help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Groussin, L.
Right arrow Articles by Bertherat, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Groussin, L.
Right arrow Articles by Bertherat, J.
The Journal of Clinical Endocrinology & Metabolism Vol. 85, No. 1 345-354
Copyright © 2000 by The Endocrine Society


Original Studies

Loss of Expression of the Ubiquitous Transcription Factor cAMP Response Element-Binding Protein (CREB) and Compensatory Overexpression of the Activator CREM{tau} in the Human Adrenocortical Cancer Cell Line H295R1

Lionel Groussin, Jean Francis Massias, Xavier Bertagna and Jérôme Bertherat

Groupe d’Etude en Physiopathologie Endocrinienne, Centre National de la Recherche Scientifique, UPR1524, Institut Cochin de Génétique Moléculaire, Université René Descartes-Paris V, 75014 Paris, France

Address all correspondence and requests for reprints to: Jérôme Bertherat, M.D., Ph.D., Groupe d’Etude en Physiopathologie Endocrinienne, Centre National de la Recherche Scientifique, UPR1524, Institut Cochin de Génétique Moléculaire, Centre Hospitalier Universitaire Cochin, 24 rue du Fg. St. Jacques, 75014 Paris, France. E-mail: bertherat{at}icgm.cochin.inserm.fr


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The pituitary hormone ACTH, acting through the cAMP pathway, plays a key role in proliferation and differentiation of the adrenal cortex. CAMP response element (CRE)-binding protein (CREB) is an ubiquitous transcription factor that binds to the CRE present in the promoter of numerous genes and mediates transcription stimulation by cAMP. Characterization of CRE-binding proteins was performed in the H295R cell line, which is considered a model for human adrenocortical tumor studies.

Western blot and RT-PCR studies demonstrated that CREB is not expressed in the human adrenocortical cancer cell line H295R, whereas it is expressed in normal adrenal. During transient transfection experiments, cAMP stimulation of two reporter genes containing canonical CRE was maintained. Cotransfection of the dominant negative inhibitor A-CREB, which prevents transcription factors containing a CREB-like leucine zipper domain to bind DNA, completely inhibited cAMP-induced stimulation of CRE activity. Western blot and RT-PCR studies showed that activating transcription factor-1 (ATF-1), CRE modulator-{alpha}/{gamma} (CREM{alpha}/{gamma}), and CREM{tau}2{alpha} are expressed in H295R cells. High amounts of CREM proteins were present in H295R, demonstrating an overexpression of this transcription factor in the absence of CREB. Furthermore, expression of the activator isoform CREM{tau} was very high in H295R compared to normal adrenal cortex. Transfection assays demonstrated that CREM{tau}2{alpha} is a potent stimulator of CRE activity in H295R. Finally, gel retardation assays showed that CREM and ATF-1 are the nuclear proteins that specifically bind the CRE in H295R cells, whereas CREM binding to CRE is not observed in a CREB-expressing cell line.

H295R cells are the first established nontransgenic cell line that does not express the ubiquitous transcription factor CREB. H295R demonstrates that CREM{tau} up-regulation can compensate for CREB deficiency to maintain CRE regulation by cAMP and is a model of compensation mechanisms between the members of the CREB/CREM/ATF-1 family of transcription factors. This loss of CREB expression and the overexpression of CREM could be linked to cellular transformation, as the normal adrenal cortex express high levels of CREB and no or low levels of CREM{tau}.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
REGULATION of gene expression by extracellular signals that activate the cAMP pathway from the cell surface to the nucleus is known to occur mainly at the transcriptional level through a palindromic conserved sequence (TGACGTCA) termed the cAMP response element (CRE) (1). The CRE is present in the promoter of many ubiquitous or tissue-specific genes. Among the nuclear proteins able to bind the CRE, the transcription factor CRE-binding protein (CREB) plays an important role in mediating cAMP-dependent transcription through protein kinase A (PKA) phosphorylation of CREB on serine 133 (2). The CREB gene is ubiquitously expressed, and CREB has been detected in all cells and tissues tested to date (3). CREB plays a major role in the development of many organs and is required for survival, as demonstrated in various transgenic animals expressing a dominant negative mutant of CREB and in knockout mice (4). A lack of CREB activity has been previously linked to a loss of PKA-dependent transcription (5, 6). Furthermore, immunoneutralization of CREB specifically inhibits cAMP-dependent transcription, leading to the suggestion that CREB is required for cAMP-dependent gene expression (7). Nevertheless, two structurally related proteins, activating transcription factor-1 (ATF-1) and CRE modulator (CREM), are also known to bind CRE and to regulate PKA-dependent transcription (8). CREB, ATF-1, and CREM are members of the bZIP superfamily of transcription factors and bind DNA as homo- or heterodimers. Multiple isoforms of the CREM gene products have been described that can positively or negatively regulate gene transcription in response to cAMP (9). The expression pattern of CREM isoforms is modulated by cAMP and varies between tissues (10, 11). A role for CRE-binding proteins has been postulated in cellular proliferation (12, 13, 14). In keeping with this hypothesis, activation of the cAMP pathway from the cell surface to the nucleus has been observed in various endocrine tumors (14, 15, 16).

In the adrenal cortex, the pituitary peptide hormone ACTH is the major activator of the cAMP pathway. ACTH is required for adrenal cortex activity and steroid synthesis (17). In humans, chronic ACTH stimulation, as observed, for instance, in Cushing’s disease, leads to adrenal cortex hyperplasia and cortisol hypersecretion. Furthermore, activation of the cAMP pathway by mutation of the {alpha}-subunit of G proteins (oncogene gsp, which leads to constitutive activation of adenylyl cyclase) or seven-transmembrane receptor ectopic expression has been observed in cases of Cushing’s syndrome with adrenal macronodular hyperplasia or adrenal tumors (18, 19, 20). However, regulation of the proliferation of adrenocortical cells by ACTH and cAMP is complex, because an inhibitory role of ACTH has also been observed in some species (21). Among the various genes that are stimulated by ACTH and/or cAMP in the adrenal cortex, a classical CRE has been observed in the promoter of c-fos, 11ß-hydroxylase (CYP11B1), and aldosterone synthase genes (CYP11B2) (22, 23, 24). By contrast, other cAMP-responsive genes, coding for steroidogenic enzymes or the ACTH receptor, present cAMP-responsive regulatory regions that frankly differ from the canonical CRE in their promoter (25). The H295R cell line was established from an invasive human adrenocortical carcinoma responsible for Cushing’s syndrome (26, 27). It is considered a model for human adrenal studies, because most adrenal steroidogenic enzymes are expressed and regulated by cAMP in this cell line (28).

Our aim was to characterize the CRE-binding proteins in the H295R cell line to assess their roles in the formation of steroid-secreting tumors of the adrenal cortex. Surprisingly, the ubiquitous transcription factor CREB is not expressed in this cell line despite the presence of cAMP-dependent regulation of a classical CRE. ATF-1 and CREM are the major CRE-binding proteins in this cell line, and CREM is up-regulated in the absence of CREB, compensating for CREB deficiency in these adrenocortical tumor cells. H295R is the first cell line in which CREB is not expressed, demonstrating the possibility of compensation within members of the CREB/CREM/ATF-1 family of transcription factors. As CREB is expressed in normal adrenal cortex, where CREM is much lower than in H295R cells, the alterations of this family of transcription factor could take part in adrenal cellular transformation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell line and transfection

The human adrenocortical H295R cell line (27, 28) was grown in DMEM-Ham’s F-12 supplemented with 2% Ultroser G (Biosepra), 2 mmol/L glutamine, 5 µg/mL insulin, 5 µg/mL transferrin, 5 ng/mL selenium, 50 U/mL penicillin, and 50 mg/mL streptomycin. The human cell lines DMS 79 and HeLa were grown as previously described (29). H293 cells were cultured in DMEM medium supplemented with 10% FBS, 2 mmol/L glutamine, and 50 mg/L gentamicin. All cells were cultured at 37 C in an atmosphere of humidified air containing 5% CO2. The cell lines were chosen because of their human origin. The HeLa and H293 cells were chosen for their high content of ATF-1 and CREB, respectively. The DMS79 cell line is an ACTH-secreting small cell carcinoma and was chosen as another cause of Cushing’s syndrome. Cells obtained from primary culture of bovine adrenal cortex were a gift from Dr. Jean-Jacques Feige (INSERM U-244, Grenoble, France). Transfections were performed by calcium phosphate coprecipitation in 10-cm dishes. The cells were exposed to the precipitate for 3 h and harvested 48 h later. When appropriate, cells were treated with forskolin (10 µmol/L) and 3-isobutyl-1-methylxanthine (IBMX; 0.5 mmol/L) for 12–15 h. All reagents used for cell culture were purchased from Sigma (St. Louis, MO). Chloramphenicol acetyltransferase (CAT) assays were performed by enzyme-linked immunosorbent assay using a kit from Roche Molecular Biochemicals (Mannheim, Germany). The reporter gene RSV-ßGal (3 µg) was used as an internal control for transfection efficiency, and CAT assays were normalized to ß-galactosidase activity. Transfection experiments were performed in duplicate. Results shown are the means of duplicate determinations for a representative experiment. Each transfection experiment was repeated at least three times with similar results.

Plasmids

The origins of RSV-ßGAL, {alpha}CG-CAT, somatostatin-CAT, and c-Fos-CAT reporter plasmids, PKA, Rous sarcoma virus (RSV)-CREB (and parental PGR expression vectors) (14), the cytomegalovirus (CMV)-CREM{alpha} and CMV-CREM{tau}2a expression vectors (30), and the A-CREB and parental pRc/CMV500 expression vectors (31) have been previously reported. DNA used for transfections was purified using the QIAGEN-tip 500 kit (QIAGEN, Chatsworth, CA), according to the manufacturer’s procedures.

Western blots and antibodies

Nontumoral human adrenal cortex were obtained during adrenalectomy performed for adrenal benign nonsecreting adenomas revealed as adrenal incidentaloma. The adjacent nontumoral adrenal cortex was immediately dissected by the pathologist and frozen in liquid nitrogen. The samples were macroscopically devoid of contaminating tissue from the adrenal medulla. Nuclear extracts were performed as previously reported with an addition of okadaic acid (1 µmol/L) in the buffers (14). Protein assays were performed using the Bio-Rad Laboratories, Inc., protein assay kit (Hercules, CA). Proteins were resolved by electrophoresis on 10% SDS-polyacrylamide gel and transferred to nitrocellulose sheets. CREB immunoblots were performed as previously described, using Ab 244 raised against a synthetic peptide spanning residues 128–162, Ab 253 raised against the full-length CREB protein, and Ab 5322 raised against a phosphorylated CREB peptide containing residues 128–141 (32). The CREB 24HB4 specific antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) was used for gel shift studies and recognized amino acids 254–327 within the DNA-binding domain of human CREB. The specific ATF-1 C41 and CREM X-12 antibodies were purchased from Santa Cruz Biotechnology, Inc.. For Western blot detection of the first antibody, the Immun-Star goat antirabbit IgG detection kit (Bio-Rad Laboratories, Inc.) was used to detect CREB and CREM antibodies. To detect the ATF-1 C41 antibody, an antimouse IgG-horseradish peroxidase and the enhanced chemiluminescence kit (Amersham Pharmacia Biotech, Arlington Heights, IL) were used. Bacterial recombinant CREB was a gift from Dr. M. Montminy; recombinant ATF-1 (amino acids 39–271) and recombinant full-length CREM were purchased from Santa Cruz Biotechnology, Inc..

RNA extraction, RT-PCR, cloning, and sequencing

Polyadenylated messenger RNA (mRNA) was extracted from H295R and DMS79 using the Micro FastTrack kit (Invitrogen, San Diego, CA). RT was performed with the complementary DNA (cDNA) cycle kit (Invitrogen). cDNA was amplified by PCR using the Dynazyme II DNA polymerase (Finnzymes Oy, Finland) for 35 cycles (94 C for 1 min, 56–60 C for 2 min, and 72 C for 3 min). As a negative control for the RT-PCR reaction, reverse transcriptase was omitted from the reaction mixture. The PCR products were separated on an agarose gel and stained with ethidium bromide. For Southern analysis, PCR products were transferred from a 1.5% agarose gel by capillary blotting to a nylon membrane (Hybond-N+, Amersham Pharmacia Biotech). Blots were hybridized at 5 C below the oligo(Tm), overnight with specific oligonucleotides end labeled with T4 polynucleotide kinase and [{gamma}-32P]ATP. Membranes were washed at room temperature twice for 10 min each time with 2 x SSC (standard saline citrate)-0.5% SDS for 30 min at hybridization temperature with 2 x SSC-0.5% SDS and for 20 min at hybridization temperature with 1 x SSC-0.5% SDS.

The synthetic oligonucleotides (Life Technologies, Inc., Gaithersburg, MD) used were as follows. For CREB cDNA amplification, the letter denotes the exon named according to Hoefler et al. (33) (Fig. 2GoGo): sense primers: B, 5'-ACC ATG GAA TCT GGA GCC GAG AAC-3'; G, 5'-TAC CCA GGG AGG AGC AAT ACA GCT-3'; and antisense primers: I, 5'-GTG GCA GTA AAG GTC CTT AAG TGC-3'; E, 5'-CTG TAG GAA GGC CTC CTT GAA AGA-3'; G, 5'-TTG AAC AAC AAC TTG GTT GCT GGG-3'. The hybridization oligonucleotides used and labeled as probe for CREB Southern blotting were as follows: E, 5'-TTT CAA CTA TTG CAG AAA GTG AAG-3'; F, 5'-TAT ACT GTC CAC TGC TAG TTT GGT-3'; and G, 5'-ATG GTT AAT GTT TGC AGG CCC TGT-3'. The cDNA amplification primers used for actin have been reported previously (34). The primers used for ATF-1 cDNA amplification were: sense, 5'-GAA GAT TCC CAC AAG AGT ACC ACG-3'; and antisense, 5'-CAG GAC TGC AAC TCG GTT TTC CAG-3'. The primers used for CREM cDNA amplification were: sense, 5'-GAC CAT GGA AAC AGT TGA ATC CCA-3' [located in exon B, according to Gellersen et al. (30)]; and antisense, 5'-AAA CTT CCG GGC GAT GCA GCC ATC-3' (located in exon H) and 5'-CGT CGA CAT TCT TTG GCA GC-3' (located in exon J).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 1. Western blot analysis of CREB protein in H295R. A, Western blot analysis of CREB protein in various human cell lines using the CREB antibody 244. Twenty-five micrograms of nuclear extracts from HeLa, H295R, H293, and DMS79 cell lines were loaded on the gel. Four nanograms of recombinant CREB and ATF-1-(39–271) and 6 ng of recombinant CREM protein were used. Molecular mass markers (kilodaltons) are shown on the left. B, Western blot analysis of CREB protein in various human cell lines using the CREB antibody 253 (left autoradiogram) and the 5322 phospho-CREB antibody (right autoradiogram). Molecular mass markers (kilodaltons) are shown on the left. C and D, Western blot analysis of CREB protein using the CREB antibody 253 in human adrenal cortex tissue (HAC1 and HAC2) and primary culture of bovine adrenal cortex (BAC). rCREB and DMS79 nuclear extracts were used as controls. Molecular mass markers (kilodaltons) are shown on the left.

 


View larger version (64K):
[in this window]
[in a new window]
 
Figure 2. RT-PCR of CREB gene expression in H295R. A, Schematic organization of the genomic structure of the human CREB gene (33 ). B and C, PCR amplification of cDNA made by RT of H295R or DMS79 mRNA. To ensure optimum sensitivity, a Southern blot hybridization was performed with 32P-labeled oligonucleotide probes from various regions of CREB. The primers and probes are shown at the bottom. They are identified by their corresponding exons (A; see Materials and Methods). RT- denotes control RNA in which RT was not performed. Molecular weight markers (kilobases) are shown on the left. D, Ethidium bromide-stained gel of a control RT-PCR performed with actin primers in DMS79 and H295R. Molecular weight markers (kilobases) are shown on the left.

 
CREM cDNA PCR products amplified with primers B–H were cloned in the pGEM-T Easy vector (Promega Corp., Madison, WI) after purification using the Wizard PCR prep purification system (Promega Corp.). Plasmids and PCR products were sequenced using an ABI 373A automated DNA sequencer.

Electrophoretic mobility shift assays

Gel shift assays with nuclear extracts from H295R and DMS79 were incubated in binding buffer [20 mmol/L HEPES, 0.2 mmol/L ethylenediamine tetraacetate, 0.1 mmol/L NaCl, 0.1 mmol/L KCl, 10 mmol/L MgCl2, 200 µg/mL BSA, 35% glycerol, and 5 µg poly(dI-dC)]. Labeled probe (5 fmol) was added to the reaction buffer, which contained 5 µg nuclear extracts, and was incubated at room temperature for 30 min. The complexes were resolved on a 6% nondenaturing polyacrylamide gel using an electrophoresis TBE 0.5x buffer. The gel was then dried, and the protein-DNA complexes were visualized autoradiographically using BIOMAX film (Eastman Kodak Co., Rochester, NY). For antibody supershift assays the nuclear extracts, antibody (1 µL 24HB4, C41, or X12) and binding buffer were preincubated for 30 min at room temperature before a 30-min incubation with labeled probe. The synthetic annealed oligonucleotides were end labeled with T4 polynucleotide kinase and [{gamma}-32P]ATP. The sequences of the wild-type and mutant oligonucleotides were as follows: rat somatostatin CRE, 5'-CGC CTC CTT GGC TGA CGT CAG AGA-3' (1); mutant somatostatin, 5'-CGC CTC CTT GGC TAA CAT CAG AGA-3'; human {alpha}CG CRE, 5'-GAT CCG GCT GAC GTC ATC AAG CTA-3' (35); NFY, 5'-GGG GTA GGA ACC AAT GAA ATG AAA GGT TA-3' (36); human collagenase activating protein-1 (AP-1), 5'-GAT CAA AGC ATG CAG ACA CCT-3' (37).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of the ubiquitous transcription factor CREB is lost in H295R

To study CREB expression and CREB phosphorylation in H295R, Western blot and RT-PCR studies were performed. Western blot with two different CREB antibodies (244 and 253) showed no signal using nuclear extracts of H295R, demonstrating clearly the lack of CREB protein in this cell line (Fig. 1Go, A and B). In contrast, CREB protein was easily detected in control cells (H293, DMS79, and HeLa) as well as in nontumoral human and bovine adrenal cortex (Fig. 1Go, C and D). Western blot with the 5322 phospho-CREB antibody showed that CREB is highly phosphorylated in H293 and DMS79, but that low levels of phosphorylation of CREB are present in unstimulated HeLa cells. The lack of signal with the nonphosphorylated recombinant CREB demonstrates the specificity of the 5322 antibody for the phosphorylated form of CREB (Fig. 1BGo). However, a lower molecular weight protein was detected with the 5322 antibody in H295R, HeLa, and H293 cells. This protein is probably phospho-ATF-1. CREB and ATF-1 share high sequence homology in their domains surrounding the PKA phosphorylation site (Ser133 in the KID domain of CREB, and Ser63 in ATF-1). Thus, the 5322 antibody should recognize phospho-ATF-1 as well as phospho-CREB (38).

To determine whether the lack of CREB protein was due to the loss of CREB gene expression in H295R, RT-PCR studies were performed. Using cDNA transcribed from H295R mRNA we found no PCR signal with three different sets of primers that amplified most of the CREB cDNA or its 5'- or 3'-regions. In contrast, all three sets of primers detected the expected CREB mRNA signal in the control cell line DMS79 (Fig. 2Go).

Despite the lack of CREB, transcriptional regulation by cAMP is preserved in H295R

The lack of CREB expression might lead to the loss of cAMP-dependent transcription. Thus, the activities of two different promoters, both containing canonical CREs, were studied in H295R. Cotransfection of the catalytic subunit of PKA or treatment with forskolin and IBMX to increase cAMP levels both stimulated the activity of reporter genes containing the somatostatin or the {alpha}CG promoters (Fig. 3AGo). The c-Fos promoter was also responsive to cAMP in this cell line (data not shown). The stimulation of the somatostatin promoter by forskolin and IBMX was similar in H295R and H293 cells, which express CREB (data not shown). This demonstrates that the cAMP transcriptional response was maintained despite the lack of CREB in the H295R cell line.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 3. cAMP regulation of CRE-driven transcription in H295R cells. Transient transfection experiments in H295R cells were performed as described in Materials and Methods, using 7 µg of two different CRE-CAT constructs [somatostatin CRE (SOM-CRE), shown on the left, or {alpha}CG CRE, shown on the right] and 3 µg RSV-ßGal, which was used as an internal control for differences in transfection efficiency. Results (mean of duplicates) are shown as the fold increase over the control value (C). The experiments were performed three times with similar results. A, Cells were treated with forskolin (FK) and IBMX or solvent (control, C) or were cotransfected with 5 µg of a PKA expression vector. B, Cells were treated with FK and IBMX or solvent (control, C) and were cotransfected with 5 µg of an expression vector of the dominant negative mutant A-CREB or the parental empty vector (pRc/CMV500).

 
To test the hypothesis that other members of the CREB/CREM/ATF-1 family of b-Zip transcription factors might compensate for CREB deficiency, cotransfection of the acidic dominant negative mutant of CREB (A-CREB) was performed in H295R. In transient transfection experiments, expression of A-CREB completely inhibited the cAMP response to both the somatostatin and {alpha}CG promoters (Fig. 3BGo). As A-CREB specifically binds to members of the CREB/ATF-1 family and not to other transcription factors from the b-ZIP family (31), this response demonstrates that ATF-1 and/or CREM compensate for the lack of CREB in H295R.

ATF-1 and several isoforms of CREM are expressed at high levels in H295R

To collect further evidence that CREM and/or ATF-1 can compensate for CREB deficiency in H295R, CREM and ATF-1 gene expression and protein levels were studied in this cell line and compared to those in other established human cell lines.

Western blot using an ATF-1-specific antibody showed a single band, demonstrating that ATF-1 protein is present in H295R (Fig. 4BGo). The amount of ATF-1 protein in H295R was almost as high as that in HeLa cells. This observation is in agreement with the phospho-ATF-1 protein detected using the 5322 phospho-CREB antibody (Fig. 1BGo). The HeLa cells contained the highest level of ATF-1 protein among all cell lines that we tested (data not shown). RT-PCR performed with cDNA transcribed from H295R and DMS79 mRNA, using a set of primers amplifying most of the coding part of ATF-1, showed a single band of the expected size in both cell lines (Fig. 4AGo).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 4. Expression of ATF-1 in H295R. A, PCR amplification of cDNA made by RT from polyadenylated mRNA extracted from H295R or DMS79 cells with specific ATF-1 primers. RT- denotes control RNA in which RT was not performed. Molecular weight markers (kilobases) are shown on the left. B, Western blot analysis of ATF-1 protein in nuclear extracts from HeLa and H295R cells, using the specific ATF-1 antibody C41. Forty micrograms of nuclear extracts from HeLa and H295R cells were loaded on the gel. Six nanograms of recombinant ATF-1-(39–271) (corresponding to a truncated form of ATF-1 that migrates faster than the wild-type protein) were used. Molecular mass markers (kilodaltons) are shown on the right.

 
Western blot studies demonstrated that several isoforms of the CREM protein are present in H295R (Fig. 5AGo). CREM protein was not detectable in DMS 79, a low amount of CREM protein was observed in HeLa cells, and a very high amount of CREM protein was seen in H295R cells. The respective molecular weights indicate that the two major forms of CREM protein detected in H295R correspond to human CREM{tau}2{alpha} (higher molecular weight protein) and CREM{alpha} or -{gamma} (lower molecular weight proteins; Fig. 5AGo). By contrast, in normal human adrenal cortex (Fig. 5BGo), the level of CREM{tau} protein was much lower than the level of CREM{alpha}/{gamma}.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 5. Expression of CREM in H295R. A, Western blot analysis (25 µg nuclear extracts from DMS79, H295R, and HeLa cells) using the CREM antibody X12 raised against the full-length human CREM protein. Six nanograms of recombinant CREM were used. Two major bands, representing CREM{tau}2{alpha} (upper band) and CREM{alpha}/{gamma} (lower band), can be observed in H295R. The antibody does not detect CREM protein in DMS79 cells and shows a very weak signal corresponding to CREM{alpha} in HeLa cells. Molecular mass markers (kilodaltons) are shown on the left. B, Western blot analysis (30 µg nuclear extracts from human adrenal cortex tissues HAC1 and HAC2) using the CREM antibody. Six nanograms of recombinant CREM were used. One major band representing CREM{alpha}/{gamma} is observed in human adrenal cortex, whereas the upper band corresponding to CREM{tau}2{alpha} is weak or undetectable. C, PCR amplification of cDNA made by RT from H295R RNA with specific CREM primers (B—J; see C). Molecular weight markers (kilobases) are shown on the left. D, The sequencing of cloned PCR products amplified with primers B–H and agarose gel purified demonstrates six different CREM isoforms in H295R (labeled 1–6). Isoforms 3–6 all contain a premature stop codon. Direct sequencing of PCR products amplified with primers B–J showed that the isoforms 1 and 2 correspond to CREM{tau}2{alpha}, CREM{alpha}, and CREM{gamma} (162). Isoforms 3–6 are identified as CREM{psi}{Delta}1,2; CREM{Delta}E; CREM{Delta}1P; and CREM{Delta}1P,2. The new CREM{Delta}E isoform lacks exon E, and the sequence at the junction between exon B and F is: CAATCCCTGCTTTAGCTCAG*GAAAATACTGAATGAACTGTCCTC (the junction between both exons is indicated by the asterisk, and the stop codon is underlined).

 
To identify the isoforms of CREM present in H295R cells, RT-PCR was performed with cDNA transcribed from H295R mRNA, using two sets of primers amplifying most of the coding part of CREM. Numerous isoforms of CREM mRNA are expressed in H295R (Fig. 5Go, C and D). Sequencing of cloned PCR products amplified with primers B-H identified six isoforms of CREM. Four of these isoforms (CREM{psi}{Delta}1,2; CREM{psi}1P, CREM{Delta}1,P2; and CREM{Delta}E) contain a premature stop codon (30). Except for CREM {Delta}E, all of these isoforms have previously been observed in other cell lines. The CREM {Delta}E isoform lacks exon E and is predicted to encode a truncated protein missing the DNA-binding domain of CREM. Direct sequencing of PCR products amplified with primers B–J identified the remaining isoforms as CREM{tau}2{alpha} and CREM{alpha}/{gamma}. These isoforms do not contain a premature stop codon and correspond to the proteins detected by Western blot. The mRNA of CREM{alpha} contains the two DNA-binding domains of CREM (DBDI and DBDII). As a stop codon is present at the 3'-end of DBDI (30), two proteins of similar molecular weight were expected for the CREM{alpha} and CREM{gamma} isoforms.

Major differences are observed between the nuclear CRE-binding proteins in a cell line expressing CREB and H295R cells

To specify the pattern of CRE-binding proteins in H295R, electrophoretic mobility shift assays were performed. Electrophoretic mobility shift patterns were compared between the CREB-deficient H295R cell line and the neuroendocrine DMS 79 cell line expressing CREB.

Gel shift experiments were performed using probes corresponding to the CRE sequence of the somatostatin and {alpha}CG promoters. The pattern of the complexes was dramatically different in the two cell lines. Three specific complexes were identified in both cell lines, as demonstrated by competition with the nonspecific NFY probe (Fig. 6Go, labeled 1, 2, and 3 in H295R and 4, 5, and 6 in DMS 79). These complexes were abolished by the addition of nonradiolabeled probes containing a canonical CRE ({alpha}CG or somatostatin CREs) or a closely related CRE (c-Fos CRE). Using H295R nuclear extracts, complex 3 was partially inhibited after addition of unlabeled probes containing a mutated CRE (mutSOM) or the AP-1 oligonucleotide, suggesting that part of the nuclear proteins comigrating with complex 3 are specific canonic CRE-binding proteins in this cell line. In contrast, using DMS 79 nuclear extracts, complex 6 was completely abolished after addition of unlabeled probes containing a mutated CRE (mutSOM) or an AP-1 oligonucleotide, demonstrating that an intact canonic CRE is not required for formation of this complex.



View larger version (57K):
[in this window]
[in a new window]
 
Figure 6. Electrophoretic mobility shift assay of CRE-binding proteins in H295R. Oligonucleotides corresponding to the {alpha}CG CRE (A) and the somatostatin CRE (B) were used to study the CRE-binding proteins in nuclear extracts (NE) of H295R and DMS 79. Arrows 1, 2, and 3 show the complexes observed in H295R, and arrows 4, 5, and 6 show the complexes seen in DMS79. Unlabeled competitor oligonucleotide (300-fold molar excess) was added as indicated (NFY, c-Fos, SOM, mutSOM, AP-1, and {alpha}CG; see Materials and Methods). Supershift assays (A, right, and B) were performed using CREB Ab, CREM Ab, or ATF-1 Ab, as indicated. Shifted bands are labeled with an asterisk. Experiments were performed at least three time with similar results.

 
Supershift assays (Fig. 6Go, A, right, and B) were performed to identify the proteins responsible for each specific complex. In H295R, complex 1 was abolished by a specific ATF-1 antibody. Complexes 2 and 3 were abolished by a CREM antibody. For complex 3, which is partly made up of noncanonical CRE-specific binding, the shift was more evident after the addition of an excess mutant somatostatin CRE (Fig. 6BGo). No supershift was observed in H295R using the specific CREB antibody, demonstrating that CREB is not part of the CRE-binding proteins in this cell line, as expected. In contrast, complex 4 in DMS 79 was abolished by the CREB antibody. These results confirm that ATF-1 and CREM are the major proteins that bind the CRE in H295R, as expected from the transient transfection assays using the dominant negative mutant A-CREB.

Regulation of cAMP-dependant transcription by CRE-binding proteins in the absence of CREB

Several antagonist trans-activation potentials have been described for the various CREM isoforms, and CREB deficiency could modify these potentials. We, therefore, studied CRE regulation by CREM in H295R. Cotransfection of the somatostatin reporter gene and CREM{alpha} or CREM{tau}2{alpha} expression vectors was performed in this cell line (Fig. 7Go). CREM{alpha} slightly inhibited the forskolin-induced stimulation of CRE activity. This CREM isoform is usually considered a negative regulator of cAMP-dependent transcription because it lacks the glutamine-rich domains Q1 and Q2. However, the magnitude of this inhibition was much less than that observed with the dominant negative mutant A-CREB. Transfection of a CREB expression vector increased cAMP stimulation of CRE activity. This increase was abolished by cotransfection of CREM{alpha}. Taken together, these data suggest that CREM{alpha} is a more potent CRE inhibitor in the presence of CREB, as expected for a competitive inhibitor. On the other hand, CREM{tau}2{alpha} was as effective as CREB in stimulating cAMP-dependent transcription, as expected, because the CREM{tau}2{alpha} isoform contains a glutamine-rich Q2 domain.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 7. Regulation of cAMP-dependent transcription by CREM isoforms and CREB in H295R. Transient transfection experiments in H295 cells were performed using 5 µg CRE-CAT constructs (somatostatin CRE); 3 µg RSV-ßGal, which was used as an internal control for differences in transfection efficiency; and 8 µg expression vector or parental vector. Results are the means of duplicates. The experiments were performed three times with similar results. FK and IBMX stimulation and cotransfection of CREM{alpha}, CREM{tau}2{alpha}, CREB, or A-CREB expression vectors were performed as indicated.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The H295R cell line is derived from an invasive adrenal cortical carcinoma that is responsible for the symptoms of glucocorticoid (Cushing’s syndrome), androgen, and mineralocorticoid excess. It is the first and unique human adrenocortical cell line available that has maintained its ability to produce and secrete the three types of adrenal steroids (26, 27, 28).Together with its conserved responsiveness to cAMP regulation, this cell line is a good model for studying adrenal steroidogenesis in humans (28). It has been shown that activation of the cAMP pathway stimulates CRE activity in H295R (24, 39). In particular, the proximal promoter of human CYP11B2 (aldosterone synthase) contains a CRE that binds proteins of the CREB family and is stimulated by cAMP in this cell line (24). However, other steroidogenic enzyme genes, which do not contain a canonical CRE sequence in their promoter, can be stimulated by cAMP in the adrenal cortex (40).

Because of the central role of ACTH- and cAMP-dependent transcription in adrenal cortex differentiation and proliferation and the potential role of the cAMP pathway in adrenal hyperplasia and tumorigenesis (18, 19, 20), we attempted to characterize the CRE-binding proteins in the H295R cell line. Surprisingly, the ubiquitous transcription factor CREB was not present in this cell line despite its expression in normal human and bovine adrenal cortex. This lack of CREB could be explained by the loss of CREB gene expression, as demonstrated by RT-PCR. Considering the various antibodies used for the Western blot studies and the different sets of PCR primers used, it seems unlikely that a truncated form of CREB is expressed in this cell line, as previously reported in other tissues (41). H295R is the first cell line identified to date that does not express the CREB gene. The F9 embryonal carcinoma cell line has a defect in cAMP-induced CRE activity that is compensated for by overexpression of exogenous CREB and PKA, suggesting that CREB is mandatory for cAMP-dependent transcription (5).

CREB is ubiquitously expressed (reviewed in Ref. 3) and is thought to be necessary for cAMP-dependent transcription through the CRE. Microinjection of CREB antibody abolishes CRE activity in response to PKA stimulation (7). The H295R cell line is the first nontransgenic model in which cAMP or PKA stimulation of CRE activity can occur in the total absence of CREB. We have demonstrated that the closely related transcription factors CREM and ATF-1 bind the CRE in this adrenocortical cell line and compensate for the loss of CREB expression. The complete inhibition of CRE activity by the dominant negative mutant A-CREB supports this conclusion. The acidic extension of A-CREB interacts specifically with the basic region of transcription factors containing a CREB-like leucine zipper (31). A-CREB then blocks binding of CREB and closely related transcription factors such as ATF-1 to DNA. In contrast, A-CREB does not modify binding of the b-ZIP factors of the AP-1 complex to DNA. ATF-1 is considered to be a positive regulator of cAMP-dependent transcription, whereas CREM isoforms could be either negative or positive regulators of CRE activity. We have verified in H295R cells that CREM{tau}2{alpha} is as effective as CREB in stimulating CRE activity. However, CREM{alpha}, which is a strong inhibitor in the presence of CREB, has only a weak inhibitory effect in H295R cells. Together the mobility shift assays and the transfection assays performed in H295R cells demonstrate that CREM and ATF-1 are the transcription factors compensating for CREB deficiency in this cell line.

Western blot showed that the levels of CREM proteins are much higher in H295R than in any other cell line that we studied. ATF-1 protein levels were similar in H295R cells and HeLa cells. HeLa cells contain the highest amount of ATF-1 protein among the human cell lines that we studied (42). Therefore, up-regulation of CREM and to a lesser extent of ATF-1 in H295R cells could compensate for CREB deficiency. A similar increase in CREM expression has been observed in CREB null mice (4, 43, 44). CRE activity in these mice has not been reported, but it is tempting to speculate that up-regulation of CREM could compensate for CREB gene deletion. The mechanism leading to CREM up-regulation in the H295R cells remains to be determined. However, in view of the similar expression pattern of the CRE-binding proteins in the CREB null mice and the H295R cells, an inhibition of CREM by CREB could be postulated.

Considering the major role of ACTH and cAMP in adrenal cortex differentiation and proliferation (16, 17), the dramatic changes in the expression of the CRE-binding protein of the CREB/ATF-1/CREM family in H295R cells raises questions about the involvement of these transcription factors in adrenal tumorigenesis. The adrenal pathology of the CREB knockout mice has not been reported (4), but the perinatal lethality observed in these animals might impair such study. In the normal adrenal cortex CREB protein can be detected, and the level of the activator CREM{tau} is much lower than the level of CREM{alpha}/{gamma} compared to the high CREM{tau} expression observed in H295R. In addition to the role played by cAMP in the proliferation of various endocrine tissues, a role for CRE-binding proteins in cellular proliferation and regulation of the cell cycle has also been postulated (12, 13, 14). The characterization of CRE-binding protein expression in adrenocortical tumors would be very interesting to study their role in adrenal tumor formation. In the adrenal cortex, ACTH stimulates the expression of the protooncogene c-fos (23). The transcriptional stimulation of c-fos by cAMP involves a CRE (22). Furthermore, most of the adrenal steroidogenic enzymes are regulated at the transcriptional level by cAMP. This regulation occurs through canonical CRE or some cAMP-responsive sequences that diverge from the palindromic CRE (24, 40). Our study demonstrates that the classical CRE is regulated by cAMP in the same manner in CREB-deficient adrenal H295R cells than in a cell line expressing CREB. Nevertheless, the alterations in the CREB/ATF-1/CREM family of transcription factors in H295 could have varying effects on noncanonical CREs.

In summary, the adrenocortical H295R cell line is the first established cell line that has lost the expression of the ubiquitous transcription factor CREB. It therefore represents a unique model for studying the regulation of transcription by cAMP in the absence of CREB. The isoforms CREM{tau}{alpha} and CREM{alpha} of the related transcription factor CREM are highly expressed in this cell line. ATF-1 and CREM are the nuclear proteins that bind to the CRE in H295R and compensate for the lack of CREB expression to maintain CRE regulation by cAMP. This human adrenocortical cell line demonstrates that CREB is not mandatory for CRE regulation by cAMP, because of the complex interplay between members of the CREB/CREM/ATF-1 family of transcription factors. Finally, as normal adrenal cortex and various human cell lines that we have tested express CREB at a high level and CREM{tau} at a low level compared to H295R, an alterations of the transcription factors of the CREB/CREM/ATF-1 family could take part in adrenal cortex tumor formation.


    Acknowledgments
 
We thank Dr. J. J. Feige and C. Mallet for the gift of bovine adrenocortical cells, Prof. M. Montminy for the CREB antibodies, Drs. D. Ginsty and D. B. Gellersen for, respectively, the A-CREB and human CREM ({alpha} and {tau}2{alpha}) plasmids, Drs. W. Rainey and C. Gicquel for providing the H295R cell line, Dr. A. Louvel for dissection of the human adrenal tissue, Dr. M. A. Dugue and the staff of the Laudat Laboratory for steroid assays of H295R culture media, F. Letourneur and E. Gomas for sequencing, and Drs. M. G. Catelli, P. Brindle and members of our laboratory for invaluable discussions.


    Footnotes
 
1 This work was supported by the Assistance Publique des Hôpitaux de Paris, the Association pour la Recherche sur le Cancer, the Ligue National Contre le Cancer, and a fellowship from the Fondation pour la Recherche Médicale and the Ligue National Contre le Cancer (to L.G.). Part of this work was presented at the 81st Annual Meeting of The Endocrine Society, June 12–15, 1999, San Diego, California. Back

Received June 28, 1999.

Revised August 30, 1999.

Accepted September 1, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Montminy MR, Sevarino KA, Wagner JA, Mandel G, Goodman RH. 1986 Identification of a cyclic-AMP-responsive element within the rat somatostatin gene. Proc Natl Acad Sci USA. 83:6682–6686.[Abstract/Free Full Text]
  2. Montminy M. 1997 Transcriptional regulation by cyclic AMP. Annu Rev Biochem. 66:807–822.[CrossRef][Medline]
  3. Meyer TE, Habener JF. 1993 Cyclic adenosine 3',5'-monophosphate response element binding protein (CREB) and related transcription-activating deoxyribonucleic acid-binding proteins. Endocr Rev. 14:269–290.[Abstract/Free Full Text]
  4. Rudolph D, Tafuri A, Gass P, Hammerling GJ, Arnold B, Schutz G. 1998 Impaired fetal T cell development and perinatal lethality in mice lacking the cAMP response element binding protein. Proc Natl Acad Sci USA. 95:4481–4486.[Abstract/Free Full Text]
  5. Gonzalez GA, Montminy MR. 1989 Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133. Cell. 59:675–680.[CrossRef][Medline]
  6. Masson N, Ellis M, Goodbourn S, Lee KA. 1992 Cyclic AMP response element-binding protein and the catalytic subunit of protein kinase A are present in F9 embryonal carcinoma cells but are unable to activate the somatostatin promoter. Mol Cell Biol. 12:1096–1106.[Abstract/Free Full Text]
  7. Meinkoth JL, Montminy MR, Fink JS, Feramisco JR. 1991 Induction of a cyclic AMP-responsive gene in living cells requires the nuclear factor CREB. Mol Cell Biol. 11:1759–1764.[Abstract/Free Full Text]
  8. Lalli E, Sassone-Corsi P. 1994 Signal transduction and gene regulation: the nuclear response to cAMP. J Biol Chem. 269:17359–17362.[Free Full Text]
  9. Foulkes NS, Borrelli E, Sassone-Corsi P. 1991 CREM gene: use of alternative DNA-binding domains generates multiple antagonists of cAMP-induced transcription. Cell. 64:739–749.[CrossRef][Medline]
  10. Mellstrom B, Naranjo JR, Foulkes NS, Lafarga M, Sassone-Corsi P. 1993 Transcriptional response to cAMP in brain: specific distribution and induction of CREM antagonists. Neuron. 10:655–665.[CrossRef][Medline]
  11. Foulkes NS, Schlotter F, Pevet P, Sassone-Corsi P. 1993 Pituitary hormone FSH directs the CREM functional switch during spermatogenesis. Nature. 362:264–267.[CrossRef][Medline]
  12. Servillo G, Penna L, Foulkes NS, Magni MV, Della Fazia MA, Sassone-Corsi P. 1997 Cyclic AMP signalling pathway and cellular proliferation: induction of CREM during liver regeneration. Oncogene. 14:1601–1606.[CrossRef][Medline]
  13. Uyttersprot N, Costagliola S, Dumont JE, Miot F. 1999 Requirement for cAMP-response element (CRE) binding protein CRE modulator transcription factors in thyrotropin-induced proliferation of dog thyroid cells in primary culture. Eur J Biochem. 259:370–378.[Medline]
  14. Bertherat J, Chanson P, Montminy M. 1995 The cyclic adenosine 3',5'-monophosphate-responsive factor CREB is constitutively activated in human somatotroph adenomas. Mol Endocrinol. 9:777–783.[Abstract/Free Full Text]
  15. Gaiddon C, Mercken L, Bancroft C, Loeffler JP. 1995 Transcriptional effects in GH3 cells of Gs alpha mutants associated with human pituitary tumors: stimulation of adenosine 3',5'-monophosphate response element-binding protein-mediated transcription and of prolactin and growth hormone promoter activity via protein kinase A. Endocrinology. 136:4331–4338.[Abstract]
  16. Roger PP, Reuse S, Maenhaut C, Dumont JE. 1995 Multiple facets of the modulation of growth by cAMP. Vitam Horm. 51:59–191.[Medline]
  17. Simpson ER, Waterman MR. 1988 Regulation of the synthesis of steroidogenic enzymes in adrenal cortical cells by ACTH. Annu Rev Physiol. 50:427–440.[CrossRef][Medline]
  18. Lacroix A, Bolte E, Tremblay J, et al. 1992 Gastric inhibitory polypeptide-dependent cortisol hypersecretion–a new cause of Cushing’s syndrome. N Engl J Med. 327:974–980.[Abstract]
  19. Lacroix A, Tremblay J, Rousseau G, Bouvier M, Hamet P. 1997 Propranolol therapy for ectopic ß-adrenergic receptors in adrenal Cushing’s syndrome. N Engl J Med. 337:1429–1434.[Free Full Text]
  20. Weinstein LS, Shenker A, Gejman PV, Merino MJ, Friedman E, Spiegel AM. 1991 Activating mutations of the stimulatory G protein in the McCune-Albright. N Engl J Med. 325:1688–1695.[Abstract]
  21. Hornsby PJ. 1984 Regulation of adrenocortical cell proliferation in culture. Endocr Res. 10:259–281.[Medline]
  22. Sassone-Corsi P, Visvader J, Ferland L, Mellon PL, Verma IM. 1988 Induction of proto-oncogene fos transcription through the adenylate cyclase pathway: characterization of a cAMP-responsive element. Genes Dev. 2:1529–1538.[Abstract/Free Full Text]
  23. Viard I, Hall SH, Jaillard C, Berthelon MC, Saez JM. 1992 Regulation of c-fos, c-jun and jun-B messenger ribonucleic acids by angiotensin-II and corticotropin in ovine and bovine adrenocortical cells. Endocrinology. 130:1193–1200.[Abstract/Free Full Text]
  24. Clyne CD, Zhang Y, Slutsker L, Mathis JM, White PC, Rainey WE. 1997 Angiotensin II and potassium regulate human CYP11B2 transcription through common cis-elements. Mol Endocrinol. 11:638–649.[Abstract/Free Full Text]
  25. Waterman MR, Bischof LJ. 1996 Mechanisms of ACTH (cAMP)-dependent transcription of adrenal steroid hydroxylases. Endocr Res. 22:615–620.[Medline]
  26. Gazdar AF, Oie HK, Shackleton CH, et al. 1990 Establishment and characterization of a human adrenocortical carcinoma cell line that expresses multiple pathways of steroid biosynthesis. Cancer Res. 50:5488–5496.[Abstract/Free Full Text]
  27. Rainey WE, Bird IM, Mason JI. 1994 The NCI-H295 cell line: a pluripotent model for human adrenocortical studies. Mol Cell Endocrinol. 100:45–50.[CrossRef][Medline]
  28. Staels B, Hum DW, Miller WL. 1993 Regulation of steroidogenesis in NCI-H295 cells: a cellular model of the human fetal adrenal. Mol Endocrinol. 7:423–433.[Abstract/Free Full Text]
  29. Picon A, Leblond-Francillard M, Raffin-Sanson ML, Lenne F, Bertagna X, de Keyzer Y. 1995 Functional analysis of the human pro-opiomelanocortin promoter in the small cell lung carcinoma cell line DMS-79. J. Mol Endocrinol. 15:187–194.
  30. Gellersen B, Kempf R, Telgmann R. 1997 Human endometrial stromal cells express novel isoforms of the transcriptional modulator CREM and up-regulate ICER in the course of decidualization. Mol Endocrinol. 11:97–113.[Abstract/Free Full Text]
  31. Ahn S, Olive M, Aggarwal S, Krylov D, Ginty DD, Vinson C. 1998 A dominant-negative inhibitor of CREB reveals that it is a general mediator of stimulus-dependent transcription of c-fos. Mol Cell Biol. 18:967–977.[Abstract/Free Full Text]
  32. Hagiwara M, Brindle P, Harootunian A, Armstrong R, Rivier J, Vale W, Tsien R, Montminy MR. 1993 Coupling of hormonal stimulation and transcription via the cyclic AMP-responsive factor CREB is rate limited by nuclear entry of protein kinase A. Mol Cell Biol. 13:4852–4859.[Abstract/Free Full Text]
  33. Hoeffler JP, Meyer TE, Waeber G, Habener JF. 1990 Multiple adenosine 3',5'-cyclic monophosphate response element DNA-binding proteins generated by gene diversification and alternative exon splicing. Mol Endocrinol. 4:920–930.[Abstract/Free Full Text]
  34. Epelbaum J, Bertherat J, Prevost G, Kordon C, Meyerhof W, Wulfsen I, Richter D, Plouin PF. 1995 Molecular and pharmacological characterization of somatostatin receptor subtypes in adrenal, extraadrenal, and malignant pheochromocytomas. J Clin Endocrinol Metab. 80:1837–1844.[Abstract]
  35. Deutsch PJ, Jameson JL, Habener JF. 1987 Cyclic AMP responsiveness of human gonadotropin-{alpha} gene transcription is directed by a repeated 18-base pair enhancer. {alpha}-promoter receptivity to the enhancer confers cell-preferential expression. J Biol Chem. 262:12169–12174.[Abstract/Free Full Text]
  36. Raymondjean M, Cereghini S, Yaniv M. 1988 Several distinct "CCAAT" box binding proteins coexist in eukaryotic cells. Proc Natl Acad Sci USA. 85:757–761.[Abstract/Free Full Text]
  37. Doyle GAR, Pierce RA, Parks WC. 1997 Transcriptional induction of collagenase-1 in differentiated monocyte-like (U937) cells is regulated by AP-1 and an upstream C/EBP-ß site. J Biol Chem. 272:11840–11849.[Abstract/Free Full Text]
  38. Tan Y, Rouse J, Zhang A, Cariati S, Cohen P, Comb MJ. 1996 FGF and stress regulate CREB and ATF-1 via a pathway involving p38 MAP kinase and MAPKAP kinase-2. EMBO J. 15:4629–4642.[Medline]
  39. Staels B, Martin G, Martinez M, et al. 1996 Expression and regulation of the lipoprotein lipase gene in human adrenal cortex. J Biol Chem. 271:17425–17432.[Abstract/Free Full Text]
  40. Waterman MR. 1994 Biochemical diversity of cAMP-dependent transcription of steroid hydroxylase genes in the adrenal cortex. J Biol Chem. 269:27783–27786.[Free Full Text]
  41. Walker WH, Girardet C, Habener JF. 1996 Alternative exon splicing controls a translational switch from activator to repressor isoforms of transcription factor CREB during spermatogenesis. J Biol Chem. 271:20145–21050.[Abstract/Free Full Text]
  42. Hai TW, Liu F, Coukos WJ, Green MR. 1989 Transcription factor ATF cDNA clones: an extensive family of leucine zipper proteins able to selectively form DNA-binding heterodimers. Genes Dev. 3:2083–2090.[Abstract/Free Full Text]
  43. Blendy JA, Kaestner KH, Schmid W, Gass P, Schutz G. 1996 Targeting of the CREB gene leads to up-regulation of a novel CREB mRNA isoform. EMBO J. 15:1098–1106.[Medline]
  44. Hummler E, Cole TJ, Blendy JA, et al. 1994 Targeted mutation of the CREB gene: compensation within the CREB/ATF family of transcription factors. Proc Natl Acad Sci USA. 91:5647–5651.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
B. Ragazzon, L. Cazabat, M. Rizk-Rabin, G. Assie, L. Groussin, H. Fierrard, K. Perlemoine, A. Martinez, and J. Bertherat
Inactivation of the Carney Complex Gene 1 (Protein Kinase A Regulatory Subunit 1A) Inhibits SMAD3 Expression and TGF{beta}-Stimulated Apoptosis in Adrenocortical Cells
Cancer Res., September 15, 2009; 69(18): 7278 - 7284.
[Abstract] [Full Text] [PDF]


Home page
DTBHome page
Testosterone patches for female sexual dysfunction
DTB, March 1, 2009; 47(3): 30 - 34.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
M. Rizk-Rabin, G. Assie, F. Rene-Corail, K. Perlemoine, H. Hamzaoui, F. Tissier, M. Lieberherr, X. Bertagna, J. Bertherat, and Z. Bouizar
Differential Expression of Parathyroid Hormone-Related Protein in Adrenocortical Tumors: Autocrine/Paracrine Effects on the Growth and Signaling Pathways in H295R Cells
Cancer Epidemiol. Biomarkers Prev., September 1, 2008; 17(9): 2275 - 2285.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
O Gubbay, M T Rae, A S McNeilly, F X Donadeu, A J Zeleznik, and S G Hillier
cAMP response element-binding (CREB) signalling and ovarian surface epithelial cell survival.
J. Endocrinol., October 1, 2006; 191(1): 275 - 285.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
T. Sugawara, N. Sakuragi, and H. Minakami
CREM confers cAMP responsiveness in human steroidogenic acute regulatory protein expression in NCI-H295R cells rather than SF-1/Ad4BP.
J. Endocrinol., October 1, 2006; 191(1): 327 - 337.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
R. Libe and J. Bertherat
Molecular genetics of adrenocortical tumours, from familial to sporadic diseases
Eur. J. Endocrinol., October 1, 2005; 153(4): 477 - 487.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
F. Tissier, C. Cavard, L. Groussin, K. Perlemoine, G. Fumey, A.-M. Hagnere, F. Rene-Corail, E. Jullian, C. Gicquel, X. Bertagna, et al.
Mutations of {beta}-Catenin in Adrenocortical Tumors: Activation of the Wnt Signaling Pathway Is a Frequent Event in both Benign and Malignant Adrenocortical Tumors
Cancer Res., September 1, 2005; 65(17): 7622 - 7627.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
F. de Fraipont, M. El Atifi, N. Cherradi, G. Le Moigne, G. Defaye, R. Houlgatte, J. Bertherat, X. Bertagna, P.-F. Plouin, E. Baudin, et al.
Gene Expression Profiling of Human Adrenocortical Tumors Using Complementary Deoxyribonucleic Acid Microarrays Identifies Several Candidate Genes as Markers of Malignancy
J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1819 - 1829.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
J Liu, X-D Li, A Ora, P Heikkila, A Vaheri, and R Voutilainen
cAMP-dependent protein kinase activation inhibits proliferation and enhances apoptotic effect of tumor necrosis factor-{alpha} in NCI-H295R adrenocortical cells
J. Mol. Endocrinol., October 1, 2004; 33(2): 511 - 522.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Bertherat, L. Groussin, F. Sandrini, L. Matyakhina, T. Bei, S. Stergiopoulos, T. Papageorgiou, I. Bourdeau, L. S. Kirschner, C. Vincent-Dejean, et al.
Molecular and Functional Analysis of PRKAR1A and its Locus (17q22-24) in Sporadic Adrenocortical Tumors: 17q Losses, Somatic Mutations, and Protein Kinase A Expression and Activity
Cancer Res., September 1, 2003; 63(17): 5308 - 5319.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. Gu, Y. Wen, A. Mison, and J. L. Nadler
12-Lipoxygenase Pathway Increases Aldosterone Production, 3',5'-Cyclic Adenosine Monophosphate Response Element-Binding Protein Phosphorylation, and p38 Mitogen-Activated Protein Kinase Activation in H295R Human Adrenocortical Cells
Endocrinology, February 1, 2003; 144(2): 534 - 543.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-F. Louet, G. Hayhurst, F. J. Gonzalez, J. Girard, and J.-F. Decaux
The Coactivator PGC-1 Is Involved in the Regulation of the Liver Carnitine Palmitoyltransferase I Gene Expression by cAMP in Combination with HNF4alpha and cAMP-response Element-binding Protein (CREB)
J. Biol. Chem., October 4, 2002; 277(41): 37991 - 38000.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Doi, H. Takemori, X.-z. Lin, N. Horike, Y. Katoh, and M. Okamoto
Salt-inducible Kinase Represses cAMP-dependent Protein Kinase-mediated Activation of Human Cholesterol Side Chain Cleavage Cytochrome P450 Promoter through the CREB Basic Leucine Zipper Domain
J. Biol. Chem., May 3, 2002; 277(18): 15629 - 15637.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. Bailey, R. J. Phillips, A. J. Pollard, K. Gilmore, S. C. Robson, and G. N. Europe-Finner
Characterization and Functional Analysis of cAMP Response Element Modulator Protein and Activating Transcription Factor 2 (ATF2) Isoforms in the Human Myometrium during Pregnancy and Labor: Identification of a Novel ATF2 Species with Potent Transactivation Properties
J. Clin. Endocrinol. Metab., April 1, 2002; 87(4): 1717 - 1728.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Groussin, L.
Right arrow Articles by Bertherat, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Groussin, L.
Right arrow Articles by Bertherat, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals