help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Makrigiannakis, A.
Right arrow Articles by Coutifaris, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Makrigiannakis, A.
Right arrow Articles by Coutifaris, C.
The Journal of Clinical Endocrinology & Metabolism Vol. 85, No. 1 449-459
Copyright © 2000 by The Endocrine Society

Original Studies

Regulated Expression and Potential Roles of p53 and Wilms’ Tumor Suppressor Gene (WT1) during Follicular Development in the Human Ovary1

Antonis Makrigiannakis2, Kunjata Amin2, George Coukos, Jonathan L. Tilly and Christos Coutifaris

Division of Human Reproduction and the Center for Research on Reproduction and Women’s Health, Department of Obstetrics and Gynecology (A.M., G.C., C.C.) and Pulmonary Division, Department of Medicine (K.A.), University of Pennsylvania Medical Center, Philadelphia, Pennsylvania 19104; and Vincent Center for Reproductive Biology, Department of Obstetrics and Gynecology (J.L.T.), Massachusetts General Hospital/Harvard Medical School, Boston, Massachusetts 02114

Address correspondence and requests for reprints to: Christos Coutifaris M.D., Ph.D., Division of Human Reproduction, Department of Obstetrics and Gynecology, University of Pennsylvania, 106 Dulles, 3400 Spruce Street, Philadelphia, Pennsylvania 19104. E-mail: ccoutifaris{at}obgyn.upenn.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
It has been previously demonstrated that the gonadotropin-mediated inhibition of apoptosis in rat ovarian granulosa cells is associated with changes in the expression of several cell death-regulatory genes, including p53. In addition, it has been shown that the actions of p53 may be amplified through a cooperative interaction with the Wilms’ tumor suppressor gene product (WT1). Based on these findings, the present studies were conducted to determine whether p53 and WT1 are expressed and gonadotropin regulated in the human ovary and to study the relationship between tumor suppressor gene expression and apoptosis in human granulosa/lutein cells (GCs). Analysis of total RNA prepared from human GCs using the RT-PCR demonstrated the presence of p53 messenger RNA (mRNA) and four WT1 mRNA splice variants. These observations were supported by Northern blot analysis of total RNA prepared from human GCs, which revealed the presence of a single (~2.8 kb) p53 mRNA transcript and two primary (~1.8 and ~3.5 kb) WT1 mRNA transcripts. Western blot analysis of nuclear protein extracts from human GCs yielded one immunoreactive protein of the expected size (~53 kDa) recognized by a p53 antibody and one immunoreactive protein of the expected size (~52–54 kDa) recognized by the WT1 antibody. Immunohistochemical staining showed that both molecules were localized to nuclei of human GCs and were coordinately regulated during follicular development. Immunofluorescence analysis showed that p53 protein was localized exclusively to nuclei of GCs undergoing apoptosis during in vitro culture and was similarly localized to nuclei and cytoplasm of apoptotic granulosa cells in atretic follicles in vivo. To further evaluate whether human GC apoptosis is linked to increased expression of tumor suppressor genes, we analyzed levels of p53 and WT1 mRNA and protein in GCs induced to undergo apoptosis in vitro. Healthy (nonapoptotic) GCs snap-frozen immediately after isolation from patients undergoing in vitro fertilization-embryo transfer possessed relatively low, but detectable, levels of p53 and WT1 mRNA and protein. However, following serum-free culture to induce apoptosis, p53 mRNA and protein levels increased significantly after 24 h, paralleling the increase in the number of apoptotic GCs. The induction of both p53 mRNA and protein in GCs was inhibited by the addition of human CG to the culture medium. In contrast, WT1 mRNA and protein levels remained constitutive in GCs incubated for 24 h compared with GCs snap-frozen immediately after isolation. We conclude that the p53 and WT1 genes are expressed at the mRNA and protein levels in human GCs and that expression of p53 is regulated during follicular maturation. Nuclear accumulation of p53 protein occurs in human GCs during apoptosis in vitro and in vivo, and p53 mRNA and protein are up-regulated in GCs starved of hormonal support but down-regulated by the presence of human CG. We propose that the products of these two principal tumor suppressor genes serve as important regulators of human follicular development and corpus luteum function.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
OF THE APPROXIMATELY 3–4 x 105 follicles remaining in a woman’s ovaries at puberty, less than 1% will reach full maturation and ovulation. The majority will degenerate by a process known as atresia (1). The few that are selected to become ovulatory follicles are transformed into corpora lutea following ovulation. The lifespan of the corpus luteum is also limited. In each nonpregnant reproductive cycle, corpora lutea regress and are eliminated by a process called luteolysis (2). Recently, it has been found that during both atresia and luteolysis granulosa and granulosa/lutein cells (GCs) undergo apoptosis, typified by cytoplasmic shrinkage and chromatin condensation (1, 2). The biochemical and molecular events underlying apoptosis in granulosa and GCs are the focus of intense current investigation by a number of laboratories. Much of this work is based on recent studies of complex cascade of events involving several evolutionarily-conserved gene products that act and interact to modulate what is believed to be a final common pathway for apoptosis activation and execution (3, 4, 5, 6).

The p53 gene is one of the most highly investigated tumor suppressor genes and seems to be a key player in apoptosis (5, 7). In the context of mechanisms to repair genetic damage, p53 intervenes to protect the cellular genome from a variety of deleterious stimuli, such as reactive oxygen species and ionizing radiation (8, 9). Damage to DNA elicits a rapid increase in p53 protein levels, followed by cell cycle arrest, the latter of which allows for repair of the damage before DNA synthesis occurs. However, if the insult is extensive, the continued elevation of p53 can trigger apoptosis as a means of eliminating that cell and maintaining genetic homeostasis (5, 9, 10). Wild-type p53 mediates apoptosis through a variety of pathways, some of which have been partially characterized (5). For example, many p53-regulated target genes have been identified, including the bcl-2 pro-survival gene (11), the bax proapoptotic gene, and several reduction-oxidation genes (12). Moreover, the ability of p53 to alter the transcriptional activity of target genes can be modulated by another antioncogenic protein, the product of the Wilms’ tumor suppressor gene (WT1) (13, 14). The WT1 gene was first identified in the urogenital system, encoding a transcription factor of 52–54 kDa (15). At least four isoforms of WT1 have been identified in cells expressing the gene, probably arising from alternative processing (14, 16).

In the female reproductive system, both p53 and WT1 have been implicated as important contributors to the development and function of the gonads. Although disruption of the p53 gene does not seem to impart a decline in fertility in females (17), WT1-null mice exhibit pronounced gonadal dysgenesis (18). The negative impact of WT1 deficiency on gonadal development likely stems from the central role of the protein in controlling expression of genes important for mammalian sex determination (19). Additionally, postnatal expression of WT1 in rat, pig, monkey, and chicken granulosa cells is regulated in a maturation and gonadotropin-dependent manner (20, 21). Regarding p53, nuclear accumulation of this tumor suppressor protein has been documented in granulosa cells of follicles destined for atresia in the rat ovary, whereas in vivo gonadotropin priming inhibits granulosa cell apoptosis with a concomitant suppression of p53 immunoreactivity (20). These initial investigations have since been confirmed and extended by a number of laboratories, collectively supporting the hypothesis that nuclear translocation of p53 in granulosa cells heralds their demise during follicular atresia (22, 23). That p53 serves a similar function in the human ovary is suggested by the findings of p53 expression in the human ovary and isolated granulosa cells (24), as well as by recent studies on the ability of overexpressed p53 to induce apoptosis in transformed human granulosa cell lines (25). However, the spatial localization of p53 in the human ovary during follicular development and the regulation of tumor suppressor gene expression in nontransformed human GCs remain to be determined.

Based on these discussions, the present studies were conducted to further examine the possible roles of p53 and WT1 in regulating apoptosis during follicular development and luteal function in the human ovary using a combination of in vivo and in vitro approaches.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Reagents, antibodies, and complementary DNA (cDNA) clones

All reagents were of analytical grade and were purchased from Sigma Chemical Co. (St. Louis, MO), unless otherwise stated. The monoclonal WT1 antibody (H2) was purchased from DAKO Corp. (Carpenteria, CA), the polyclonal WT1 antibody (C19) was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), and the monoclonal anti-p53 antibody (Ab-5) was purchased from Oncogene Research Products (Cambridge, MA). The cDNAs for human WT1 and human p53 used for Northern blotting were kind gifts from Donna George (Department of Genetics, University of Pennsylvania, Philadelphia, PA). The pWT33 plasmid was a kind gift from Frank Rauscher (Wistar Institute, Philadelphia, PA) (26).

Cell culture and treatments

Human GCs were isolated by follicular aspiration from 16 patients between the ages of 25 to 43 yr who were undergoing in vitro fertilization/embryo transfer. These cells had been exposed in vivo to a follicular recruitment regimen, including a gonadotropin-releasing hormone agonist (Lupron; TAP Pharmaceuticals, Inc., Deerfield, IL) for pituitary supression and FSH (Fertinex or Gonal-F; Serono, Randolph, MA) for follicular stimulation. Moreover, all patients had received a single dose of 10,000 IU purified human CG (hCG) (Profasi; Serono) 36 h before follicular aspiration. The follicular fluid was collected and centrifuged. The sedimented cells were resuspended in Ca++-Mg++-free HBSS (Life Technologies, Inc., Grand Island, NY), overlayed on Ficoll-paque (Pharmacia Biotech, Uppsala, Sweden) and centrifuged at 400 x g for 30 min at room temperature. The cells were collected from the interphase. The isolated GCs were suspended, washed twice with Ca++-Mg++-free HBSS, and cultured in Hams F-12:DMEM (1:1. v/v; Life Technologies, Inc.) media supplemented with 10% FBS, penicillin (10 U/mL), streptomycin (0.05 mg/mL), and fungizone (0.25 mg/mL). In some experiments, cultured GCs were treated with 1 IU/mL hCG in serum-free Hams F-12:DMEM (1:1, v/v) medium with 0.2% BSA and 10 mM HEPES. Contamination with monocytes, identified by the anti-CD14 monoclonal antibody (mAb; Becton Dickinson and Co., Lincoln Park, NJ), was less than 2% (data not shown). Each experiment was performed at least three times with different cell preparations to ensure consistency of the findings.

Collection and processing of human ovarian tissue

Ovarian cortical biopsies measuring ~1 mm in thickness were collected from four parous, healthy women, between the ages of 25 and 34 yr, undergoing elective laparoscopic tubal ligation. This protocol was reviewed and approved by the Institutional Review Board. Participation was voluntary, and each patient gave informed consent. The ovarian tissue was transferred in sterile bicarbonate-buffered Waymouth medium (HyClone Laboratories, Inc., Logan, UT) containing 0.5% BSA. The tissue, while submerged in medium, was examined under a stereomicroscope (Nikon) and loosely dissected with two sterile 27-gauge tuberculin needles. The ovarian tissue was minced and placed in a sterile capped test tube with 5 mL bicarbonate-buffered Waymouth medium supplemented with 0.5% BSA, 0.1% crude collagenase (Collagenase type XI, 1660 units/mg solid), and 0.01% DNAse (DNAse I, 440 Kunitz units/mg solid). Digestion of the tissue was performed for 3 h at 37 C, and the homogenate was then diluted 1:5 with sterile Waymouth medium. The digested tissue was then scanned under a stereomicroscope, and preantral follicles were identified, isolated, and recovered with hand-drawn sterilized glass micropipets. Individual follicles were transferred to glass slides precoated with poly-L-lysine for attachment and further processing for indirect immunofluorescence.

RNA isolation

Total cellular RNA was extracted from primary cultures of GCs, as described previously (27). Briefly, samples were frozen in liquid nitrogen, homogenized in 4 M acid guanidinium thiocyanate, phenol-chloroform extracted, and ethanol precipitated to recover total RNA. After quantitation by measuring the absorbance at 260 nm, the RNA samples were used for the RT-PCR and Northern blot analysis, as described below.

RT-PCR

Five micrograms of total RNA from each sample were denatured at 65 C for 5 min and chilled rapidly on ice. The RNA was then reverse transcribed in 50 mL 1x RT buffer [50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, and 10 mM DTT] containing 40 pmol random hexamer primers; 0.5 mM each of dATP, dCTP, dGTP, and dTTP; 80 U RNasin (Promega Corp., Madison, WI); and 500 U Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.) for 1 h at 37 C. Afterward, 50 µL water were added, and the mixture was heated to 94 C. To check the integrity of the RT reaction, a 10-µL aliquot of the reverse transcribed product was cycled by PCR to amplify ß-actin cDNA. The reaction was carried out for 35 cycles (90 C for 50 sec, 56 C for 60 sec, 72 C for 8 min) in 50 µL 1x PCR buffer [20 mM Tris-HCl (pH 8.4), 50 mM KCl, and 1.5 mM MgCl2) containing 0.25 mM each of dATP, dCTP, dGTP, and dTTP; 1.5 U Taq DNA polymerase (Life Technologies, Inc.), and 100 ng of each of the following human ß-actin amplimers (forward: either 5'ATGGATGATGATATCGCCGC3' or 5'CATGGGTCAGAAGGATTCAT3'; reverse: 5'TTAATGTCACGCACGATTTC3'). As expected (28), two products of 637 bp or 500 bp were generated after PCR amplification using the reverse primer coupled with the first or second forward primer, respectively.

For analysis of WT1 or p53 gene expression, 10-µL aliquots of reverse transcribed cDNA were cycled under the same PCR conditions. For WT1 analysis, the primers used were derived from that reported by Gessler et al. (29), as follows (see also Fig. 1Go): A: 5'ATGGGCTCCGACGTGCGGGA3' (forward); B: 5'TGACAATTTATACCAAATGA3' (forward); C: 5'TGAATGCCACTGAAGACAACC3' (reverse); D: 5'AGACATACAGGTGTGAAA3' (forward); E: 5'GACTAATTCATCTGACCGGGC-AAA3' (reverse); F: 5'GCCCAATACAGAATACACA3' (forward); G: 5'TCACACACTGTGCTGCCT3' (reverse).



View larger version (7K):
[in this window]
[in a new window]
  		Figure 1. The exon-intron structure of the Wilms’ tumor suppressor gene (WT-1) is depicted diagramatically, with the boxes representing the 10 exons. The stipled regions are alternatively spliced fragments that give rise to four isoforms. The start (ATG) and the stop (TGA) are indicated by the open vertical arrows. The four zinc fingers are shown by the numbered vertical arrows. The primers used to amplify the WT-1 gene are shown by the horizontal half-arrows and labeled A–G.

 
For p53 analysis, 10-µL aliquots of the reverse-transcribed cDNA were subjected to PCR to amplify a 1.18-kb fragment of the human p53 cDNA encoded by exons 2–11 (30) using the following primers: forward, 5'ATGGAGGAGCCGCAGT3'; reverse, 5'AATGTCAGTCTGAGTCAG3'. The PCR conditions consisted of an initial denaturing step of 94 C for 3 min, followed by 28 cycles of 94 C for 35 sec, 47 C for 1 min, and 72 C for 5 min. Negative controls included RNA without RT, substitution of reverse-transcribed cDNA with water, and use of RNA from the cell line H358, which is missing both alleles of p53. One tenth of each resultant PCR mixture following amplification was electrophoresed through a 2.0% agarose gel, stained with ethidium bromide, and photographed under ultraviolet-transillumination. We sequenced two clones, and the sequence agreed with that demonstrated by Gessler et al. (29).

Northern blot analysis

For Northern blotting, 20 µg total RNA from each sample were separated by electrophoresis through a 1.2% agarose/2.2 M formaldehyde 4-morpholinepropanesulfonic acid gel. Equal loading of RNA was confirmed by ethidium bromide staining of ribosomal RNAs. The RNA was transferred to a Zeta-probe nylon membrane (Bio-Rad Laboratories, Inc. Melville, NY) and hybridized for 16–20 h at 60 C to a radiolabeled fragment of the human WT1 cDNA or p53 cDNA in 0.5 M sodium phosphate (pH 7.2), 7% SDS, and 1.0 mM ethylenediaminetetraacetate (EDTA). Blots were washed twice in 2% SDS, 40 mM sodium phosphate (pH 7.2), and 1 mM EDTA for 30 min at 65 C and exposed to Kodak X-OMAT film at -70 C.

Immunoblot analysis

Nuclear extracts were prepared from flasks of primary cultures of human GCs by the methods of Zumbasasen and Stoffel (31). Adherent GCs were scraped into 5 mL ice-cold phosphate-buffered saline (PBS), pelleted, and washed twice with PBS. The cell pellet (1 x 106 cells per 0.1 mL) was resuspended in a lysis buffer consisting of 10 mM Tris-HCl (pH 8.0), 60 mM KCl, 1 mM EDTA, 0.5% Nonidet P-40, 1 mM DTT, 1 mM phenylmethlysulfonyl fluoride, and 1 mM benamide, incubated on ice for 10 min, and centrifuged at 1200 x g at 4 C for 5 min. The pelleted nuclei were washed briefly in lysis buffer without Nonidet P-40 and resuspended in an extraction buffer consisting of 20 mM Tris-HCl (pH 8.0), 20 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, and 25% glycerol, and lysed by adding NaCl to a final concentration of 400 mM. The extraction was carried out on ice for 10 min with periodic brief vortexing, and the lysate was then centrifuged for 10 min at 16,000 x g at 4 C. The supernatant containing the nuclear protein extract was processed for protein quantitation by the Bradford method (32). Fifty micrograms of protein from each sample were mixed with Laemmli sample buffer containing ß-mercaptoethanol (5%) and boiled for 5 min. Proteins were then separated by SDS-PAGE (10% gels) and electrophoretically transferred onto polyvinylidene difluoride membranes (NEN Life Science Products-Dupont, Boston, MA). The membranes were rinsed in PBS and then blocked for 30 min in 4% nonfat milk in prepared in TBST buffer [50 mM Tris-HCl (pH 7.5), 171 mM NaCl, and 0.05% Tween-20]. The blots were incubated with the WT1-H2 or p53 antibody (at a concentration 1 µg/mL) in TBST for 1 h and then washed three times (5 min each) in TBST with vigorous shaking. The blots were incubated in a horseradish peroxidase-labeled antimouse secondary antibody (diluted 1:6000 in TBST) for 30 min, washed three times (5 min each) in TBST, and visualized using enhanced chemiluminescence according to the manufacturer’s instructions (NEN Life Science Products-Dupont).

Indirect immunofluorescence

Cells grown on coverslips (Nunc, Roskilde, Denmark) were washed twice in prewarmed (37 C) DMEM and twice in prewarmed (37 C) PBS containing 1.5 mM Ca++, and then were fixed in 100% methanol at -20 C for 5 min. Cells were incubated in 10% normal goat serum (30 min at room temperature) and then with one of the primary antibodies (either WT1-H2 or p53-Ab-5; at a concentration of 10 µg/mL) for 2 h at room temperature. A fluorescein-conjugated goat antimouse secondary antibody (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA), used at a 1:200 dilution, was added, and the sections were incubated for 30 min at room temperature. Coverslips were mounted on glass slides with Fluoromount G (Fisher Scientific, Malvern, PA), containing 1,4-diazabicyclo(2.2.2)octane (Polysciences Inc., Warrington, PA) to stabilize the fluorescence, and photographed with a Nikon microscope.

Double immunofluoresence analysis was carried out by combining the polyclonal anti-WT1 antibody with the mAb against p53. After fixation, cells were incubated in 10% goat serum-10% swine serum (30 min at room temperature), followed by a 2-h room temperature incubation with the primary antibodies. Cells were then washed thoroughly with PBS-4% BSA and incubated with a fluorescein-conjugated goat antimouse IgG and/or a rhodamine-conjugated swine antirabbit IgG secondary antibody (Jackson ImmunoResearch Laboratories, Inc.) at a dilution of 1:200 in PBS-4% BSA for 30 min. Coverslips were mounted on glass slides with Fluoromount G containing 1,4-diazabicyclo-(2.2.2)octane to stabilize fluorescence. Cells were examined and photographed with a Nikon microscope.

Immunohistochemistry

Paraffin-embedded human archival ovarian tissue sections (5 µm thick) were deparaffinized at 70 C in xylene, rehydrated through a graded ethanol series, and rinsed in PBS (pH 7.4). Sections were treated with 0.1% hydrogen peroxide for 30 min at 20 C (to inactivate endogenous peroxidase activity) and washed in PBS. Sections were then digested with prewarmed pepsin (0.65 mg/mL in PBS) at 40 C for 5 min, blocked with 5% goat serum, and then incubated with the primary antibody (WT1-H2, 10 µg/mL) or p53 (10 µg/mL) for 1 h at room temperature. Localization of the primary antibody was performed by incubation of the sections with a biotinylated antimouse IgG antibody, and the biotin was detected using an avidin-biotin-peroxidase kit (Vector Laboratories, Inc. Burlingame, CA) with diaminobenzadine as the chromogenic substrate. Control sections were processed in an identical manner by substitution of the primary antibody with a purified mouse IgG fraction. For the archival ovarian tissue specimens used in this study, dating of the phase of the menstrual cycle was performed using endometrial tissue specimens from the same patients, according to the criteria of Noyes et al. (33).

In situ detection of apoptosis

Terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) assay. Apoptosis was detected by 3'-end labeling of DNA fragments in situ using the ApopTag In-Situ Apoptosis Detection kit (Oncor, Gaithersburg, MD), according to the manufacturer’s guidelines. Briefly, GCs were fixed in neutral-buffered 10% formalin and washed twice in PBS. The cells were then incubated in a humidified chamber at 37 C for 1 h in the presence of terminal deoxynucleotidyl transferase, digoxigenin-11 dUTP, and dATP. The cells were washed with buffer and incubated with antidigoxigenin-fluorescein antibody for 30 min at room temperature. The cells were then washed with buffer and observed under epifluorescence and brightfield optics. The nuclear structures of individual cells were stained with propidium iodide.

TUNEL and indirect immunofluorescence double-labeling assay.To assess the expression of WT1 or p53 in GCs undergoing apoptosis in vivo and in vitro, we performed double fluorescent staining for apoptosis (TUNEL) and p53 or WT-1 protein. Using procedures detailed above, indirect immunofluorescence for p53 or WT-1 was performed first and followed by the TUNEL assay.

Statistical analysis

All experiments were conducted in duplicates and repeated at least three times. The percentage data were analyzed by either one-way ANOVA, followed by Newman-Keuls multiple range test or Student’s t test. Only P < 0.05 was considered significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Human GCs express p53 and WT1 mRNA transcripts

cDNAs corresponding to human p53 (30) and WT1 (29) were amplified by RT-PCR of total RNA extracted from human GCs of four different patients (Fig. 2Go). Nucleotide sequence analysis of these clones revealed that the human p53 (1.2 kb) and WT1 (540 bp; derived using primers F/G shown in Fig. 1Go) cDNAs amplified were 100% homologous to their respective sequences previously reported by other investigators (29, 30). The integrity of cDNA in each sample was confirmed by amplifying the ß-actin cDNA, and in all samples tested an expected product of either 637 bp or 500 bp was identified (Fig. 2Go, bottom). As a positive control, PCR amplification of WT1 cDNA from the pWT33 plasmid (26, 34) yielded the 540-bp product (Fig. 2Go). In addition, the absence of nonspecific amplification from genomic DNA was confirmed by including DNase-free RNase in the RT reaction (data not shown) and by selecting primers to be within different exons of the WT1 or p53 genes, thus eliminating PCR of genomic DNA. In all the samples tested for WT1, a single 540-bp product was detected by RT-PCR (Fig. 2AGo), with primer pairs F/G. Additionally, in all samples tested for p53, a single 1.2-kb product was detected (Fig. 2BGo). To confirm and extend these data derived from RT-PCR analysis, Northern blot analysis of total RNA extracted from human GCs revealed the presence of a single ~2.8-kb p53 mRNA transcript (Fig. 3AGo) and two major WT1 transcripts of 1.8 kb and 3.5 kb (Fig. 3BGo).



View larger version (36K):
[in this window]
[in a new window]
  		Figure 2. RT-PCR analysis of p53 (A) and Wilms’ tumor suppressor gene (WT-1) (B). A, PCR amplification of p53 exons 2–11 and ß-actin exons 1–3 was performed on reversed-transcribed RNA derived from GCs from four patients (A–D) (lanes 4–7). Lane 3 is mesothelioma cells, a positive control. The top panel shows ethidium bromide staining of a ~1.2-kb PCR product of the p53 cDNA. The bottom panel shows ß-actin product. Lane 1 is negative (-) control (H2O) for the RT and PCR reaction. Lane 2 is DNA markers. B, PCR amplification of WT-1 from exons 6–10 and that for ß-actin from exons 1–3 was performed on reverse-transcribed RNA derived from GCs from four patients (A–D) (lanes 6–9). Lane 5 is mesothelioma cells, a positive control. The top panel shows ethidium bromide staining of a ~540-bp PCR product of the WT-1 cDNA. The bottom panel shows ß-actin product. Lanes 2–4 are negative (-) controls (H2O) for the RT and PCR reactions. Lane 1 is DNA markers.

 


View larger version (34K):
[in this window]
[in a new window]
  		Figure 3. Analysis of p53 and WT-1 mRNA expression in human GCs. Twenty micrograms of total RNA extracted from human GCs cultured in serum-free media for 24 h was processed for Northern blot analysis using radioactively labeled p53 (A) and WT-1 (B) cDNA. The p53 transcript was estimated to be ~2.8 kb (A), and WT-1 transcript sizes (1.8 kb and 3.5 kb) are indicated in panel B. Migration distances of the 28S and 18S ribosomal RNAs are also indicated. These data are representative of results obtained in four replicate experiments.

 
In the kidney, WT1 is alternatively spliced, giving rise to four different transcripts that reflect the absence or presence of two alternatively spliced insertions of 51 bp or 9 bp, respectively (35). Based on this, we sought to analyze the possible existence of WT1 mRNA splicing variants in human GCs by RT-PCR using primers pairs B/C and D/E, which span the two alternative splice sites, as depicted as the hatched boxes in Fig. 1Go. Splice site 1 primers (B/C) generated two products of 224 bp and 173 bp, reflecting the presence of the 51-bp insertion (Fig. 4Go, top). Similarly, splice site 2 primers (D/E) produced two products of 170 bp and 161 bp, reflecting the presence of the 9-bp insertion (Fig. 4Go, bottom). All the other bands shown in Fig. 4Go are nonspecific bands because Southern blot analysis with the WT1 radiolabeled cDNA has shown that only the shown WT1 isoform bands hybridized to the probe (data not shown).



View larger version (55K):
[in this window]
[in a new window]
  		Figure 4. RT-PCR analysis of the WT-1 splice variants in human GCs. RT-PCR was performed on GC RNA from four different patients (A–D) (lanes 1–4) using primers pairs B/C (top) and D/E (bottom). These pairs of primers spanned two alternative splice sites. Top, For splice site 1, primers B/C gave two products of sizes 224 bp and 173 bp, reflecting the presence of a 51-bp insertion. ß-actin products are also shown. Bottom, For splice site 2, primers D/E gave two products sized 170 bp and 161 bp, indicating the presence of a 9-bp insertion. Lane 5 is negative (-) control (H2O) for the RT and PCR reaction. Molecular size markers are shown on the right (lane 6). All other bands above the WT1 bands are nonspecific bands.

 
Human GCs express p53 and WT1 proteins

Western blot analysis of nuclear extracts prepared from human GCs yielded one appropriately sized (53 kDa) protein recognized by the p53 mAb and one appropriately sized (52–54 kDa) protein recognized by the WT1 mAb (Fig. 5AGo). To confirm and extend the results of the Western blot analysis, we performed indirect immunofluorescence staining of human GCs cultured in serum-free medium for 24 h. Both p53 and WT1 were localized to the nuclei of GCs, and double immunofluorescence staining for p53 and WT1 revealed that only a few GCs exhibited nuclear colocalization of both proteins (Fig. 5Go, B and C).



View larger version (77K):
[in this window]
[in a new window]
  		Figure 5. Expression of p53 and WT-1 protein in human GCs cultured in serum-free media for 24 h. A, Immunoblot analysis of p53 and WT-1 protein in human GCs. Nuclear extracts were analyzed for expression of p53 and WT-1 protein with the anti-p53 and anti-WT-1 mAb, respectively, by immunoblotting. Molecular weights are marked on the left. The arrows indicate a band at ~53 kDa and 52–54 kDa recognized by the anti-p53 and anti-WT-1 mAb, respectively, in human GCs. B and C, Immunofluorescence localization of p53 (B) and WT-1 (C) proteins in human GCs. Cells were double-stained with either anti-p53 (B) or anti-WT-1 (C) mAb, as described in Materials and Methods. Note the nuclear localization of p53 (B, inverted arrow) and WT-1 (C, arrowhead) and the colocalization in some cells (B and C).

 
Expression of p53 and WT1 are regulated during follicular development

Immunostaining analysis of single follicles isolated by enzymatic dispersion of tissue from several cortical ovarian biopsies demonstrated the presence of WT1 protein in granulosa cells of primary and primordial follicles (Fig. 6Go, A and C, arrows). By comparison, p53 immunostaining was negative (data not shown). Subsequent immunohistochemical analyses of archival ovarian tissue specimens revealed that the expression of p53 and WT1 in granulosa cells was developmentally regulated. Immunostaining of fetal ovaries (19 weeks of pregnancy), which contain a very large number of primordial and primary follicles, showed very strong expression of WT1 in almost all granulosa cells of primordial and primary follicles (Fig. 6EGo, arrows), whereas p53 staining was negative (Fig. 6DGo). In antral atretic follicles of adult ovarian biopsies (these follicles were deemed atretic based on the presence of fewer granulosa cell layers, disrupted/disorganized cell-cell contacts between granulosa cells, and the widespread presence of granular chromatin/pyknotic nuclei), nuclear and some cytoplasmic accumulation of p53 was apparent in many granulosa cells (Fig. 6Go, F and G), whereas WT1 staining was absent (Fig. 6Go, H and I).



View larger version (68K):
[in this window]
[in a new window]
  		Figure 6. Expression of p53 and WT-1 in the human ovary in situ. A, B, and C, Immunolocalization of WT-1 in isolated preantral human follicles. Human preantral follicles were isolated from ovarian biopsy specimens and immunostained for WT-1. Under low magnification (A), multiple preantral follicles of varying sizes (arrows) can be seen surrounded by WT-1 positive granulosa cells. Under high magnification (B, phase contrast), it can be clearly seen that remaining adherent granulosa cells stain intensely for WT-1 (C, arrow). D and E, Immunohistochemical detection of p53 (D) and WT-1 (E) in fetal human ovary in situ. Note that p53 staining is absent (D) in contrast to the very strong staining of WT-1 in almost all granulosa cells (E, arrows). F–I, Immunohistochemical detection of p53 in an atretic follicle (F) and at a higher magnification (G); WT-1 staining (H) and at a higher magnification (I) in an atretic follicle. Note that in the representative atretic follicle p53 nuclear and some cytoplasmic staining was present in many granulosa cells (G, arrow) in contrast to the absence of WT-1 (H and I). an:antrum. Magnification: A and F, x100; B and C, x600; D, E, G, and I, x400; H, x200.

 
Human GC apoptosis correlates with p53 but not WT1 expression in vitro and in vivo

Because WT1 has been reported to be associated with apoptosis independently of p53, we investigated the correlation between GC apoptosis with the expression of p53 or WT1, by performing a double fluorescent staining for p53 or WT1 expression and correlation with the morhologic criteria of apoptosis, such as display of apoptotic blebs (Fig. 7AGo). This was carried out in cultured GCs induced to undergo apoptosis in serum-free cultures (36, 37). GCs expressing p53 were found to be invariably apoptotic, by detection of apoptotic blebs. Vice versa, GCs that displayed apoptotic blebs were expressing p53 (Fig. 7BGo). Numerous GCs coexpressed p53 and WT1 (Fig. 7Go, B and C). These cells were also found to display apoptotic blebs (Fig. 7AGo). The correlation of p53 with apoptosis in vitro was also confirmed by performing a double staining for p53 and in situ fluorescence TUNEL assay (Fig. 7Go, D-F). GCs expressing p53 (Fig. 7EGo) were found to be invariably apoptotic by detection of DNA fragmentation (TUNEL positive) (Fig. 7FGo), and all apoptotic cells were positive for p53 (Fig. 7EGo). However, we could identify numerous GCs displaying apoptotic blebs (Fig. 7AGo) without expressing WT1 in vitro (Fig. 7CGo). Moreover, in situ, in atretic follicles displaying loss of most of the granulosa cell layers and disruption of granulosa cell-cell contacts (Fig. 7GGo), most of the granulosa cells were apoptotic (TUNEL positive) (Fig. 7IGo) but were negative for WT1 staining (Fig. 7HGo). In addition, in isolated preantral follicles we could identify numerous granulosa cells positive for WT1 (Fig. 6Go, A and C), whereas we could not identify any granulosa cells positive for p53 (data not shown). As anticipated, we were unable to demonstrate any apoptosis in the granulosa cells surrounding these follicles. These results suggest that apoptosis is closely correlated with expression of p53 but not WT1 in GCs.



View larger version (130K):
[in this window]
[in a new window]
  		Figure 7. Immunohistochemical localization of p53 protein, WT-1 protein, and apoptotic nuclei (TUNEL positive) in GCs cultured in serum-free conditions for 24 h. A, B, and C, Phase contrast (A) and double immunofluorescence staining (B and C) showing the localization for p53 (B) and WT-1 (C) in the nuclei of the positive stained cells. Note that all the apoptotic cells as indicated by the presence of apoptotic blebs (A) are stained positively for p53 (B, arrowheads), whereas only one of them stained positively for WT-1 (C). D, E, and F, Phase contrast (D) and double immunofluorescence staining (E and F) with the p53 antibody (E) and TUNEL staining to detect apoptotic nuclei (F). Note that all positive for p53-stained cells (E) have apoptotic nuclei (F). G, H, and I, Phase contrast (G) and double immunofluorescence staining (H and I) with the WT-1 antibody (H) and TUNEL staining (I) in an atretic follicle in situ. Note that all granulosa cells in this atretic follicle do not stain for WT-1 (H), but they have TUNEL positive nuclei (I). Magnification: A–C, x1000; D–F, x400; G–I, x200.

 
To further evaluate whether human GC apoptosis is linked to increased expression of tumor suppressor genes, we analyzed levels of p53 and WT1 mRNA and protein in GCs induced to undergo apoptosis in vitro. Northern blot analysis revealed that the levels of p53 (Fig. 8AGo, lane 0 h) and WT1 (Fig. 8BGo, lane 0 h) mRNA were low but detectable in GCs immediately after isolation (Fig. 8Go), where minimal apoptosis occurs (36, 37). GCs incubated for 24 hours in serum-free conditions without trophic hormone support undergo rapid apoptosis (36, 37). Under these conditions, GCs displayed a significant increase in p53 mRNA levels, compared with freshly isolated cells, as assessed by densitometric analysis (12 ± 0.5-fold increase, P < 0.05, n = 4) [Fig. 8AGo, SF(-)]. By contrast, WT1 mRNA levels did not change significantly in GCs incubated for 24 h in serum-free conditions without trophic support [Fig. 8BGo, SF(-)].



View larger version (57K):
[in this window]
[in a new window]
  		Figure 8. p53, but not WT-1 mRNA expression, is regulated by hCG in human GCs in vitro. Total RNA samples prepared from human GCs immediately after isolation (0 h), after culture for 24 h in the absence of serum (apoptosis induction; SF; lane -) or in the presence of 1 IU/mL hCG for 24 h without serum (SF; lane +) were analyzed for p53 mRNA levels (A) and WT-1 mRNA levels (B). The autoradiograms (A and B) are representative of results obtained in four replicate experiments (estimated transcript sizes and migration distances of 28S and 18S ribosomal RNA species are indicated). Note the increase of p53 mRNA (12.5-fold, P < 0.05) in GCs cultured for 24 h in the absence of serum (SF; lane -). Incubation in the presence of 1 IU/mL hCG for 24 h without serum (SF; lane +) significantly decreased the levels of p53 (P < 0.05) to the levels of the immediately snap-frozen GCs (lane 0 h). Note that WT-1 mRNA levels did not change significantly in the presence of hCG. (+C denotes a positive control of human mesothelioma mRNA extract).

 
Immunoblotting experiments revealed that the levels of p53 (Fig. 9Go, left, 0 h) and WT1 (Fig. 9Go, right, 0 h) were low but present in GCs immediately after isolation. The expression of p53 protein in GCs cultured under serum deprivation for 24 h (apoptosis-inducing condition) was significantly higher than that immediately after isolation, as quantitated by image analysis (16 ± 1-fold increase, P < 0.05, n = 3) [Fig. 9Go, left, SF(-)]. WT1 protein levels did not change significantly in GCs incubated for 24 h under serum-free conditions [Fig. 9Go, right, SF(-)]. These results further suggest that WT1, in contrast to p53, is not associated with GC apoptosis.



View larger version (35K):
[in this window]
[in a new window]
  		Figure 9. p53, but not WT-1 protein expression, is regulated by hCG in human GCs in vitro. Total protein samples prepared from human GCs immediately after isolation (0 h), after culture for 24 h in the absence of serum (apoptosis induction, SF; lane -) or in the presence of 1 IU/mL hCG for 24 h without serum (SF; lane +) were analyzed for p53 protein levels (left) or WT-1 protein levels (right). The immunoblots are representative of results obtained in four replicate experiments. Note the increase of p53 protein (16-fold P < 0.05) in GCs cultured for 24 h in the absence of serum (SF; lane -). Incubation in the presence of 1 IU/ml hCG for 24 h without serum (SF; lane +) significantly decreased the levels of p53 to the levels seen in immediately snap-frozen GCs (lane 0 h) (P > 0.05). Note that WT-1 protein levels did not change significantly in the presence of hCG (right).

 
p53, but not WT1 gene expression, is regulated by hCG in human GCs

hCG has been shown to prevent apoptosis in rat follicles (20). The effects of hCG treatment on the expression of p53 and WT1 mRNAs were studied in human GCs (Fig. 8Go). Northern blot analysis revealed that in vitro incubation with 1 IU/mL hCG for 24 h without trophic hormone support significantly inhibited the induction of p53 mRNA levels in GCs [Fig. 8AGo, (+)], compared with the levels of GCs cultured in the absence of serum [Fig. 8AGo, (-)] (P < 0.05). On the other hand, WT1 mRNA levels did not change significantly in the presence of hCG [Fig. 8BGo, (+)], compared with the levels of GCs cultured in the absence of serum [Fig. 8BGo, (-)] (24 h, 82 ± 6% of serum free (-) levels; P > 0.05, n = 4).

Immunoblotting also showed that incubation with 1 IU/mL hCG under serum deprivation for 24 h significantly inhibited the increase of the levels of p53 protein in GCs [Fig. 9Go, left, (+)], compared to the levels of GCs cultured in the absence of serum [Fig. 9Go, left, (-)]. In contrast, examination of WT1 protein expression indicated that WT1 protein levels did not change significantly in GCs incubated for 24 h under serum-free conditions or in the presence of 1 IU/mL hCG compared to those immediately snap frozen (Fig. 9Go, right).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Atresia represents a central mechanism in the regulation of ovarian function. From fetal life to puberty, the vast majority of ovarian follicles will regress by atresia. During every follicular cycle, the cohort of follicles that are stimulated by pituitary FSH, will regress by atresia (1). Finally, at the completion of an ovulatory cycle, the corpus luteum will involute. Recently, it has been demonstrated that apoptosis, a form of physiologic cell death, is likely the underlying event associated with the initiation and progression of follicular atresia (2, 36, 37). In the present study, we demonstrate that the p53 gene, a tumor suppressor gene that plays an important role in the mechanisms mediating apoptosis in extragonadal tissues (5, 7, 10, 38), may be important for follicular atresia. Corroborating previous evidence by Tilly et al. (20), we observed that human GCs possess wild-type p53 gene, which is identical to that described in other human tissues (39), and that this gene is expressed at the mRNA and protein levels. The expression of this tumor suppressor gene directly correlated with the fate of the cells, as conditions promoting apoptosis in vitro up-regulated p53 in GCs, whereas factors promoting GC survival suppressed the expression of p53 in these cells. Specifically, induction of apoptosis in GCs by growth factor-deprived (serum-free) conditions was associated with a significant increase in p53 mRNA and protein compared to freshly isolated GCs. These findings are consistent with the reported induction of p53 gene expression in rat antral follicles under serum-free conditions (20). On the other hand, p53 mRNA and protein levels were suppressed, in vitro by exogenous hCG, which is known to function as rescue factor preventing the regression of the corpus luteum in vivo. Finally, our in vitro observations indicating a role of p53 in follicular atresia correlated well with our in vivo studies evaluating the expression of p53 protein in archival tissue specimens from ovaries at different stages of development. These studies indicated that expression of p53 protein was localized to the nuclei and the cytoplasm of degenerating granulosa cells of atretic antral follicles. Generally, p53 is known to have a nuclear localization, and some cytoplasmic staining seen in GCs in the atretic follicle can be attributed to the apoptotic nature of these cells when the cellular organization is rapidly disintegrating. This is consistent with the reported presence of p53 immunostaining in apoptotic granulosa cells of atretic antral follicles in the rat (20). The above data, taken together, support the concept that p53 plays an important role in follicular atresia during adult reproductive life.

The mechanisms by which p53 may mediate apoptosis in the human ovary are still poorly understood. Several genes have been identified that represent specific transcriptional targets of p53 (40), and some of them are present in granulosa cells. A potential link between p53, a transcription factor capable of directly inducing apoptosis (10, 38), and bcl-2, a protein that prolongs cell survival (11, 41), has been reported (40). In addition, p53 can increase the transcriptional activity of the bax gene, which encodes a bcl-2-related protein that either directly (42) or indirectly, through inactivation of bcl-2, accelerates apoptosis (43). Histologic analysis of ovaries from bax-deficient mice revealed an apparent defect in the ability of granulosa cells to undergo apoptosis during follicular atresia (44). In addition, bax was found to correlate positively with apoptosis in rat granulosa cells of atretic follicles, and gonadotropin-mediated follicular survival was linked to a reduction in bax expression (45). Recent findings indicated that the expression of the bax gene in the human ovary also predominates in granulosa cell populations that are on the verge of apoptosis, but is absent in granulosa cells of healthy follicles (24). Taken together, these data indicate that the expression of the p53 gene and activation of p53-dependent pathways are regulated in the human ovary and may be the final downstream target inhibited during gonadotropin-induced follicular survival.

WT1 is a known regulator of the p53 gene (13, 14) and may independently induce apoptosis or cell cycle arrest. There is evidence that this gene may play an important role in urogenital organogenesis in animal models (18). Our studies indicated that human GCs possess the WT1 gene, which has an identical structure to that described in other human tissues. Interestingly, we demonstrated the presence of four different mRNAs, reflecting the absence or presence of two alternatively spliced insertions of 51 bp and 9 bp, respectively. This is consistent with the demonstration that the WT1 transcript is alternatively spliced in a variety of tissues (14, 35), including the rat ovary (46). The significance of alternative splicing of WT1 remains unknown, but it may reflect different functions of the gene. Furthermore, the nucleotide sequence of the zinc finger region of WT1 obtained from four patients was found to be normal. Immunoblot analysis of nuclear extracts of human GCs revealed the presence of the appropriately sized 52–54-kDa protein. Immunofluorescent staining showed the presence of WT1 protein to be in a nuclear location in GCs in vitro.

A role of WT1 in early stages of gonadal development has been proposed because WT1-deficient mice fail to develop the gonadal ridge during embryonic life (18, 19). In the present study, we demonstrated high levels of expression of WT1 protein product in primordial and primary follicles from fetal ovaries, as anticipated on the basis of its presumed implication in gonadal morphogenesis. The involvement of this gene in the physiology of the adult ovary is, however, unknown. We identified high levels of expression of WT1 protein product in primordial and primary follicles of human adult ovaries, suggesting an additional function for WT1 in later stages of ovarian development. Our immunohistochemical studies indicated that the expression of WT1 protein is developmentally regulated and progressively declines during follicular development. Higher levels of WT1 protein expression were detected in the primordial and primary follicles, whereas no WT1 expression was found in late atretic follicles. Our in vitro studies suggest that this gene is not directly involved with GC apoptosis mechanisms. GCs coexpressed WT1 and p53 in vitro, but WT1 protein levels did not change on induction of apoptosis in GCs, suggesting consitutive expression of the gene. Moreover, WT1 expression in GCs was not affected by the addition of gonadotropin in vitro. These data, taken together, suggest that WT1 may have a role in regulating granulosa cell function during gonadotropin-independent stages of follicular development, and its involvement in GC survival may decline in gonadotropin-dependent stages.

The exact role of WT1 in GC function remains purely speculative at this time. However, it is known that WT1 may inhibit p53-dependent apoptosis (13, 14). In addition, WT1 transcriptionally suppresses the expression of growth factors and their receptors (26), including colony-stimulating factor-1, insulin-like growth factor-II, insulin-like growth factor-I receptor, platelet-derived growth factor A, transforming growth factor-ß, and inhibin-{alpha} (46, 47, 48, 49). The paramount role of several of these factors in the gonadotropin-dependent and -independent paracrine control of folliculogenesis has been established (50, 51). It is possible that WT1 is a key factor in maintaining a balance between factors promoting follicular regression and factors inducing follicular maturation, promoting the preservation of ovarian follicles in a quiescent state throughout development and the reproductive life. In support of this hypothesis, mutations of WT1 have been reported in sex cord-stromal tumors of the ovary in the human (52).

In summary, we have provided evidence linking two important members of the tumor suppressor gene family, p53 and WT1 to ovarian follicular growth and atresia. Our data indicate that p53 gene is expressed in GCs and is closely related to their survival. This apoptosis-inducing gene is regulated by gonadotropins in human GCs, suggesting that p53 may play an important role in regulating follicular survival during gonadotropin-dependent stages of follicular life or maintenance of luteal cells during pregnancy. WT1, a known transcriptional regulator of p53, is also expressed in human GCs. Our data indicate that this gene is constitutively expressed in human granulosa cells and its expression remains strong during early stages of development, but progressively declines during gonadotropin-dependent follicular maturation. These data suggest a possible implication of WT1 in the mechanisms responsible for the maintenance of a quiescent state in follicles during gonadotropin-independent stages of follicular life.


   Acknowledgments
 
We thank Valerie Baldwin for her help in the preparation of this manuscript and Sam Croly and Jennifer Bucci for the isolation of granulosa/lutein cells.


   Footnotes
 
1 Supported by NIH Grants R01-HD31903 (to C.C.) and R01-HD34226 (to J.L.T.) and by the Alexandrer Onassis Foundation (to A.M.). Back

2 These authors contributed equally to this work. Back

Received June 16, 1999.

Revised August 23, 1999.

Accepted September 10, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Tilly JL, Kowalski, Johnson AL, Hsueh AJW. 1991 Involvement of apoptosis in ovarian follicular atresia and post-ovulatory regression. Endocrinology. 129:2799–2801.[Abstract]
  2. Rueda BR, Tilly KI, Botros IW, et al. 1997 Increased bax and interleukin-1ß-converting enzyme messenger ribonucleic acid levels coincide with apoptosis in the bovine corpus luteum during structural regression. Biol Reprod. 56:186–193.[Abstract]
  3. Adams JM, Cory S. 1998 The Bcl-2 protein family: arbiters of cell survival. Science. 281:1322–1326.[Abstract/Free Full Text]
  4. Cryns V, Yuan J. 1999 Proteases to die for. Genes Dev. 13:371.[Free Full Text]
  5. Gottlieb TM, Oren M. 1998 p53 and apoptosis. Semin Cancer Biol. 8:359–368.[CrossRef][Medline]
  6. Green DR, Reed JC. 1998 Mitochondria and apoptosis. Science.281:1309–1312.
  7. Kaelin WG Jr. 1999 Cancer. Many vessels, faulty gene. Nature. 399:203–204.[CrossRef][Medline]
  8. Kastan MB, Oyyekwere O, Sidransky D, Vogelstein B, Craig RW. 1991 Participation of p53 protein in the cellular response to DNA damage. Cancer Res. 51:6304–6311.[Medline]
  9. Fritsche M, Haessler C, Bradner G. 1993 Induction of nuclear accumulation of the tumor-suppressor protein p53 by DNA-damaging agents. Oncogene. 8:307–318.[Medline]
  10. Clarke AR, Purdie CA, Harrison DJ, et al. 1993 Thymocyte apoptosis induced by p53-dependent and independent pathways. Nature. 362:849–852.[CrossRef][Medline]
  11. Reed JC. 1994 Bcl-2 and the regulation of programmed cell death. J Cell Biol. 124:1–6.[Free Full Text]
  12. Polyak K, Xia Y, Zweier JL, Kinzler KW, Vogelstein B. 1997 A model for p53-induced apoptosis. Nature. 389:300–305.[CrossRef][Medline]
  13. Maheswaran S, Park S, Bernard A, et al. 1993 Physical and functional interaction between WT1 and p53 proteins. Proc Natl Acad Sci USA. 90:5100–5104.[Abstract/Free Full Text]
  14. Davies R, Moore A, Schedl A, et al. 1999 Multiple roles for the Wilms’ tumor suppressor, WT1. Cancer Res. 59:1747–1750.
  15. Rauscher FJ. 1993 The WT1 Wilms tumor gene product: a developmentally regulated transcription factor in the kidney that functions as a tumor suppressor. FASEB J. 7:896–903.[Abstract]
  16. Brunning W, Pelletier J. 1996 A non-AUG translational initiation event generates novel WT1 isoforms. J Biol Chem. 271:8646–8654.[Abstract/Free Full Text]
  17. Donehower LA, Harvey M, Slagle BL, et al. 1992 Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature. 356:215–221.[CrossRef][Medline]
  18. Kreidberg JA, Sariola H, Loring JM, et al. 1993 WT1 is required for early kidney development. Cell. 74:679–691.[CrossRef][Medline]
  19. Parker KL, Schedl A, Schimmer BP. 1999 Gene interactions in gonadal development. Annu Rev Physiol. 61:417–433.[CrossRef][Medline]
  20. Tilly KI, Banerjee S, Banerjee P, Tilly JL. 1995 Expression of the p53 and Wilms tumor suppressor genes in the rat ovary: gonadotropin repression in vivo and immunohistochemical localization of nuclear p53 protein to apoptotic granulosa cells of atretic follicles. Endocrinology. 136:1394–1402.[Abstract]
  21. Chun SY, McGee EA, Hsu SY, et al. 1999 Restricted expression of WT1 messenger ribonucleic acid in immature ovarian follicles: uniformity in mammalian and avian species and maintenance during reproductive senescence. Biol Reprod. 60:365–373.[Abstract/Free Full Text]
  22. Keren-Tal I, Suh BS, Dantes A, Lindner S, Oren M, Amsterdam A. 1995 Involvement of p53 expression in cAMP-mediated apoptosis in immortalized granulosa cells. Exp Cell Res. 218:283–295.[CrossRef][Medline]
  23. Kim JM, Yoon YD, Tsang BK. 1999 Involvement of the Fas/Fas ligand system in p53-mediated granulosa cell apoptosis during follicular development and atresia. Endocrinology. 140:2307–2317.[Abstract/Free Full Text]
  24. Kugu K, Ratts VS, Piquette GN, et al. 1998 Analysis of apoptosis and expression of bcl-2 gene family members in the human and baboon ovary. Cell Death Differ. 5:67–76.[CrossRef][Medline]
  25. Hosokawa K, Aharoni D, Dantes A, et al. 1998 Modulation of Mdm2 expression and p53-induced apoptosis in immortalized human ovarian granulosa cells. Endocrinology. 139:4688–4700.[Abstract/Free Full Text]
  26. Rauscher 3rd FJ. 1993 The WT1 Wilms tumor gene product: a developmentally regulated transcription factor in the kidney that functions as a tumor suppressor. FASEB J. 7:896–903.
  27. Chocmzynski P, Sacchi N. 1987 Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 162:156–159.[Medline]
  28. Ueyama H, Inazawa J, Nishino H, Han-Xiang D, Ochiai Y, Ohkubo I. 1995 Chromosomal mapping of the human smooth muscle actin gene (enteric type, ACTA3) to 2p13.1 and molecular nature of the hindIII polymorphism. Genomics. 25:720–723.[CrossRef][Medline]
  29. Gessler M, Poustka A, Cavenee W, Neve RL, Orkin SH, Bruns GA. 1990 Homozygous deletion in Wilms tumors of a zinc-finger gene identified by chromosome jumping. Nature. 343:774–778.[CrossRef][Medline]
  30. Harris N, Brill E, Shohat O, et al. 1986 Molecular basis for heterogeneity of the human p53 protein. Mol Cell Biol. 12:4650–4656.
  31. Zumbansen M, Stoffel W. 1997 Tumor necrosis factor {alpha} activates NF-kappaB in acid sphingomyelinase-deficient mouse embryonic fibroblasts. J Biol Chem. 272:10904–10909.[Abstract/Free Full Text]
  32. Bradford MM. 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 72:248–254.[CrossRef][Medline]
  33. Noyes RW, Hertig AT, Rock J. 1950 Dating the endometrial biopsy. Fertil Steril. 1:3–7.
  34. Call KM, Glaser T, Ho CY, et al. 1990 Isolation and characterization of a zinc finger polypeptide gene at the human chromosome 11 Wilms tumor locus. Cell. 60:509–520.[CrossRef][Medline]
  35. Haber DA, Sohn RL, Buckler AJ, Pelletier J, Call KM, Housman DE. 1991 Alternative splicing and genomic structure of the Wilm’s tumor gene WT1. Proc Natl Acad Sci USA. 88:9618–9622.[Abstract/Free Full Text]
  36. Breckwoldt M, Selaraj N, Aharoni D, et al. 1996 Expression of Ad4-BP/cytochrome 450 side chain clevage enzyme and induction of cell death in long term cultures of human granulosa cells. Mol Hum Reprod. 6:391–400.[Abstract/Free Full Text]
  37. Makrigiannakis A, Coukos G, Christophidou-Solomidou M, et al. 1999 N-cadherin-mediated human granulosa cell adhesion prevents apoptosis. A role in follicular atresia and luteolysis? Am J Pathol. 154:1391–1406.[Abstract/Free Full Text]
  38. Yonish-Royah E, ResuitzkyD, Lotem J, Sachs L, Kimchi A, Orey M. 1991 Wild type p53 induces apoptosis of myeloid leukemic cells that is inhibited by interleukin-6. Nature. 352:345–347.[CrossRef][Medline]
  39. Caamano J, Ruggeri B, Momiki S, Sickler A, Zhang SY, Klein-Szanto. 1991 Detection of p53 in primary lung tumors and non-small cell lung carcinoma cell lines. Am J Pathol. 139:839–845.[Abstract]
  40. Miyashita T, Krajewski S, Krajewski M, et al. 1994 Tumor suppressor p53 is a regulator of bcl-2 and bax gene expression in vitro and in vivo. Oncogene. 9:1799–1805.[Medline]
  41. Korsmeyer SH. 1992 Bcl-2 initiates a new category of oncogenes: regulators of cell death. Blood. 80:879–886.[Free Full Text]
  42. Yiu XM, Otvai ZN, Korsmeyer SJ. 1994 BH1 and BH2 domains of bcl-2 are required for inhibition of apoptosis and heterodimerization with bax. Nature. 369:321–323.[CrossRef][Medline]
  43. Otvai ZN, Milliman CL, Korsmeyer SJ. 1993 Bcl-2 Heterodimerizes in vivo with a conserved homolog, bax, that accelerates programmed cell death. Cell. 74:609–619.[CrossRef][Medline]
  44. Knudson CM, Tung KSK, Tourtellotte WG, Brown GAJ, Korsmeyer SJ. 1995 Bax-deficient mice with lymphoid hyperplasia and male germ cell death. Science. 270:96–99.[Abstract/Free Full Text]
  45. Tilly JL, Tilly KI, Kenton ML, Johnson AL. 1995 Expression of members of the bcl-2 gene family in the immature rat ovary: equine chorionic gonadotropin-mediated inhibition of granulosa cell apoptosis is associated with decreased bax and constitutive bcl-2 and bcl-Xlong messenger ribonucleic acid levels. Endocrinology. 136:232–241.[Abstract]
  46. Hsu SY, Kubo M, Chun S-Y, Haluska FG, Housman DE, Hsueh A. 1995 Wilms tumor protein WT1 as an ovarian transcription factor decreases in expression during follicle development and repression of inhibin gene promoter. Mol Endocrinol. 9:1356–1366.[Abstract]
  47. Dey BR, Sukhatme VP, Roberts AB, et al. 1994 Repression of the transforming growth factor-ß1 gene by the Wilms’ tumor suppressor WT1 gene product. Mol Endocrinol. 8:595–602.[Abstract]
  48. Drummond IA, Madden SL, Rohwer-Nutter P, et al. 1992 Repression of insulin- like growth factor II gene by the Wilms’ tumor suppressor, WT1. Science. 257:674–678.[Abstract/Free Full Text]
  49. Harrington MA, Konicek B, Song A, et al. 1993 Inhibition of colony-stimulating factor-1 promoter activity by the product of the Wilms’ tumor locus. J Biol Chem. 268:21271–21275.[Abstract/Free Full Text]
  50. Sidis Y, Fujiwara T, Leykin L, Isaacson K, Toth T, Schneyer AL. 1998 Characterization of inhibin/activin subunit, activin receptor, and follistatin messenger ribonucleic acid in human and mouse oocytes: evidence for activin’s paracrine signaling from granulosa cells to oocytes. Biol Reprod. 59:807–812.[Abstract/Free Full Text]
  51. Iwashita M, Kudo Y, Takeda Y. 1998 Effect of follicle stimulating hormone and insulin-like growth factors on proteolysis of insulin-like growth factor binding protein-4 in human granulosa/lutein cells. Mol Hum Reprod. 4:401–405.[Abstract/Free Full Text]
  52. Coppes MJ, Ye Y, Rackley R, et al. 1993 Analysis of WT1 in granulosa cell and other sex cord-stromal tumors. Cancer Res. 53:2712–2714.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Am. J. Pathol.Home page
A. Rolaki, G. Coukos, D. Loutradis, H. M. DeLisser, C. Coutifaris, and A. Makrigiannakis
Luteogenic Hormones Act through a Vascular Endothelial Growth Factor-Dependent Mechanism to Up-Regulate {alpha}5{beta}1 and {alpha}v{beta}3 Integrins, Promoting the Migration and Survival of Human Luteinized Granulosa Cells
Am. J. Pathol., May 1, 2007; 170(5): 1561 - 1572.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
J J Brosens and B Gellersen
Death or survival - progesterone-dependent cell fate decisions in the human endometrial stroma.
J. Mol. Endocrinol., June 1, 2006; 36(3): 389 - 398.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
M. Cherian-Shaw, R. Das, C. A. VandeVoort, and C. L. Chaffin
Regulation of Steroidogenesis by p53 in Macaque Granulosa Cells and H295R Human Adrenocortical Cells
Endocrinology, December 1, 2004; 145(12): 5734 - 5744.
[Abstract] [Full Text] [PDF]

Home page