| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Division of Human Reproduction and the Center for Research on Reproduction and Women’s Health, Department of Obstetrics and Gynecology (A.M., G.C., C.C.) and Pulmonary Division, Department of Medicine (K.A.), University of Pennsylvania Medical Center, Philadelphia, Pennsylvania 19104; and Vincent Center for Reproductive Biology, Department of Obstetrics and Gynecology (J.L.T.), Massachusetts General Hospital/Harvard Medical School, Boston, Massachusetts 02114
Address correspondence and requests for reprints to: Christos Coutifaris M.D., Ph.D., Division of Human Reproduction, Department of Obstetrics and Gynecology, University of Pennsylvania, 106 Dulles, 3400 Spruce Street, Philadelphia, Pennsylvania 19104. E-mail: ccoutifaris{at}obgyn.upenn.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2.8 kb) p53 mRNA transcript and two primary (1.8 and 3.5 kb)
WT1 mRNA transcripts. Western blot analysis of nuclear protein extracts
from human GCs yielded one immunoreactive protein of the expected size
(53 kDa) recognized by a p53 antibody and one immunoreactive protein
of the expected size (52–54 kDa) recognized by the WT1 antibody.
Immunohistochemical staining showed that both molecules were localized
to nuclei of human GCs and were coordinately regulated during
follicular development. Immunofluorescence analysis showed that p53
protein was localized exclusively to nuclei of GCs undergoing apoptosis
during in vitro culture and was similarly localized to
nuclei and cytoplasm of apoptotic granulosa cells in atretic follicles
in vivo. To further evaluate whether human GC apoptosis
is linked to increased expression of tumor suppressor genes, we
analyzed levels of p53 and WT1 mRNA and protein in GCs induced to
undergo apoptosis in vitro. Healthy (nonapoptotic) GCs
snap-frozen immediately after isolation from patients undergoing
in vitro fertilization-embryo transfer possessed
relatively low, but detectable, levels of p53 and WT1 mRNA and protein.
However, following serum-free culture to induce apoptosis, p53 mRNA and
protein levels increased significantly after 24 h, paralleling the
increase in the number of apoptotic GCs. The induction of both p53 mRNA
and protein in GCs was inhibited by the addition of human CG to the
culture medium. In contrast, WT1 mRNA and protein levels remained
constitutive in GCs incubated for 24 h compared with GCs
snap-frozen immediately after isolation. We conclude that the p53 and
WT1 genes are expressed at the mRNA and protein levels in human GCs and
that expression of p53 is regulated during follicular maturation.
Nuclear accumulation of p53 protein occurs in human GCs during
apoptosis in vitro and in vivo, and p53
mRNA and protein are up-regulated in GCs starved of hormonal support
but down-regulated by the presence of human CG. We propose that the
products of these two principal tumor suppressor genes serve as
important regulators of human follicular development and corpus luteum
function. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The p53 gene is one of the most highly investigated tumor suppressor genes and seems to be a key player in apoptosis (5, 7). In the context of mechanisms to repair genetic damage, p53 intervenes to protect the cellular genome from a variety of deleterious stimuli, such as reactive oxygen species and ionizing radiation (8, 9). Damage to DNA elicits a rapid increase in p53 protein levels, followed by cell cycle arrest, the latter of which allows for repair of the damage before DNA synthesis occurs. However, if the insult is extensive, the continued elevation of p53 can trigger apoptosis as a means of eliminating that cell and maintaining genetic homeostasis (5, 9, 10). Wild-type p53 mediates apoptosis through a variety of pathways, some of which have been partially characterized (5). For example, many p53-regulated target genes have been identified, including the bcl-2 pro-survival gene (11), the bax proapoptotic gene, and several reduction-oxidation genes (12). Moreover, the ability of p53 to alter the transcriptional activity of target genes can be modulated by another antioncogenic protein, the product of the Wilms’ tumor suppressor gene (WT1) (13, 14). The WT1 gene was first identified in the urogenital system, encoding a transcription factor of 52–54 kDa (15). At least four isoforms of WT1 have been identified in cells expressing the gene, probably arising from alternative processing (14, 16).
In the female reproductive system, both p53 and WT1 have been implicated as important contributors to the development and function of the gonads. Although disruption of the p53 gene does not seem to impart a decline in fertility in females (17), WT1-null mice exhibit pronounced gonadal dysgenesis (18). The negative impact of WT1 deficiency on gonadal development likely stems from the central role of the protein in controlling expression of genes important for mammalian sex determination (19). Additionally, postnatal expression of WT1 in rat, pig, monkey, and chicken granulosa cells is regulated in a maturation and gonadotropin-dependent manner (20, 21). Regarding p53, nuclear accumulation of this tumor suppressor protein has been documented in granulosa cells of follicles destined for atresia in the rat ovary, whereas in vivo gonadotropin priming inhibits granulosa cell apoptosis with a concomitant suppression of p53 immunoreactivity (20). These initial investigations have since been confirmed and extended by a number of laboratories, collectively supporting the hypothesis that nuclear translocation of p53 in granulosa cells heralds their demise during follicular atresia (22, 23). That p53 serves a similar function in the human ovary is suggested by the findings of p53 expression in the human ovary and isolated granulosa cells (24), as well as by recent studies on the ability of overexpressed p53 to induce apoptosis in transformed human granulosa cell lines (25). However, the spatial localization of p53 in the human ovary during follicular development and the regulation of tumor suppressor gene expression in nontransformed human GCs remain to be determined.
Based on these discussions, the present studies were conducted to further examine the possible roles of p53 and WT1 in regulating apoptosis during follicular development and luteal function in the human ovary using a combination of in vivo and in vitro approaches.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
All reagents were of analytical grade and were purchased from Sigma Chemical Co. (St. Louis, MO), unless otherwise stated. The monoclonal WT1 antibody (H2) was purchased from DAKO Corp. (Carpenteria, CA), the polyclonal WT1 antibody (C19) was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), and the monoclonal anti-p53 antibody (Ab-5) was purchased from Oncogene Research Products (Cambridge, MA). The cDNAs for human WT1 and human p53 used for Northern blotting were kind gifts from Donna George (Department of Genetics, University of Pennsylvania, Philadelphia, PA). The pWT33 plasmid was a kind gift from Frank Rauscher (Wistar Institute, Philadelphia, PA) (26).
Cell culture and treatments
Human GCs were isolated by follicular aspiration from 16 patients between the ages of 25 to 43 yr who were undergoing in vitro fertilization/embryo transfer. These cells had been exposed in vivo to a follicular recruitment regimen, including a gonadotropin-releasing hormone agonist (Lupron; TAP Pharmaceuticals, Inc., Deerfield, IL) for pituitary supression and FSH (Fertinex or Gonal-F; Serono, Randolph, MA) for follicular stimulation. Moreover, all patients had received a single dose of 10,000 IU purified human CG (hCG) (Profasi; Serono) 36 h before follicular aspiration. The follicular fluid was collected and centrifuged. The sedimented cells were resuspended in Ca++-Mg++-free HBSS (Life Technologies, Inc., Grand Island, NY), overlayed on Ficoll-paque (Pharmacia Biotech, Uppsala, Sweden) and centrifuged at 400 x g for 30 min at room temperature. The cells were collected from the interphase. The isolated GCs were suspended, washed twice with Ca++-Mg++-free HBSS, and cultured in Hams F-12:DMEM (1:1. v/v; Life Technologies, Inc.) media supplemented with 10% FBS, penicillin (10 U/mL), streptomycin (0.05 mg/mL), and fungizone (0.25 mg/mL). In some experiments, cultured GCs were treated with 1 IU/mL hCG in serum-free Hams F-12:DMEM (1:1, v/v) medium with 0.2% BSA and 10 mM HEPES. Contamination with monocytes, identified by the anti-CD14 monoclonal antibody (mAb; Becton Dickinson and Co., Lincoln Park, NJ), was less than 2% (data not shown). Each experiment was performed at least three times with different cell preparations to ensure consistency of the findings.
Collection and processing of human ovarian tissue
Ovarian cortical biopsies measuring 1 mm in thickness were
collected from four parous, healthy women, between the ages of 25 and
34 yr, undergoing elective laparoscopic tubal ligation. This protocol
was reviewed and approved by the Institutional Review Board.
Participation was voluntary, and each patient gave informed consent.
The ovarian tissue was transferred in sterile bicarbonate-buffered
Waymouth medium (HyClone Laboratories, Inc., Logan, UT)
containing 0.5% BSA. The tissue, while submerged in medium, was
examined under a stereomicroscope (Nikon) and
loosely dissected with two sterile 27-gauge tuberculin needles. The
ovarian tissue was minced and placed in a sterile capped test tube with
5 mL bicarbonate-buffered Waymouth medium supplemented with 0.5% BSA,
0.1% crude collagenase (Collagenase type XI, 1660 units/mg solid), and
0.01% DNAse (DNAse I, 440 Kunitz units/mg solid). Digestion of the
tissue was performed for 3 h at 37 C, and the homogenate was then
diluted 1:5 with sterile Waymouth medium. The digested tissue was then
scanned under a stereomicroscope, and preantral follicles were
identified, isolated, and recovered with hand-drawn sterilized glass
micropipets. Individual follicles were transferred to glass slides
precoated with poly-L-lysine for attachment and further processing for
indirect immunofluorescence.
RNA isolation
Total cellular RNA was extracted from primary cultures of GCs, as described previously (27). Briefly, samples were frozen in liquid nitrogen, homogenized in 4 M acid guanidinium thiocyanate, phenol-chloroform extracted, and ethanol precipitated to recover total RNA. After quantitation by measuring the absorbance at 260 nm, the RNA samples were used for the RT-PCR and Northern blot analysis, as described below.
RT-PCR
Five micrograms of total RNA from each sample were denatured at 65 C for 5 min and chilled rapidly on ice. The RNA was then reverse transcribed in 50 mL 1x RT buffer [50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, and 10 mM DTT] containing 40 pmol random hexamer primers; 0.5 mM each of dATP, dCTP, dGTP, and dTTP; 80 U RNasin (Promega Corp., Madison, WI); and 500 U Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.) for 1 h at 37 C. Afterward, 50 µL water were added, and the mixture was heated to 94 C. To check the integrity of the RT reaction, a 10-µL aliquot of the reverse transcribed product was cycled by PCR to amplify ß-actin cDNA. The reaction was carried out for 35 cycles (90 C for 50 sec, 56 C for 60 sec, 72 C for 8 min) in 50 µL 1x PCR buffer [20 mM Tris-HCl (pH 8.4), 50 mM KCl, and 1.5 mM MgCl2) containing 0.25 mM each of dATP, dCTP, dGTP, and dTTP; 1.5 U Taq DNA polymerase (Life Technologies, Inc.), and 100 ng of each of the following human ß-actin amplimers (forward: either 5'ATGGATGATGATATCGCCGC3' or 5'CATGGGTCAGAAGGATTCAT3'; reverse: 5'TTAATGTCACGCACGATTTC3'). As expected (28), two products of 637 bp or 500 bp were generated after PCR amplification using the reverse primer coupled with the first or second forward primer, respectively.
For analysis of WT1 or p53 gene expression, 10-µL aliquots of reverse
transcribed cDNA were cycled under the same PCR conditions. For WT1
analysis, the primers used were derived from that reported by Gessler
et al. (29), as follows (see also Fig. 1
): A:
5'ATGGGCTCCGACGTGCGGGA3'
(forward); B:
5'TGACAATTTATACCAAATGA3'
(forward); C:
5'TGAATGCCACTGAAGACAACC3'
(reverse); D:
5'AGACATACAGGTGTGAAA3'
(forward); E:
5'GACTAATTCATCTGACCGGGC-AAA3'
(reverse); F:
5'GCCCAATACAGAATACACA3'
(forward); G:
5'TCACACACTGTGCTGCCT3'
(reverse).
|
Northern blot analysis
For Northern blotting, 20 µg total RNA from each sample were separated by electrophoresis through a 1.2% agarose/2.2 M formaldehyde 4-morpholinepropanesulfonic acid gel. Equal loading of RNA was confirmed by ethidium bromide staining of ribosomal RNAs. The RNA was transferred to a Zeta-probe nylon membrane (Bio-Rad Laboratories, Inc. Melville, NY) and hybridized for 16–20 h at 60 C to a radiolabeled fragment of the human WT1 cDNA or p53 cDNA in 0.5 M sodium phosphate (pH 7.2), 7% SDS, and 1.0 mM ethylenediaminetetraacetate (EDTA). Blots were washed twice in 2% SDS, 40 mM sodium phosphate (pH 7.2), and 1 mM EDTA for 30 min at 65 C and exposed to Kodak X-OMAT film at -70 C.
Immunoblot analysis
Nuclear extracts were prepared from flasks of primary cultures of human GCs by the methods of Zumbasasen and Stoffel (31). Adherent GCs were scraped into 5 mL ice-cold phosphate-buffered saline (PBS), pelleted, and washed twice with PBS. The cell pellet (1 x 106 cells per 0.1 mL) was resuspended in a lysis buffer consisting of 10 mM Tris-HCl (pH 8.0), 60 mM KCl, 1 mM EDTA, 0.5% Nonidet P-40, 1 mM DTT, 1 mM phenylmethlysulfonyl fluoride, and 1 mM benamide, incubated on ice for 10 min, and centrifuged at 1200 x g at 4 C for 5 min. The pelleted nuclei were washed briefly in lysis buffer without Nonidet P-40 and resuspended in an extraction buffer consisting of 20 mM Tris-HCl (pH 8.0), 20 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, and 25% glycerol, and lysed by adding NaCl to a final concentration of 400 mM. The extraction was carried out on ice for 10 min with periodic brief vortexing, and the lysate was then centrifuged for 10 min at 16,000 x g at 4 C. The supernatant containing the nuclear protein extract was processed for protein quantitation by the Bradford method (32). Fifty micrograms of protein from each sample were mixed with Laemmli sample buffer containing ß-mercaptoethanol (5%) and boiled for 5 min. Proteins were then separated by SDS-PAGE (10% gels) and electrophoretically transferred onto polyvinylidene difluoride membranes (NEN Life Science Products-Dupont, Boston, MA). The membranes were rinsed in PBS and then blocked for 30 min in 4% nonfat milk in prepared in TBST buffer [50 mM Tris-HCl (pH 7.5), 171 mM NaCl, and 0.05% Tween-20]. The blots were incubated with the WT1-H2 or p53 antibody (at a concentration 1 µg/mL) in TBST for 1 h and then washed three times (5 min each) in TBST with vigorous shaking. The blots were incubated in a horseradish peroxidase-labeled antimouse secondary antibody (diluted 1:6000 in TBST) for 30 min, washed three times (5 min each) in TBST, and visualized using enhanced chemiluminescence according to the manufacturer’s instructions (NEN Life Science Products-Dupont).
Indirect immunofluorescence
Cells grown on coverslips (Nunc, Roskilde, Denmark) were washed twice in prewarmed (37 C) DMEM and twice in prewarmed (37 C) PBS containing 1.5 mM Ca++, and then were fixed in 100% methanol at -20 C for 5 min. Cells were incubated in 10% normal goat serum (30 min at room temperature) and then with one of the primary antibodies (either WT1-H2 or p53-Ab-5; at a concentration of 10 µg/mL) for 2 h at room temperature. A fluorescein-conjugated goat antimouse secondary antibody (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA), used at a 1:200 dilution, was added, and the sections were incubated for 30 min at room temperature. Coverslips were mounted on glass slides with Fluoromount G (Fisher Scientific, Malvern, PA), containing 1,4-diazabicyclo(2.2.2)octane (Polysciences Inc., Warrington, PA) to stabilize the fluorescence, and photographed with a Nikon microscope.
Double immunofluoresence analysis was carried out by combining the polyclonal anti-WT1 antibody with the mAb against p53. After fixation, cells were incubated in 10% goat serum-10% swine serum (30 min at room temperature), followed by a 2-h room temperature incubation with the primary antibodies. Cells were then washed thoroughly with PBS-4% BSA and incubated with a fluorescein-conjugated goat antimouse IgG and/or a rhodamine-conjugated swine antirabbit IgG secondary antibody (Jackson ImmunoResearch Laboratories, Inc.) at a dilution of 1:200 in PBS-4% BSA for 30 min. Coverslips were mounted on glass slides with Fluoromount G containing 1,4-diazabicyclo-(2.2.2)octane to stabilize fluorescence. Cells were examined and photographed with a Nikon microscope.
Immunohistochemistry
Paraffin-embedded human archival ovarian tissue sections (5 µm thick) were deparaffinized at 70 C in xylene, rehydrated through a graded ethanol series, and rinsed in PBS (pH 7.4). Sections were treated with 0.1% hydrogen peroxide for 30 min at 20 C (to inactivate endogenous peroxidase activity) and washed in PBS. Sections were then digested with prewarmed pepsin (0.65 mg/mL in PBS) at 40 C for 5 min, blocked with 5% goat serum, and then incubated with the primary antibody (WT1-H2, 10 µg/mL) or p53 (10 µg/mL) for 1 h at room temperature. Localization of the primary antibody was performed by incubation of the sections with a biotinylated antimouse IgG antibody, and the biotin was detected using an avidin-biotin-peroxidase kit (Vector Laboratories, Inc. Burlingame, CA) with diaminobenzadine as the chromogenic substrate. Control sections were processed in an identical manner by substitution of the primary antibody with a purified mouse IgG fraction. For the archival ovarian tissue specimens used in this study, dating of the phase of the menstrual cycle was performed using endometrial tissue specimens from the same patients, according to the criteria of Noyes et al. (33).
In situ detection of apoptosis
Terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) assay. Apoptosis was detected by 3'-end labeling of DNA fragments in situ using the ApopTag In-Situ Apoptosis Detection kit (Oncor, Gaithersburg, MD), according to the manufacturer’s guidelines. Briefly, GCs were fixed in neutral-buffered 10% formalin and washed twice in PBS. The cells were then incubated in a humidified chamber at 37 C for 1 h in the presence of terminal deoxynucleotidyl transferase, digoxigenin-11 dUTP, and dATP. The cells were washed with buffer and incubated with antidigoxigenin-fluorescein antibody for 30 min at room temperature. The cells were then washed with buffer and observed under epifluorescence and brightfield optics. The nuclear structures of individual cells were stained with propidium iodide.
TUNEL and indirect immunofluorescence double-labeling assay.To assess the expression of WT1 or p53 in GCs undergoing apoptosis in vivo and in vitro, we performed double fluorescent staining for apoptosis (TUNEL) and p53 or WT-1 protein. Using procedures detailed above, indirect immunofluorescence for p53 or WT-1 was performed first and followed by the TUNEL assay.
Statistical analysis
All experiments were conducted in duplicates and repeated at least three times. The percentage data were analyzed by either one-way ANOVA, followed by Newman-Keuls multiple range test or Student’s t test. Only P < 0.05 was considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
cDNAs corresponding to human p53 (30) and WT1 (29) were amplified
by RT-PCR of total RNA extracted from human GCs of four different
patients (Fig. 2). Nucleotide sequence
analysis of these clones revealed that the human p53 (1.2 kb) and WT1
(540 bp; derived using primers F/G shown in Fig. 1
) cDNAs amplified
were 100% homologous to their respective sequences previously reported
by other investigators (29, 30). The integrity of cDNA in each sample
was confirmed by amplifying the ß-actin cDNA, and in all samples
tested an expected product of either 637 bp or 500 bp was identified
(Fig. 2, bottom). As a positive control, PCR amplification
of WT1 cDNA from the pWT33 plasmid (26, 34) yielded the 540-bp product
(Fig. 2). In addition, the absence of nonspecific amplification from
genomic DNA was confirmed by including DNase-free RNase in the RT
reaction (data not shown) and by selecting primers to be within
different exons of the WT1 or p53 genes, thus eliminating PCR of
genomic DNA. In all the samples tested for WT1, a single 540-bp product
was detected by RT-PCR (Fig. 2A), with primer pairs F/G. Additionally,
in all samples tested for p53, a single 1.2-kb product was detected
(Fig. 2B). To confirm and extend these data derived from RT-PCR
analysis, Northern blot analysis of total RNA extracted from human GCs
revealed the presence of a single 2.8-kb p53 mRNA transcript (Fig. 3A) and two major WT1 transcripts of 1.8
kb and 3.5 kb (Fig. 3B).
|
|
. Splice site 1 primers (B/C)
generated two products of 224 bp and 173 bp, reflecting the presence of
the 51-bp insertion (Fig. 4, top). Similarly, splice site 2 primers (D/E) produced two
products of 170 bp and 161 bp, reflecting the presence of the 9-bp
insertion (Fig. 4, bottom). All the other bands shown in
Fig. 4 are nonspecific bands because Southern blot analysis with the
WT1 radiolabeled cDNA has shown that only the shown WT1 isoform bands
hybridized to the probe (data not shown).
|
Western blot analysis of nuclear extracts prepared from human GCs
yielded one appropriately sized (53 kDa) protein recognized by the p53
mAb and one appropriately sized (52–54 kDa) protein recognized by the
WT1 mAb (Fig. 5A). To confirm and extend
the results of the Western blot analysis, we performed indirect
immunofluorescence staining of human GCs cultured in serum-free medium
for 24 h. Both p53 and WT1 were localized to the nuclei of GCs,
and double immunofluorescence staining for p53 and WT1 revealed that
only a few GCs exhibited nuclear colocalization of both proteins (Fig. 5, B and C).
|
Immunostaining analysis of single follicles isolated by enzymatic
dispersion of tissue from several cortical ovarian biopsies
demonstrated the presence of WT1 protein in granulosa cells of primary
and primordial follicles (Fig. 6, A and
C, arrows). By comparison, p53 immunostaining was negative
(data not shown). Subsequent immunohistochemical analyses of archival
ovarian tissue specimens revealed that the expression of p53 and WT1 in
granulosa cells was developmentally regulated. Immunostaining of fetal
ovaries (19 weeks of pregnancy), which contain a very large number of
primordial and primary follicles, showed very strong expression of WT1
in almost all granulosa cells of primordial and primary follicles (Fig. 6E, arrows), whereas p53 staining was negative (Fig. 6D). In
antral atretic follicles of adult ovarian biopsies (these follicles
were deemed atretic based on the presence of fewer granulosa cell
layers, disrupted/disorganized cell-cell contacts between granulosa
cells, and the widespread presence of granular chromatin/pyknotic
nuclei), nuclear and some cytoplasmic accumulation of p53 was apparent
in many granulosa cells (Fig. 6, F and G), whereas WT1 staining was
absent (Fig. 6, H and I).
|
Because WT1 has been reported to be associated with apoptosis
independently of p53, we investigated the correlation between GC
apoptosis with the expression of p53 or WT1, by performing a double
fluorescent staining for p53 or WT1 expression and correlation with the
morhologic criteria of apoptosis, such as display of apoptotic blebs
(Fig. 7A). This was carried out in
cultured GCs induced to undergo apoptosis in serum-free cultures (36, 37). GCs expressing p53 were found to be invariably apoptotic, by
detection of apoptotic blebs. Vice versa, GCs that displayed apoptotic
blebs were expressing p53 (Fig. 7B). Numerous GCs coexpressed p53 and
WT1 (Fig. 7, B and C). These cells were also found to display apoptotic
blebs (Fig. 7A). The correlation of p53 with apoptosis in
vitro was also confirmed by performing a double staining for p53
and in situ fluorescence TUNEL assay (Fig. 7, D-F). GCs
expressing p53 (Fig. 7E) were found to be invariably apoptotic by
detection of DNA fragmentation (TUNEL positive) (Fig. 7F), and all
apoptotic cells were positive for p53 (Fig. 7E). However, we could
identify numerous GCs displaying apoptotic blebs (Fig. 7A) without
expressing WT1 in vitro (Fig. 7C). Moreover, in
situ, in atretic follicles displaying loss of most of the
granulosa cell layers and disruption of granulosa cell-cell contacts
(Fig. 7G), most of the granulosa cells were apoptotic (TUNEL positive)
(Fig. 7I) but were negative for WT1 staining (Fig. 7H). In addition, in
isolated preantral follicles we could identify numerous granulosa cells
positive for WT1 (Fig. 6, A and C), whereas we could not identify any
granulosa cells positive for p53 (data not shown). As anticipated, we
were unable to demonstrate any apoptosis in the granulosa cells
surrounding these follicles. These results suggest that apoptosis is
closely correlated with expression of p53 but not WT1 in GCs.
|
, lane 0 h) and WT1 (Fig. 8B, lane 0 h) mRNA were low but detectable in GCs immediately
after isolation (Fig. 8), where minimal apoptosis occurs (36, 37). GCs
incubated for 24 hours in serum-free conditions without trophic hormone
support undergo rapid apoptosis (36, 37). Under these conditions, GCs
displayed a significant increase in p53 mRNA levels, compared with
freshly isolated cells, as assessed by densitometric analysis (12
± 0.5-fold increase, P < 0.05, n = 4) [Fig. 8A, SF(-)]. By contrast, WT1 mRNA levels did not change significantly in
GCs incubated for 24 h in serum-free conditions without trophic
support [Fig. 8B, SF(-)].
|
, left, 0 h) and WT1
(Fig. 9, right, 0 h) were low but present in GCs
immediately after isolation. The expression of p53 protein in GCs
cultured under serum deprivation for 24 h (apoptosis-inducing
condition) was significantly higher than that immediately after
isolation, as quantitated by image analysis (16 ± 1-fold
increase, P < 0.05, n = 3) [Fig. 9, left, SF(-)]. WT1 protein levels did not change
significantly in GCs incubated for 24 h under serum-free
conditions [Fig. 9, right, SF(-)]. These results further
suggest that WT1, in contrast to p53, is not associated with GC
apoptosis.
|
hCG has been shown to prevent apoptosis in rat follicles (20). The
effects of hCG treatment on the expression of p53 and WT1 mRNAs were
studied in human GCs (Fig. 8). Northern blot analysis revealed that
in vitro incubation with 1 IU/mL hCG for 24 h without
trophic hormone support significantly inhibited the induction of p53
mRNA levels in GCs [Fig. 8A, (+)], compared with the levels of GCs
cultured in the absence of serum [Fig. 8A, (-)] (P
< 0.05). On the other hand, WT1 mRNA levels did not change
significantly in the presence of hCG [Fig. 8B, (+)], compared with
the levels of GCs cultured in the absence of serum [Fig. 8B, (-)]
(24 h, 82 ± 6% of serum free (-) levels; P >
0.05, n = 4).
Immunoblotting also showed that incubation with 1
IU/mL hCG under serum deprivation for 24 h significantly inhibited
the increase of the levels of p53 protein in GCs [Fig. 9, left, (+)], compared to the levels of GCs cultured in the
absence of serum [Fig. 9, left, (-)]. In contrast,
examination of WT1 protein expression indicated that WT1 protein levels
did not change significantly in GCs incubated for 24 h under
serum-free conditions or in the presence of 1 IU/mL hCG compared to
those immediately snap frozen (Fig. 9, right).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The mechanisms by which p53 may mediate apoptosis in the human ovary are still poorly understood. Several genes have been identified that represent specific transcriptional targets of p53 (40), and some of them are present in granulosa cells. A potential link between p53, a transcription factor capable of directly inducing apoptosis (10, 38), and bcl-2, a protein that prolongs cell survival (11, 41), has been reported (40). In addition, p53 can increase the transcriptional activity of the bax gene, which encodes a bcl-2-related protein that either directly (42) or indirectly, through inactivation of bcl-2, accelerates apoptosis (43). Histologic analysis of ovaries from bax-deficient mice revealed an apparent defect in the ability of granulosa cells to undergo apoptosis during follicular atresia (44). In addition, bax was found to correlate positively with apoptosis in rat granulosa cells of atretic follicles, and gonadotropin-mediated follicular survival was linked to a reduction in bax expression (45). Recent findings indicated that the expression of the bax gene in the human ovary also predominates in granulosa cell populations that are on the verge of apoptosis, but is absent in granulosa cells of healthy follicles (24). Taken together, these data indicate that the expression of the p53 gene and activation of p53-dependent pathways are regulated in the human ovary and may be the final downstream target inhibited during gonadotropin-induced follicular survival.
WT1 is a known regulator of the p53 gene (13, 14) and may independently induce apoptosis or cell cycle arrest. There is evidence that this gene may play an important role in urogenital organogenesis in animal models (18). Our studies indicated that human GCs possess the WT1 gene, which has an identical structure to that described in other human tissues. Interestingly, we demonstrated the presence of four different mRNAs, reflecting the absence or presence of two alternatively spliced insertions of 51 bp and 9 bp, respectively. This is consistent with the demonstration that the WT1 transcript is alternatively spliced in a variety of tissues (14, 35), including the rat ovary (46). The significance of alternative splicing of WT1 remains unknown, but it may reflect different functions of the gene. Furthermore, the nucleotide sequence of the zinc finger region of WT1 obtained from four patients was found to be normal. Immunoblot analysis of nuclear extracts of human GCs revealed the presence of the appropriately sized 52–54-kDa protein. Immunofluorescent staining showed the presence of WT1 protein to be in a nuclear location in GCs in vitro.
A role of WT1 in early stages of gonadal development has been proposed because WT1-deficient mice fail to develop the gonadal ridge during embryonic life (18, 19). In the present study, we demonstrated high levels of expression of WT1 protein product in primordial and primary follicles from fetal ovaries, as anticipated on the basis of its presumed implication in gonadal morphogenesis. The involvement of this gene in the physiology of the adult ovary is, however, unknown. We identified high levels of expression of WT1 protein product in primordial and primary follicles of human adult ovaries, suggesting an additional function for WT1 in later stages of ovarian development. Our immunohistochemical studies indicated that the expression of WT1 protein is developmentally regulated and progressively declines during follicular development. Higher levels of WT1 protein expression were detected in the primordial and primary follicles, whereas no WT1 expression was found in late atretic follicles. Our in vitro studies suggest that this gene is not directly involved with GC apoptosis mechanisms. GCs coexpressed WT1 and p53 in vitro, but WT1 protein levels did not change on induction of apoptosis in GCs, suggesting consitutive expression of the gene. Moreover, WT1 expression in GCs was not affected by the addition of gonadotropin in vitro. These data, taken together, suggest that WT1 may have a role in regulating granulosa cell function during gonadotropin-independent stages of follicular development, and its involvement in GC survival may decline in gonadotropin-dependent stages.
The exact role of WT1 in GC function remains purely speculative at this
time. However, it is known that WT1 may inhibit p53-dependent apoptosis
(13, 14). In addition, WT1 transcriptionally suppresses the expression
of growth factors and their receptors (26), including
colony-stimulating factor-1, insulin-like growth factor-II,
insulin-like growth factor-I receptor, platelet-derived growth factor
A, transforming growth factor-ß, and inhibin-
(46, 47, 48, 49). The
paramount role of several of these factors in the
gonadotropin-dependent and -independent paracrine control of
folliculogenesis has been established (50, 51). It is possible that WT1
is a key factor in maintaining a balance between factors promoting
follicular regression and factors inducing follicular maturation,
promoting the preservation of ovarian follicles in a quiescent state
throughout development and the reproductive life. In support of this
hypothesis, mutations of WT1 have been reported in sex cord-stromal
tumors of the ovary in the human (52).
In summary, we have provided evidence linking two important members of the tumor suppressor gene family, p53 and WT1 to ovarian follicular growth and atresia. Our data indicate that p53 gene is expressed in GCs and is closely related to their survival. This apoptosis-inducing gene is regulated by gonadotropins in human GCs, suggesting that p53 may play an important role in regulating follicular survival during gonadotropin-dependent stages of follicular life or maintenance of luteal cells during pregnancy. WT1, a known transcriptional regulator of p53, is also expressed in human GCs. Our data indicate that this gene is constitutively expressed in human granulosa cells and its expression remains strong during early stages of development, but progressively declines during gonadotropin-dependent follicular maturation. These data suggest a possible implication of WT1 in the mechanisms responsible for the maintenance of a quiescent state in follicles during gonadotropin-independent stages of follicular life.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 These authors contributed equally to this work.
Received June 16, 1999.
Revised August 23, 1999.
Accepted September 10, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
activates NF-kappaB in acid sphingomyelinase-deficient mouse
embryonic fibroblasts. J Biol Chem. 272:10904–10909.This article has been cited by other articles:
 |
|
 |
|
  M. Bilandzic, S. Chu, P. G. Farnworth, C. Harrison, P. Nicholls, Y. Wang, R. M. Escalona, P. J. Fuller, J. K. Findlay, and K. L. Stenvers Loss of Betaglycan Contributes to the Malignant Properties of Human Granulosa Tumor Cells Mol. Endocrinol., April 1, 2009; 23(4): 539 - 548. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Rolaki, G. Coukos, D. Loutradis, H. M. DeLisser, C. Coutifaris, and A. Makrigiannakis Luteogenic Hormones Act through a Vascular Endothelial Growth Factor-Dependent Mechanism to Up-Regulate {alpha}5{beta}1 and {alpha}v{beta}3 Integrins, Promoting the Migration and Survival of Human Luteinized Granulosa Cells Am. J. Pathol., May 1, 2007; 170(5): 1561 - 1572. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J J Brosens and B Gellersen Death or survival - progesterone-dependent cell fate decisions in the human endometrial stroma. J. Mol. Endocrinol., June 1, 2006; 36(3): 389 - 398. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Cherian-Shaw, R. Das, C. A. VandeVoort, and C. L. Chaffin Regulation of Steroidogenesis by p53 in Macaque Granulosa Cells and H295R Human Adrenocortical Cells Endocrinology, December 1, 2004; 145(12): 5734 - 5744. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. E. Thompson, E. Asselin, A. Branch, J. K. Stiles, P. Sutovsky, L. Lai, G.-S. Im, R. S. Prather, S. C. Isom, E. Rucker III, et al. Regulation of Prohibitin Expression During Follicular Development and Atresia in the Mammalian Ovary Biol Reprod, July 1, 2004; 71(1): 282 - 290. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. B. Billiar, N. C. Zachos, M. G. Burch, E. D. Albrecht, and G. J. Pepe Up-Regulation of {alpha}-Inhibin Expression in the Fetal Ovary of Estrogen-Suppressed Baboons Is Associated with Impaired Fetal Ovarian Folliculogenesis Biol Reprod, June 1, 2003; 68(6): 1989 - 1996. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Logan, K. P. McNatty, and J. L. Juengel Expression of Wilms' Tumor Gene and Protein Localization During Ovarian Formation and Follicular Development in Sheep Biol Reprod, February 1, 2003; 68(2): 635 - 643. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Embree-Ku and K. Boekelheide Absence of p53 and FasL Has Sexually Dimorphic Effects on Both Development and Reproduction Experimental Biology and Medicine, July 1, 2002; 227(7): 545 - 553. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Makrigiannakis, G. Coukos, A. Mantani, P. Prokopakis, G. Trew, R. Margara, R. Winston, and J. White Expression of Wilms' Tumor Suppressor Gene (WT1) in Human Endometrium: Regulation through Decidual Differentiation J. Clin. Endocrinol. Metab., December 1, 2001; 86(12): 5964 - 5972. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
