excess relative to the antigen-binding sites of
the antibody. After washes, the slides were incubated for 30 min with a
biotinylated antimouse secondary antibody (Vector Laboratories, Inc., Burlingame, CA), followed by 30-min incubation with
avidin/biotin-horseradish peroxidase complex (Vector Laboratories, Inc.) and 3-min incubation with diaminobenzidene
(Zymed Laboratories, Inc., South San Francisco, CA). The
slides were rinsed and counterstained with Mayer’s hematoxylin
(Sigma, St. Louis, MO), dehydrated in ethanol, cleared
with xylene, and mounted with glass coverslips using Histomount
(Zymed Laboratories, Inc.). Paraffin sections were stained
for cyclin E as described above, except that monoclonal anticyclin E
(Novocastra Laboratories, Newcastle upon Tyne, UK) was used as the
primary antibody, Vector NovaRED (Vector Laboratories, Inc.) was used as the substrate, and the sections were not
counterstained.
Cell cultures
Primary human cytotrophoblasts were prepared from normal term
human placentas using the trypsin-deoxyribonuclease-dispase/Percoll
method as described by Kliman (23) with previously published
modifications (24). Cultures were plated at a density of 350,000
cells/cm2 and maintained in Earl’s medium 199
containing 10% FBS (HyClone Laboratories, Inc., Logan,
UT), 20 mmol/L HEPES (pH 7.4), 0.5 mmol/L L-glutamine
(Sigma), penicillin (10 U/mL), streptomycin (10 µg/mL),
and fungizone (0.25 µg/mL). In some experiments trophoblasts were
grown in Ham’s/Waymouth’s medium (H/W) composed of equal volumes of
Ham’s F-12 medium and Waymouth’s medium, supplemented as described
above for medium 199. All cultures were maintained at 37 C in a 5%
CO2 atmosphere. Medium was changed every 24
h. Where indicated, cultures contained 8-Br-cAMP (Sigma),
troglitazone (a gift from Parke-Davis, Ann
Arbor, MI), 15-deoxy-12,14-prostaglandin
J2 (Cayman, Ann Arbor, MI), or bisphenol A
diglycidyl ether (BADGE, Fluka, Milwaukee, WI). The choriocarcinoma
cell line BeWo (25), provided by Dr. Alan Schwartz (Washington
University, St. Louis, MO), was maintained in MEM with 10% FBS and
antibiotics.
Immunofluorescence and TUNEL
Primary trophoblasts were stained with antidesmosomal and antinuclear antibodies as previously described (24). Briefly, cells were fixed with -20 C methanol for 20 min. After rinsing in phosphate-buffered saline (PBS), the cells were blocked with 2% goat serum in staining buffer (PBS/0.2% BSA/0.02% sodium azide) for 35 min in a humidified chamber at 37 C, then incubated for 35 min at 37 C with a cocktail of monoclonal mouse antihuman desmosome antibody (Sigma) and human antinuclear antibody (Antibodies, Inc., Davis, CA), diluted in staining buffer. The plates were washed, then incubated with a cocktail of fluorescein isothiocyanate-goat antimouse IgG (Fab-specific, Sigma) and tetramethylrhodamine B isothiocyanate-goat antihuman IgG (Sigma) for an additional 35 min at 37 C. After washing, the cells were mounted with Gel/Mount (Biomeda, Foster City, CA) and viewed by epifluorescence using an MRC 1024 confocal microscope and LaserSharp version 3.2 software (Bio-Rad Laboratories, Inc., Hercules, CA). A syncytium was defined as three or more nuclei in the same cytoplasm without intervening surface desmosomal membrane staining. Quantitation was performed by counting the number of syncytia per random field and the number of nuclei per syncytium. Syncytia were counted only when they were entirely contained within the field. At least four fields were counted. Statistical analysis was performed using unpaired Student’s t test with StatView 4.0 software (Abacus Concepts, Berkeley, CA).
For terminal deoxynucleotidyltransferase-mediated deoxy-UTP nick end labeling (TUNEL) staining, cells were dried over a flame, and fixed in 4% formalin for 10 min. Endogenous peroxidase was quenched with 3% H2O2, and cells were washed with PBS. The ApopTag kit (Oncor, Gaithersburg, MD) was used for TUNEL staining. Briefly, cells were incubated in an equilibration buffer for 10 min and then in a 37 C humidified chamber for 1 h with terminal deoxynucleotidyltransferase and deoxy-UTP-digoxigenin. The reaction was stopped, and cells were washed and incubated with antidigoxigenin peroxidase solution, colorized with amino ethylcarbazole (Vector Laboratories, Inc.), counterstained with hematoxylin, and examined by brightfield microscopy. The apoptotic index was defined as the number of TUNEL-positive cells divided by the total number of cells counted.
Western blotting and densitometric analysis
The plates were rinsed with PBS and lysed with 250 µL cold
lysis buffer (1% Nonidet P-40, 0.5% deoxycholate, and 0.1% SDS in
PBS) containing a protease inhibitor cocktail (Sigma). The
plates were scraped, and the lysate was sonicated three times for
10 s each time on ice with a Sonic Dismembrator 50 (Fisher,
Pittsburgh, PA). The lysates were centrifuged, and 30 µg protein/lane
were separated on 10% SDS-PAGE gels at 80 V for 3 h. After
separation, the proteins were transferred to polyvinylidene difluoride
membranes (Immobilon-P, Millipore Corp., Bedford, MA) for
3 h, 4 C at 400 mA. The blot was then rinsed briefly with 0.15
mol/L NaCl and 10 mmol/L Tris-HCl, pH 8.0, containing 0.2% Tween-20,
blocked for 30 min with 5% powdered milk in 0.15 mol/L NaCl and 10
mmol/L Tris-HCl, pH 8.0, containing 0.2% Tween-20, then incubated
overnight at 4 C with primary antibody (mouse monoclonal anti-PPAR
or mouse monoclonal anti-p53, Santa Cruz Biotechnology, Inc.). The blot was incubated for 1 h with horseradish
peroxidase-conjugated goat antimouse IgG secondary antibody
(Santa Cruz Biotechnology, Inc.), washed, and processed
for luminescence using the Amersham Pharmacia Biotech ECL
kit (Amersham Pharmacia Biotech, Arlington Heights, IL).
Densitometric analysis was performed using a Molecular Dynamics, Inc. PD densitometer and ImageQuant version 3.3
software (Molecular Dynamics, Inc., Sunnyvale, CA).
hCG concentration determination
Culture supernatants were assayed for hCG using a microparticle immunoassay (Abbott Laboratories, Abbott Park, IL). Values represent hCG secreted per 24-h interval, normalized to total cellular DNA and expressed as the mean ± SD of duplicate samples.
Transient transfection and PPRE reporter assay
The PPREx3-Luc reporter plasmid was constructed by cloning three
copies of the acyl-coenzyme A oxidase promoter PPAR response element
(PPRE) plus eight nucleotides of the 5'-flanking sequence
(AGGGGACCAGGACAAAGGTCA, where the PPRE DR-1
sequence is underlined) (26, 27, 28) into the BamHI polylinker
site in a P36-Luc reporter (29) (gift from Dr. Stuart Adler, Washington
University, St. Louis, MO) upstream of the firefly luciferase gene. The
use of three PPRE elements in the reporter constructs had been
previously described (13) and gives a more robust response than a
single PPRE and thus a more accurate quantitation of PPAR activity.
Placental trophoblasts or BeWo cells were plated 1 day before
transfection. Transfection was performed according to the
calcium-phosphate precipitation method, previously described (30, 31),
using 2.0 µg of either PPREx3-Luc or the parent P36 plasmid, 2.0 µg
salmon sperm DNA, and 0.02 µg Rous sarcoma virus-ß-galactosidase
reporter construct (to normalize for cell viability and transfection
efficiency). The luciferase assay was performed 40–48 h after the
transfection. Cells were lysed in a lysis buffer that contains 50
mmol/L Tris-2-[N-morpholino]ethanesulfonic acid (pH 7.8), 1 mmol/L
dithiothreitol, and 1% Triton X-100. Lysates were assayed for
luciferase using a luminometer (Monolight 2010, Analytical Luminescence Laboratory, San Diego, CA) and for
ß-galactosidase using a plate reader (Anthos htIII, Salzburg,
Austria). All experiments were performed in duplicate and repeated at
least three times. Results (mean ± SD) were
expressed as the fold increase in relative luciferase units, corrected
to ß-galactosidase, and compared to unstimulated cultures.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
is expressed in human villous trophoblasts
We first sought to examine the expression of PPAR in the human
placenta. For this purpose we stained sections of placentas derived
from women after uncomplicated term deliveries. As shown in Fig. 1
, a and b, syncytiotrophoblast nuclei
strongly express PPAR. Because cytotrophoblasts also appeared to
express PPAR (Fig. 1a), we stained serial sections for either
PPAR or cyclin E, which is expressed in placental cytotrophoblasts,
but not in the syncytiotrophoblast or villous core cells (32). Indeed,
cell nuclei that stained positively for cyclin E were also positive for
PPAR (Fig. 1, b and c), demonstrating that cytotrophoblasts express
PPAR. PPAR was also expressed in the nuclei of endothelial cells
in villous blood vessels (Fig. 1a) and in the nuclei of Hofbauer cells
(data not shown), but not in other villous core cells. The specificity
of the staining was confirmed in control stains in which staining was
performed in the presence of an excess of PPAR-blocking peptide
(compare Fig. 1, d and e), and also in stains in which the primary
antibody was omitted (Fig. 1f). In addition, no staining was observed
when an isotype-matched control antibody was used as the primary
antibody (data not shown).
|
expression
Because PPAR is expressed in both cytotrophoblast and
syncytiotrophoblast, we sought to determine whether its expression is
altered during trophoblast differentiation. Trophoblasts were cultured
in the presence or absence of 1 mmol/L 8-Br-cAMP, a known stimulant of
cytotrophoblast differentiation into syncytiotrophoblast (25, 33). As
shown in Fig. 2A, 8-Br-cAMP stimulated
cytotrophoblast differentiation, demonstrated by the increase in hCG
secretion during 72 h of culture. However, trophoblast
differentiation was not associated with enhanced PPAR expression
(Fig. 2B). Interestingly, culturing trophoblasts in H/W medium, which
hinders cytotrophoblast differentiation (34) (Fig. 2A) led to a
corresponding diminution of PPAR expression (5-fold by 72 h;
Fig. 2B). These data indicate that although PPAR expression is
maximal at 24 h of standard culture and cannot be further enhanced
by stimulation of differentiation, hindered differentiation is
associated with diminished PPAR expression. We further determined
whether PPAR activity changes during trophoblast differentiation.
For this purpose we transfected primary trophoblasts with a PPREx3-Luc
reporter construct that contained a luciferase gene under the control
of three PPRE sites inserted upstream of luciferase (Fig. 2C). To
control for nonspecific increases in transcription due to cellular
activation, we transfected duplicate cultures with the reporter plasmid
lacking the PPRE sites. We found that 8-Br-cAMP induced an 8- to
10-fold increase in intrinsic PPAR activity, and that this effect
was trophoblast specific, because the addition of 8-Br-cAMP did not
enhance PPREx3-Luc reporter transcription in CV-1 cells (Fig. 2C).
Addition of 8-Br-cAMP resulted in minimal (2-fold) stimulation of the
P36 control reporter in either primary trophoblasts or CV-1 cells (Fig. 2C), suggesting a nonspecific effect by 8-Br-cAMP. Taken together,
these data demonstrate that 8-Br-cAMP induces a PPRE-specific increase
in transcriptional activity in primary trophoblasts, indicative of
increased intrinsic PPAR activity. Thus, although intracellular
levels of PPAR remain unchanged, the activity of PPAR increases
when trophoblasts are stimulated to differentiate by 8-Br-cAMP.
|
ligands exhibit opposing effects on trophoblast
differentiation
To determine whether activation of PPAR alters the
differentiation of human cytotrophoblasts, we cultured trophoblasts in
the presence or absence of troglitazone or
15PGJ2. We first established that both ligands
stimulate PPAR activity using the choriocarcinoma cell line BeWo. As
shown in Fig. 3A, both ligands enhanced
luciferase expression from the PPREx3-Luc reporter construct,
reflecting PPAR activation. Importantly, primary trophoblasts
incubated in the presence of troglitazone exhibited a 2-
to 5-fold increase in hCG secretion relative to control cultures at
72 h (Fig. 3B), indicating enhancement of biochemical
differentiation of cytotrophoblasts. In contrast, incubation in the
presence of 15PGJ2 diminished hCG production
from trophoblasts. To eliminate the possibility that a lower
concentration of either ligand might have a different effect on
trophoblast differentiation, we titrated troglitazone or
15PGJ2 in trophoblast cultures. As shown in
Fig. 3C, troglitazone stimulated hCG secretion at 1.0 and
10 µmol/L, whereas 15PGJ2 led to a
concentration-dependent decrease in hCG secretion at the same
concentrations. Taken together, these data indicate that the disparate
effects of the two ligands on trophoblast differentiation were
maintained even at a lower concentration. Interestingly, addition of
the PPAR antagonist BADGE (35) led to a decrease in both basal and
troglitazone-induced hCG production (Fig. 3D), supporting
the idea that prodifferentiation PPAR ligands may predominate in
native trophoblast cultures. In addition, when trophoblasts were
cultured in the presence of both troglitazone and
8-Br-cAMP, an additive increase in hCG secretion was observed compared
to that with either substance alone, whereas cultures exposed
simultaneously to 15DPGJ2 and 8-Br-cAMP showed
only a slight increase in hCG secretion relative to those given
15DPGJ2 alone (data not shown). These results are
consistent with the induction of an endogenous ligand by 8-Br-cAMP and
indicate that the effect of 15DPGJ2 is dominant
over that of 8-Br-cAMP.
|
PGJ2 on trophoblast differentiation, we
examined syncytium formation as an indicator of morphological
differentiation. As shown in Fig. 4, in
control cultures most trophoblasts were present as mononucleated
cytotrophoblasts at 24 h (1.5 ± 0.6 syncytia/field, 4.3
± 1.0 nuclei/syncytium), with more abundant, larger syncytia at
48 h (4.3 ± 1.0 syncytia/field; P = 0.001
vs. 24 h; and 11.6 ± 8.4 nuclei/syncytium,
P = 0.04 vs. 24 h). Syncytium formation
was accelerated in cultures containing troglitazone,
yielding 5.8 ± 2.5 syncytia/field (P = 0.01
vs. 24-h control) with 6.9 ± 3.1 nuclei/syncytium at
24 h. Syncytia were larger and more abundant at 48 h, such
that each field usually consisted of 2–3 large syncytia (>15
nuclei/syncytium) that extended beyond the edges of the field, making
quantitation of random fields impossible. By 72 h, both control
and troglitazone-containing cultures consisted of these
large syncytia and were indistinguishable from each other. In contrast,
trophoblasts cultured in the presence of
15PGJ2 showed little syncytium formation
throughout the culture period, yielding 0.8 ± 1.3, 1.3 ±
1.4, and 0.8 ± 1.2 syncytia at 24, 48, and 72 h,
respectively (P = NS vs. control at 24,
P = 0.001 vs. control at 48 h, and
qualitatively markedly different at 72 h). Furthermore, each
syncytium contained only 3–4 nuclei. Therefore, we concluded that
troglitazone enhances biochemical and morphological
differentiation of cytotrophoblasts, whereas
15PGJ2 abrogates cytotrophoblast
differentiation.
|
PGJ2 stimulates trophoblast apoptosis
Trophoblasts cultured in the presence of
15PGJ2 exhibit small, dense nuclei and nuclear
fragments (Fig. 4
, 15PGJ2), suggesting that
the trophoblasts may be undergoing apoptosis. Because of this
observation and because 15PGJ2 has been shown
to induce apoptosis in the JEG-3 cell line (36) and in other cells (9, 37, 38), we evaluated whether 15PGJ2 induces
apoptosis in primary human trophoblasts. As shown in Fig. 5A, 15PGJ2
enhanced trophoblast apoptosis (apoptotic index, 14.3%) relative to
the control (apoptotic index, 4.3%), determined by the TUNEL
technique. There was no increase in apoptosis when trophoblasts were
incubated with troglitazone (apoptotic index, 3.2%).
Because it is known that diverse apoptotic stimuli induce the
accumulation and activation of the tumor suppressor protein p53, which,
in turn, can activate the apoptotic cascade (39, 40), we examined the
effects of 15PGJ2 and
troglitazone on p53 expression. We found that
15PGJ2 induced a 4- to 5-fold increase in p53
expression compared to either control cultures or cultures containing
troglitazone (Fig. 5B). Taken together, we conclude that
the two PPAR ligands have opposing effects on trophoblasts, with
troglitazone promoting differentiation and
15PGJ2 diminishing differentiation and
inducing apoptosis.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, a nuclear
protein that is essential for proper placental development and
trophoblast differentiation in the mouse (21, 22), is expressed in
human placental cytotrophoblast and syncytiotrophoblast, and that the
expression and activity of PPAR are associated with trophoblast
differentiation. These findings suggest that PPAR may play an
important function in the differentiation of human trophoblasts.
Importantly, PPAR is a ligand-dependent nuclear receptor. PPAR
ligands modulate differentiation (5, 7, 8, 13, 17, 18, 19, 20) and apoptosis
(9, 38) in other cell systems. We selected two ligands known to
stimulate PPAR activity, namely the thiazolidinedione
troglitazone and the prostanoid
15PGJ2. Surprisingly, we found that whereas
troglitazone stimulates biochemical and morphological
differentiation of trophoblasts, 15PGJ2
hinders differentiation and induces apoptosis. The ability of
troglitazone to induce differentiation of human
trophoblast, the diminution of hCG production by the PPAR antagonist
BADGE, and the disrupted differentiation observed in PPAR-deficient
mice (21) suggest that an endogenous, troglitazone-like
ligand predominates during trophoblast differentiation in
vivo. The possibility that PPARs play a role in trophoblast
differentiation was first reported by Matsuo and Strauss using the
choriocarcinoma cell line JEG-3 (41). They demonstrated that when
ligands for retinoid X receptor, the heterodimer partner of
PPARs, were added to cultures of JEG-3 cells, hCG secretion was
enhanced. In addition, when ligands for PPAR were added to the
cultures, hCG secretion was diminished.
Biochemical and morphological trophoblast differentiation are
stimulated by 8-Br-cAMP (25, 33, 42). Whereas 8-Br-cAMP enhances hCG
secretion, the intracellular levels of PPAR remain constant
throughout the culture period. These results suggest that the stimulus
for trophoblast differentiation induces an endogenous ligand for
PPAR. When trophoblasts were cultured in the presence of both
troglitazone and 8-Br-cAMP, an additive increase in hCG
secretion was observed compared to that with either substance alone
(data not shown), supporting the hypothesis that 8-Br-cAMP induces an
endogenous PPAR ligand. Alternatively, because PPAR is
inactivated by phosphorylation (43, 44, 45), dephosphorylation and
subsequent stimulation of PPAR may explain PPAR activation during
trophoblast differentiation. Experiments are currently underway to
determine whether ligand production is enhanced or the phosphorylation
state is altered in trophoblasts exposed to 8-Br-cAMP. Interestingly,
when trophoblasts are cultured in H/W medium, which is known to hinder
trophoblast differentiation, PPAR expression is diminished. These
data are consistent with those presented by Barak et al.
(21), who reported that maturation of the early labyrinthine parenchyma
into chorionic villi trophoblast is blocked in mice lacking PPAR.
Together, it is likely that PPAR activity is essential for
trophoblast differentiation.
In contrast to troglitazone, the putative natural PPAR
ligand 15PGJ2 hinders trophoblast
differentiation and induces apoptosis. The ability of
15PGJ2 to induce apoptosis has been documented
in monocytes (9) and endothelial cells (38). In addition, Ikai et
al. (46) demonstrated that another PGD2
derivative, 12-PGJ2,
increased p53 expression and apoptosis in endothelial cells. Our
results are also supported by Clay et al. (37), who found
that 15PGJ2, but not
troglitazone, stimulated apoptosis in breast cancer cell
lines. There are at least two explanations for the disparate effects of
troglitazone and 15PGJ2 on
trophoblasts. The first involves ligand- and promoter-specific
conformational changes in the protein, which result in altered capacity
to physically interact with a distinct set of coregulators, where one
coregulator complex stimulates gene expression, and the other represses
expression. For example, it is known that the antiestrogen
4-hydroxytamoxifen induces a conformational change in the estrogen
receptor (ER) distinct from that induced by estradiol (47, 48). This
conformational change inhibits activation via the ligand-dependent AF-2
domain, thus accounting for the antagonistic effects of
4-hydroxytamoxifen on estrogen-mediated ER responses. Studies are
currently underway to pursue this possibility. Alternatively, the
possibility that one or both PPAR ligands may act independently of
PPAR, as previously suggested using other cells (49, 50, 51, 52), cannot be
excluded. Experiments using the combination of
15DPGJ2 and BADGE are unable to resolve this
issue because both compounds inhibit hCG secretion in primary
trophoblasts. Therefore, when both compounds are added to trophoblast
cultures, no increase in hCG secretion is observed (data not shown).
Regardless of their mechanism of action, the opposing effects of
troglitazone and 15PGJ2 on
trophoblast differentiation may elucidate the processes that govern
trophoblast differentiation and apoptosis.
Our data may have profound clinical implications. Dysfunction of the
human placenta may result in fetal growth restriction (53, 54), a
condition associated with abnormal trophoblast differentiation and
enhanced apoptosis (55). If, in fact, 15PGJ2
causes placental trophoblast apoptosis in vivo, it would be
intriguing to determine whether 15PGJ2 levels
are increased in conditions such as fetal growth restriction. In this
scenario, inhibition of 15PGJ2 production and
stimulation of the troglitazone pathway might reverse the
apoptotic pathway and support placental development and
differentiation.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received February 29, 2000.
Revised June 22, 2000.
Accepted July 10, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, -ß, and - in the adult rat. Endocrinology. 137:354–366.[Abstract]
2:tissue-specific regulator of an adipocyte
enhancer. Genes Dev. 8:1224–1234.: adipose-
predominant expression and induction early in adipocyte
differentiation. Endocrinology. 135:798–800.[Abstract]
and the retinoid X
receptor. Proc Natl Acad Sci USA. 94:237–241. promotes monocyte/macrophage differentiation and
uptake of oxidized LDL. Cell. 93:241–252.[CrossRef][Medline]
is activated by inducers
of adipogenesis, including thiazolidinedione drugs. Eur J Biochem. 239:1–7.[Medline]
and
. Proc Natl Acad Sci USA. 94:4318–4323.. Cell. 93:229–240.[CrossRef][Medline]
. Cell. 83:803–812.[CrossRef][Medline]
and
promotes adipocyte differentiation. Cell. 83:813–819.[CrossRef][Medline]
(PPAR ). J Biol Chem. 270:12953–12956. agonism and the antihyperglycemic
activity of thiazolidinediones. J Med Chem. 39:665–668.[CrossRef][Medline]
2, a lipid-activated
transcription factor. Cell. 79:1147–1156.[CrossRef][Medline]
and C/EBP. Proc Natl Acad Sci USA. 92:9856–9860.. Mol
Cell. 1:465–470.[CrossRef][Medline]
is
required for placental, cardiac, and adipose tissue development. Mol
Cell. 4:585–595.[CrossRef][Medline]
mediates high-fat diet-induced adipocyte hypertrophy and insulin
resistance. Mol Cell. 4:597–609.[CrossRef][Medline]
inhibits adipocyte differentiation. J Biol Chem. 275:1873–1877., induces apoptosis in JEG3
choriocarcinoma cells. Biochem Biophys Res Commun. 262:579–585.[CrossRef][Medline]
. Science. 274:2100–2103. is inhibited by phosphorylation at
a consensus mitogen-activated protein kinase site. J Biol Chem. 272:5128–5132. responses of macrophages to
lipopolysaccharide in vitro or in vivo. J
Immunol. 164:1046–1054.. Diabetes. 48:254–260.[Abstract]
This article has been cited by other articles:
 |
|
 |
|
  M. Vore and M. Leggas Progesterone Acts via Progesterone Receptors A and B to Regulate Breast Cancer Resistance Protein Expression Mol. Pharmacol., March 1, 2008; 73(3): 613 - 615. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A Desmarais, F. L Lopes, H. Zhang, S. K Das, and B. D Murphy The Peroxisome Proliferator-Activated Receptor Gamma Regulates Trophoblast Cell Differentiation in Mink (Mustela vison) Biol Reprod, November 1, 2007; 77(5): 829 - 839. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. T. Schaiff, F. F. Knapp Jr., Y. Barak, T. Biron-Shental, D. M. Nelson, and Y. Sadovsky Ligand-Activated Peroxisome Proliferator Activated Receptor {gamma} Alters Placental Morphology and Placental Fatty Acid Uptake in Mice Endocrinology, August 1, 2007; 148(8): 3625 - 3634. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Cervar-Zivkovic, C. Hu, A. Barton, Y. Sadovsky, G. Desoye, U. Lang, and D.M. Nelson Endothelin-1 Attenuates Apoptosis in Cultured Trophoblasts From Term Human Placentas Reproductive Sciences, July 1, 2007; 14(5): 430 - 439. [Abstract] [PDF]
|
|
|
|
 |
|
 J. Weissgarten, S. Berman, S. Efrati, M. Rapoport, Z. Averbukh, and L. Feldman Apoptosis and proliferation of cultured mesangial cells isolated from kidneys of rosiglitazone-treated pregnant diabetic rats Nephrol. Dial. Transplant., May 1, 2006; 21(5): 1198 - 1204. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. R. Tobin, N. K. Harsem, K. T. Dalen, A. C. Staff, H. I. Nebb, and A. K. Duttaroy Regulation of ADRP expression by long-chain polyunsaturated fatty acids in BeWo cells, a human placental choriocarcinoma cell line J. Lipid Res., April 1, 2006; 47(4): 815 - 823. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Peraza, A. D. Burdick, H. E. Marin, F. J. Gonzalez, and J. M. Peters The Toxicology of Ligands for Peroxisome Proliferator-Activated Receptors (PPAR) Toxicol. Sci., April 1, 2006; 90(2): 269 - 295. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. P. Hewitt, P. J. Mark, and B. J. Waddell Placental Expression of Peroxisome Proliferator-Activated Receptors in Rat Pregnancy and the Effect of Increased Glucocorticoid Exposure Biol Reprod, January 1, 2006; 74(1): 23 - 28. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. T. Schaiff, I. Bildirici, M. Cheong, P. L. Chern, D. M. Nelson, and Y. Sadovsky Peroxisome Proliferator-Activated Receptor-{gamma} and Retinoid X Receptor Signaling Regulate Fatty Acid Uptake by Primary Human Placental Trophoblasts J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4267 - 4275. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. D. Mitchell, M. C. Chang, T. Chaiworapongsa, H.-Y. Lan, R. J. A. Helliwell, R. Romero, and T. A. Sato Identification of 9{alpha},11{beta}-Prostaglandin F2 in Human Amniotic Fluid and Characterization of Its Production by Human Gestational Tissues J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4244 - 4248. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. B. E. Berry, J. A. Keelan, R. J. A. Helliwell, R. S. Gilmour, and M. D. Mitchell Nanomolar and Micromolar Effects of 15-Deoxy-{Delta}12,14-prostaglandin J2 on Amnion-Derived WISH Epithelial Cells: Differential Roles of Peroxisome Proliferator-Activated Receptors {gamma} and {delta} and Nuclear Factor {kappa}B Mol. Pharmacol., July 1, 2005; 68(1): 169 - 178. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. M Lindstrom and P. R Bennett 15-Deoxy-{Delta}12,14-Prostaglandin J2 Inhibits Interleukin-1{beta}-Induced Nuclear Factor-{kappa}B in Human Amnion and Myometrial Cells: Mechanisms and Implications J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3534 - 3543. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Li, J. Dakour, L. J. Guilbert, B. Winkler-Lowen, F. Lyall, and D. W. Morrish PL74, a Novel Member of the Transforming Growth Factor-{beta} Superfamily, Is Overexpressed in Preeclampsia and Causes Apoptosis in Trophoblast Cells J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3045 - 3053. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. L. Waite, R. E. Louie, and R. N. Taylor Circulating Activators of Peroxisome Proliferator-Activated Receptors Are Reduced in Preeclamptic Pregnancy J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 620 - 626. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Bildirici, C.-R. Roh, W. T. Schaiff, B. M. Lewkowski, D. M. Nelson, and Y. Sadovsky The Lipid Droplet-Associated Protein Adipophilin Is Expressed in Human Trophoblasts and Is Regulated by Peroxisomal Proliferator-Activated Receptor-{gamma}/Retinoid X Receptor J. Clin. Endocrinol. Metab., December 1, 2003; 88(12): 6056 - 6062. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. M. Nelson, S. D. Smith, T. C. Furesz, Y. Sadovsky, V. Ganapathy, C. A. Parvin, and C. H. Smith Hypoxia reduces expression and function of system A amino acid transporters in cultured term human trophoblasts Am J Physiol Cell Physiol, February 1, 2003; 284(2): C310 - C315. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Yan, J.-F. Mouillet, Q. Ou, and Y. Sadovsky A Novel Domain within the DEAD-Box Protein DP103 Is Essential for Transcriptional Repression and Helicase Activity Mol. Cell. Biol., January 1, 2003; 23(1): 414 - 423. [Abstract] [Full Text]
|
|
|
|
|
|
M. Lappas, M. Permezel, H. M. Georgiou, and G. E. Rice Regulation of Proinflammatory Cytokines in Human Gestational Tissues by Peroxisome Proliferator-Activated Receptor-{gamma}: Effect of 15-Deoxy-{Delta}12,14-PGJ2 and Troglitazone J. Clin. Endocrinol. Metab., October 1, 2002; 87(10): 4667 - 4672. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Capparuccia, D. Marzioni, A. Giordano, F. Fazioli, M. De Nictolis, N. Busso, T. Todros, and M. Castellucci PPAR{gamma} expression in normal human placenta, hydatidiform mole and choriocarcinoma Mol. Hum. Reprod., June 1, 2002; 8(6): 574 - 579. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. L. Schild, W. T. Schaiff, M. G. Carlson, E. J. Cronbach, D. M. Nelson, and Y. Sadovsky The Activity of PPAR{gamma} in Primary Human Trophoblasts Is Enhanced by Oxidized Lipids J. Clin. Endocrinol. Metab., March 1, 2002; 87(3): 1105 - 1110. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Mohan, J.R. Malayer, R.D. Geisert, and G.L. Morgan Expression Patterns of Retinoid X Receptors, Retinaldehyde Dehydrogenase, and Peroxisome Proliferator Activated Receptor Gamma in Bovine Preattachment Embryos Biol Reprod, March 1, 2002; 66(3): 692 - 700. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Michimata, H. Tsuda, M. Sakai, M. Fujimura, K. Nagata, M. Nakamura, and S. Saito Accumulation of CRTH2-positive T-helper 2 and T-cytotoxic 2 cells at implantation sites of human decidua in a prostaglandin D2-mediated manner Mol. Hum. Reprod., February 1, 2002; 8(2): 181 - 187. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. E. Crawford, C. Qi, P. Misra, V. Stellmach, M. S. Rao, J. D. Engel, Y. Zhu, and J. K. Reddy Defects of the Heart, Eye, and Megakaryocytes in Peroxisome Proliferator Activator Receptor-binding Protein (PBP) Null Embryos Implicate GATA Family of Transcription Factors J. Biol. Chem., January 25, 2002; 277(5): 3585 - 3592. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Tarrade, K. Schoonjans, L. Pavan, J. Auwerx, C. Rochette-Egly, D. Evain-Brion, and T. Fournier PPAR{gamma}/RXR{alpha} Heterodimers Control Human Trophoblast Invasion J. Clin. Endocrinol. Metab., October 1, 2001; 86(10): 5017 - 5024. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Tarrade, K. Schoonjans, J. Guibourdenche, J. M. Bidart, M. Vidaud, J. Auwerx, C. Rochette-Egly, and D. Evain-Brion PPAR{gamma}/RXR{alpha} Heterodimers Are Involved in Human CG{beta} Synthesis and Human Trophoblast Differentiation Endocrinology, October 1, 2001; 142(10): 4504 - 4514. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
