| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Medicine Branch, Division of Clinical Sciences, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892
Address all correspondence and requests for reprints to: Dr. Yutaka Chuman, First Department of Surgery, Faculty of Medicine, Kagoshima University, Sakuragaoka 8–35-1, Kagoshima 890-8520, Japan.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The transfer of a suicide gene into tumor cells is one strategy for
cancer gene therapy (6). One example of a suicide gene is herpes
simplex virus thymidine kinase (HSV-TK), an enzyme absent from
mammalian cells, which catalyzes the conversion of a nontoxic prodrug,
such as ganciclovir (GCV), to its toxic phosphorylated metabolite (7).
Transduction of the HSV-TK gene into mammalian cancer cells can confer
sensitivity to GCV. The key to successful suicide gene therapy is to
restrict gene expression to specific cell populations through the use
of specific promoters. This is important both in the treatment of a
systemic disease, such as metastatic cancer, and in local therapy, as
efficacy and safety can be improved by the use of cell type-specific
promoters that keep expression of the therapeutic gene in nontarget
cells at a minimum (8). Several cell type-specific promoters have been
explored, including carcinoembryonic antigen in colon cancer,
prostate-specific antigen in prostate cancer, 
-fetoprotein in
hepatoma, and DF3/MUC1 in breast cancer (9, 10, 11, 12). This approach is
applicable to adrenocortical cancer.
In preliminary studies examining the possibility of exploiting expression of the CYP11B1 gene in the treatment of adrenocortical cancer, expression of this gene was demonstrated in all 32 adrenocortical cancer specimens (13). Using H295 human adrenocortical cancer cells and Y-1 mouse adrenocortical cancer cells as in vitro models, we observed that the putative promoter of the CYP11B1 gene mediated preferential expression of a firefly luciferase reporter gene and the suicide gene, HSV-TK, in adrenocortical cells. Expression of HSV-TK in Y-1 cells conferred enhanced sensitivity to GCV. Although CYP11B1 promoter activity was preferentially observed in adrenocortical cells, we believed that the strength of the promoter could be enhanced.
In the present study we describe our attempts to enhance the activity of the CYP11B1 promoter while maintaining its specificity for adrenal cells. To achieve this, we isolated a putative enhancer element of the cholesterol side-chain cleavage (P450scc) gene and placed it upstream of the CYP11B1 promoter. This strategy enhanced the activity and specificity of the CYP11B1 promoter in adrenocortical cancer cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We used a total of 15 cell lines: the H295 adrenocortical cancer cell line (14), the Y-1 mouse adrenal tumor cell line, three thyroid cancer cell lines (FTC 263, FTC 133, and SW 1736), a colon carcinoma (DLD-1), a prostate cancer (PC-3M), an epithelial ovarian carcinoma [A2780(1A9)], a renal cell carcinoma (A498), a lung carcinoma (H462), a breast carcinoma (MCF7), an epidermoid carcinoma (KB-3–1), two hepatoma (Hep G2 and Hep 3B), and a transformed human kidney cell line (293).
Quantitative PCR
Quantitative RT-PCR was performed as previously described (13). Total ribonucleic acid (RNA) was extracted using RNA STAT-60 (Tel-Test, Inc., Friendswood, TX). The primers were: CYP11B1 5' (sense), 1207GTGCGCGTGTTCCTCTACTCT1227; CYP11B1 3' (antisense), 1463ATAACTCCGGGTCGTACACGG1483; ACTH receptor 5' (sense), -149GTTCCTGCTTCAGAGCTGAAG –129; ACTH receptor 3' (antisense), 557GACCAGAAGTAGGACAACGGA575; MDR1 5' (sense), 410GCCTGGCAGCTGGAAGACAAATACACAAAATT441; MDR1 3' (antisense), 664CCCTTGTGATTTTGGCCATCAGTCCTGTTCTT695; P450scc 5' (sense), 388GCCCCAACCCAGAACGATTC407; and P450scc 3' (antisense), 617CGGAAATTACTCGGGGGACA636.
RNA from a normal adrenal was serially diluted and amplified in every experiment and was included in every gel. Thus, in every experiment the reaction conditions were internally controlled, and in every gel a reference standard was included. Dilutions were chosen so that all reactions were in the exponential range. Similar results were obtained using either ß2-microglobulin or 28S as standards.
Construction of reporter plasmids
The promoter of the CYP11B1 gene was isolated using PCR and DNA from H295 cells. Primers used were: 5' (sense), CGAAG-ATC-1117TACCAGTTCCTCCTTGTACGTC-1096; and 3' (antisense), 7AATGGCACTCAGGGCAAAGG26AAGCTTCTG. BglII (sense) and HindIII (antisense) restriction sites flanked the CYP11B1 promoter sequence. The amplified fragment was subcloned into the PCR II TA vector (Invitrogen, San Diego, CA), and its sequence was confirmed. After digestion with BglII and HindIII, the 1143-bp promoter fragment was ligated to the pGL3-B luciferase vector (Promega Corp., Madison, WI). This construct was designated 11ß-Luc. In addition, the HSV-TK minimum promoter was excised by digesting pRL-TK (Promega Corp.) with HindIII and BglII; this was subcloned into PGL3-B and designated TK-Luc. TK-Luc was used as the positive control.
The enhancer element of P450scc was amplified using the PCR and
the following primers: 5' (sense),
-1958AGAGGATGAGGCAATAACCTC-1938;
and 3' (antisense),
-1530GGAAGAGCAACAACCACTCT-1511.
The amplified fragment was subcloned into PCR II TA vector
(Invitrogen), and its sequence was confirmed. The insert
was released with XhoI and SstI, and inserted
into the 11ß-Luc and TK-Luc plasmids digested with XhoI
and SstI. These constructs were designated SCC/11ß-Luc and
SCC1958/TK-Luc. Two deletions of SCC1958/TK-Luc were prepared by
digestion with either SstI and SpeI or
SstI and StuI, removing residues -1958 through
-1880 (SstI/SpeI) or -1958 through -1706
(SstI/StuI). After self-ligation, the luciferase
gene driven by the HSV-TK promoter had either residues -1880 to -1511
(SCC1880/TK-Luc) or residues -1706 to -1511 (SCC1706/TK-Luc) of the
P450scc enhancer. To construct SCC/11ß-TK, we digested 11ß-TK
containing the HSV-TK-coding region and the CYP11B1 promoter with
BglII and inserted the -1958 to -1511 SCC enhancer
fragment. The vectors used in this study are shown in Fig. 1
.
|
Transient transfections used a liposome-mediated method. Because of their slow growth rate, 2 x 105 H295 cells were plated in each well of a 24-well plate 2 days before transfection; for all other cell lines, 3–4 x 104 cells were plated 24 h before transfection. Because of the poor transfection efficiency of H295 cells, 1.5 µg plasmid DNA and 4.5 µl TransFast (Promega Corp.) mixed with 200 µl medium were added to each well; for all other cell lines 0.5 µg plasmid DNA and 1.5 µl TransFast or Tx20 (Promega Corp.) mixed with 200 µl medium were used. After incubation for 1 h in the above mixtures, cells were cultured in the presence or absence of 0.3 mmol/L 8-bromo-cAMP (8-Br-cAMP) or other differentiating agents for 2 days. After harvesting, the total protein concentration was measured using a protein assay (Bio-Rad Laboratories, Inc., Richmond, CA). Firefly luciferase activity was assessed using the Luciferase Assay System (Promega Corp.) and was normalized to protein. All transfections were performed in triplicate and for H295 cells were repeated at least three times to confirm reproducibility because of its low transfection efficiency. In all experiments, TK-LUC and PGL3-B were used as positive and negative controls, respectively. Stable transfection of Y-1 cells with SCC/11ß-TK also employed TransFast. After 3 weeks in medium containing 300 µg/mL G418, stable transfectants were isolated.
Western blot analysis
Stable Y-1 transfectants were scraped into cell lysis buffer containing 10 mmol/L Tris (pH 7.4), 150 mmol/L NaCl, 1% Nonidet P-40, 1 mmol/L ethylenediamine tetraacetate, and 20 µg/mL aprotinin, and 100 µg protein were separated on a 10% SDS-PAGE gel. Electroblotting to Immobilon-P transfer membrane (Millipore Corp., Bedford, MA) was performed, and nonspecific protein binding was blocked using 10% milk in TNE buffer [2 mmol/L Tris (pH 7.4), 2 mmol/L NaCl, 1 mmol/L ethylenediamine tetraacetate, and 0.15% Tween 20] for 1 h. The membrane was incubated for 1 h with a rabbit polyclonal antibody for HSV-TK (provided by Dr. William C. Summers, Yale University, New Haven, CT), diluted 1:1000 in 5% milk, and 0.02% sodium azide in TNE. After washing, antirabbit Ig horseradish peroxidase-linked secondary antibody (Amersham Pharmacia Biotech, Arlington Heights, IL) was added for 1 h. After washing, the membrane was developed in ECL Western blotting detection reagents (Amersham Pharmacia Biotech).
Cell killing assay
The 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide assay was performed to determine sensitivity to GCV. Cells maintained in a 25-cm2 flask with or without differentiating agents for 2 days were seeded in 96-well plates (6000 cells/well) and incubated in various concentrations of GCV for 5 days. Cell survival was calculated as the percentage of untreated cells.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The unique nature of adrenocortical cells and previous findings demonstrating expression of CYP11B1 messenger RNA (mRNA) in all adrenocortical carcinomas were catalysts for the present study. The knowledge that expression of CYP11B1 is a property of a differentiated adrenocortical cell provided the rationale for including differentiating agents in the experimental design. Previous studies had demonstrated that the CYP11B1 promoter could direct expression of a luciferase promoter preferentially in adrenocortical cancer cells. The present studies were designed to improve the specificity and activity of previous constructs.
Although CYP11B1 is expressed almost exclusively in adrenocortical
cells, other enzymes are also highly expressed, although they are
somewhat less adrenal specific. One of these is the first enzyme in the
biosynthetic pathway, P450scc. Previous studies identified the promoter
of the P450scc gene and a putative enhancer (15). Although the P450scc
enhancer need not be adrenal specific, we reasoned that its specificity
would be restricted and probably include adrenocortical cells. Thus, we
attempted to use this enhancer to augment the activity of the CYP11B1
promoter. The original description identified the residues comprising
the enhancer as -1958 through -1503, with the start of transcription
designated +1. As a first step, we sought to determine whether the full
length was necessary or whether a truncated version could target
adrenocortical cancer cells. We subcloned three lengths of the P450scc
enhancer proximal to the HSV-TK promoter in TK-Luc: 1) a full-length
enhancer containing residues -1958 through -1511 (SCC1985/TK-Luc), 2)
an intermediate length containing residues -1880 through -1511
(SCC1880/TK-Luc), and 3) a further truncation encompassing residues
-1706 through -1511 (SCC1706/TK-Luc). Figure 2A shows luciferase activity after transient
transfection of H295 and Y-1 cells with either control TK-Luc or TK-Luc
with the three lengths of enhancer. Luciferase activity in untreated
cells was compared to that in cells treated with the differentiating
agent, 8-Br-cAMP. The luciferase activity of TK-Luc in untreated cells
was assigned a value of 1. Although the three lengths of enhancer did
not significantly affect the basal activity of TK-Luc in untreated
cells, they significantly augmented luciferase activity after 0.3
mmol/L 8-Br-cAMP. The effect of 8-Br-cAMP was more pronounced in human
H295 than in mouse Y-1 adrenocortical cancer cells. Although the
differences among the three lengths were not significant, the highest
activity was observed with the longest enhancer, and consequently, this
length was chosen for subsequent experiments. Figure 2B summarizes
experiments investigating the enhancer specificity for adrenocortical
cells. Five cancer cell lines from five different tissues (see Table 1) and H295 cells were transfected with
either TK-Luc or SCC1958/TK-Luc, and luciferase activity was determined
in untreated cells and in cells treated with 0.3 mmol/L 8-Br-cAMP. The
activity of TK-Luc in untreated cells was assigned a value of 1 for
each cell line to provide a reference for this diverse group of cells
with variable transfection efficiencies. As shown, 8-Br-cAMP did not
augment the activity of either TK-Luc or SCC1958/TK-Luc in the five
cells lines that were not of adrenocortical origin, suggesting that
augmentation by the enhancer after 8-Br-cAMP was specific.
|
|
Having documented the activity and specificity of the P450scc
enhancer, we cloned the -1958 through -1511 fragment proximal to the
CYP11B1 promoter. The resulting construct, designated SCC/11ß-Luc,
was transfected into H295 and Y-1 cells and compared with 11ß-Luc
containing only the CYP11B1 promoter (Fig. 3). In both cell lines, the SCC enhancer
augmented the basal activity of SCC/11ß-Luc compared to 11ß-Luc,
and in the H295 cells ,it increased the response to 8-Br-cAMP. To
establish the specificity of expression, 13 additional cell lines of
diverse origins were compared to H295 and Y-1 cells. In Fig. 4A, relative luciferase activities are
compared using 11ß-Luc; in Fig. 4B, relative activities are
contrasted using SCC/11ß-Luc. All cell lines were also transfected
with TK-Luc, and the activity of each vector is expressed relative to
that of TK-Luc, which was assigned a value of 1. Addition of the
P450scc enhancer increased the specificity and, as shown in Fig. 3, increased the responsiveness to 8-Br-cAMP in human H295 cells. The
enhanced basal activity and the augmentation by 8-Br-cAMP in H295 and
Y-1 cells compared with those in the other cell lines indicated this
construct had a relatively high adrenal cell specificity.
|
|
To support the thesis that the augmented expression after
8-Br-cAMP was a result of cellular differentiation and to characterize
other differentiating agents, we examined the effects of several agents
on SCC/11ß-Luc. We compared the effects of 8-Br-cAMP with those of
the cAMP agonist, forskolin, and with those of ACTH, a hormone reported
to have differentiating activity in adrenocortical cells (16), as well
as with those of two differentiating agents with distinct,
non-cAMP-dependent effects, sodium butyrate and
all-trans-retinoic acid. We first examined the effects of
these agents on expression of the endogenous genes in H295 cells.
Expression was quantitated using a PCR technique, previously validated
(13). The results are summarized in Table 2. Expression of CYP11B1, ACTH receptor,
P450scc, and the multidrug resistance gene, MDR-1, were
compared. Expression in untreated cells has been assigned a value of 1.
For comparison, levels in a normal adrenal gland are included.
Expression of these four genes was lower in H295 cells, than in the
normal adrenal, consistent with dedifferentiation during malignant
transformation. Treatment with the two agonists of the cAMP pathway
(8-Br-cAMP and forskolin) increased expression of CYP11B1, ACTH
receptor, and P450scc, but not MDR-1, whereas sodium
butyrate and all-trans-retinoic acid, neither of which acts
via cAMP, had no effect.
|
shows the effects of the
differentiating agents on 11ß-Luc and SCC/11ß-Luc in H295 cells.
The induction of luciferase activity correlates well with the effects
on the endogenous genes; the greatest induction was observed with
8-Br-cAMP and forskolin, whereas sodium butyrate and
all-trans-retinoic acid had little or no effect. This figure
also shows for comparison the effects of these agents on the expression
of SCC/11ß-Luc in Y-1 cells. With the exception of an increase after
ACTH treatment, the expression profiles were similar to that in H295
cells.
|
Although the goal of these studies was to develop a strategy for
the treatment of adrenocortical cancer in humans, parallel studies were
conducted in mouse Y-1 cells to confirm the observations in H295 cells
and because Y-1 cells grow faster (doubling time of 26 h for Y-1
cells vs. >5 days for H295 cells) and transfect better
(10% transfection efficiency for Y-1 cells vs. <1% for
H295 cells) than H295 cells. We wanted to examine whether the SCC/11ß
fragment could drive expression of a HSV-TK gene for use in GCV-induced
suicide. To do this, SCC/11ß-TK was constructed by cloning the
SCC/11ß fragment upstream of the HSV-TK gene in an expression vector
containing the neomycin resistance gene. Transfection of Y-1 cells with
SCC/11ß-TK was followed by selection in G418 for 3 weeks and cloning
by limiting dilution to isolate individual colonies. A total of 34
clones were isolated. Fourteen expressed HSV-TK protein and were more
sensitive than parental Y-1 cells to GCV. Four were chosen for further
investigations. Figure 6 shows expression of
HSV-TK in Y-1 cells and the 4 clones. As expected, expression of HSV-TK
protein could not be detected in parental Y-1 cells even after
treatment with differentiating agents. In contrast, expression could be
detected in the SCC/11ß-TK clones, albeit at variable levels.
Furthermore, in 2 of the clones, expression of HSV-TK protein could be
further induced by 8-Br-cAMP, forskolin, or ACTH, the agents shown to
mediate luciferase expression in Y-1 cells (see Fig. 5
). Coincident
with this, GCV sensitivity was markedly enhanced in the clones relative
to parental Y-1 cells. As shown in Fig. 7, in
contrast to parental Y-1 cells, which were relatively insensitive to
GCV, with an IC50 greater than 100 µmol/L, the various
clones had IC50 values between 1–20 µmol/L. Furthermore,
in those clones in which expression was inducible by differentiating
agents, pretreatment with these compounds resulted in further
sensitization. Thus, the SCC/11ß fragment was able to induce
expression of HSV-TK (Fig. 6), and this, in turn, could be used to
modulate GCV sensitivity (Fig. 7).
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In developing a gene therapy approach for a specific cancer, two issues deserve special attention: 1) the need to express the gene(s) of interest in a tissue-specific manner, and 2) the need that this be at a sufficiently high level that therapeutic benefit can be derived. The first of these, specificity, can be achieved if the promoter used restricts expression of the therapeutic gene to tumor cells. To achieve specificity, the CYP11B1 (11ß-hydroxylase) promoter appears to be an ideal candidate for adrenocortical cancer. We have previously demonstrated CYP11B1 expression almost exclusively in normal adrenal tissue, with only minimal expression in the normal ovary and testes, as well as expression in 32 adrenocortical cancer samples, but not in other tumors (13). Furthermore, in the present study, CYP11B1 promoter activity was preferentially demonstrated in H295 and Y-1 adrenocortical cells relative to its expression in 13 cell lines derived from tissues other than the normal adrenal. Taken together, these data support the possibility of using the CYP11B1 promoter as an adrenocortical-specific promoter in a suicide gene therapy strategy. In this regard we would also point out that preliminary data indicate that adrenal cells can be infected by adenovirus (unpublished observations). The second issue, the need for significant expression, is essential for successful therapy and impacts the issue of specificity. The level of expression of the CYP11B1 promoter in adrenocortical cells was about 20–30% that of the HSV-TK promoter in the absence of 8-Br-cAMP and 90–100% after treatment with 8-Br-cAMP. Although the promoter activity was not as high as that of a cytomegalovirus (CMV)-driven luciferase construct (data not shown), the activity of the promoter used may be sufficient. Although Esandi et al. reported that in vivo treatment with a CMV-driven thymidine kinase (TK) adenovirus was more tumoricidal than that with a Rous sarcoma virus-driven TK adenovirus (18), other studies indicate that the level of HSV-TK activity required for cytotoxicity may not need to be the maximal that can be achieved. Thus, for example, Elshmi et al. did not find significant enhancement of antitumor effect of a TK/GCV system between Rous sarcoma virus- and CMV-driven adenovirus vectors (17). This similarity in antitumor effect was observed both in vitro and in vivo, leading the researchers to conclude that increasing the HSV-TK enzyme levels above a minimal threshold was not effective in augmenting the TK/GCV system. Similarly, Vandier et al. reported that the glial fibrillary acidic protein promoter, which was reportedly approximately 100-fold less active than the CMV promoter, drove the HSV-TK gene efficiently and specifically to kill glioma cells (19). Although these latter reports indicate that HSV-TK activity and GCV sensitivity may not be directly correlated to the promoter activity driving the HSV-TK gene, we believed that the activity of the 11ß-Luc promoter may not be sufficient. Thus, we sought to further augment the activity of this construct and looked to other enzymes of the steroid biosynthetic pathway.
We chose cytochrome P450scc, a mitochondrial enzyme that catalyzes the conversion of cholesterol to pregnenolone and is the first step in the synthesis of all steroid hormones (15). The P450scc gene is expressed in steroidogenic tissues such as adrenal gland, ovary, testis, and placenta, with some expression also detected in the brain. The 5'-flanking region of this gene has received greater scrutiny than the promoter region of the other enzymes in the steroid biosynthetic pathway. Previous reports using mouse Y-1 cells identified cAMP-responsive elements (CRE) in the human P450scc promoter at residues -1641 to -1697, -1629 to -1654, and -1503 to -1621 and an adrenal gland-selective enhancer element (AdE) at -1822 to -1931 (15, 20, 21). Therefore, we isolated a fragment encompassing residues -1958 to -1511 of the human P450scc promoter, which contains the putative CREs and the AdE and confirmed its function as a CRE and AdE in human H295 and mouse Y-1 cells. The -1958 to -1511 sequence of the human P450scc promoter increased the activity of both the HSV-TK minimum promoter and the CYP11B1 promoter in H295 and Y-1 adrenocortical cells, but not in cell lines of other tissue origin. The increase was more pronounced after 8-Br-cAMP, so that not only the activity but also the specificity of the SCC/11ß promoter were markedly enhanced in response to 8-Br-cAMP. The fold increase in human H295 cells after 8-Br-cAMP treatment was greater than that in mouse Y-1 cells. This observation was not unexpected given previous reports suggesting that although mouse adrenocortical cancer Y-1 cells are widely used for analysis of the regulation of the human steroidogenic enzymes, transcriptional regulation of the P450scc gene in human adrenal cells differs substantially from Y-1 cells (22). In the present study, however, the CRE and AdE fragment identified in mouse Y-1 cells enhanced the promoter activity in human adrenal H295 cells to a greater extent than in mouse Y-1 cells and was further augmented by the cAMP pathway agonists, 8-Br cAMP, forskolin, and ACTH, in both Y-1 and H295 cells. Enhancement by 8-Br-cAMP was not found in any other cell line. These data suggest that species differences in promoter function are minor compared to tissue differences and that mouse Y-1 cells are an appropriate model to examine the human promoter. Consequently, because of the slow growth rate and low transfection efficiency of H295 cells, mouse Y-1 cells were used to isolate stable transfectants.
The Y-1 stable transfectants expressed HSV-TK and demonstrated much higher sensitivity to GCV than parental Y-1 cells. Basal expression varied, and in those with lower levels, HSV-TK expression and sensitivity to GCV were enhanced by 8-Br-cAMP, forskolin, and ACTH. These data are consistent with the results of the luciferase assay and suggest that enhancement could be specific in adrenal cells. We would emphasize that although sensitivity was enhanced by as much as 10-fold, greater sensitization may be possible under optimal conditions. Our experiments only examined pretreatment with 8-Br-cAMP, forskolin, and ACTH, and these have antiproliferative effects for Y-1 cells (23, 24). Induction with other agents that do not inhibit growth might have a greater effect.
Unlike other tumor-targeted strategies that exploit the expression of genes acquired during malignant transformation, CYP11B1 expression is a differentiated function. Variable tumor dedifferentiation is expected to result in lower expression of CYP11B1, and other adrenal markers, such as the ACTH receptor mRNA, and differentiating agents might up-regulate their transcription. To be sure, the choice of differentiating agent will be important. As previously reported, 8-Br-cAMP and forskolin induced expression of the ACTH receptor and CYP11B1 mRNA (13), but this was not observed with other differentiating agents, including sodium butyrate and all-trans-retinoic acid, suggesting that agents that target the cAMP pathway might be optimal.
In conclusion, we report the construction of a suicide vector with preferential toxicity in adrenocortical cells. Using enhancer elements from the promoter region of the P450scc gene, the activity of the CYP11B1 promoter in and its specificity for adrenocortical cells were markedly enhanced. Furthermore, in stably transfected Y-1 cells, HSV-TK expression and GCV sensitivity were enhanced by treatment with 8-Br-cAMP, forskolin, and ACTH. We propose that a similar strategy using differentiating agents may be useful in the gene therapy of other tumors with unique differentiated properties, including those arising from other endocrine organs. Such an approach may help increase promoter activity and enhance specificity. Current efforts are directed at generating recombinant adenovirus containing the HSV-TK gene under the control of the CYP11B1 promoter together with the CRE and AdE elements of the P450scc gene.
Received June 24, 1999.
Revised August 23, 1999.
Accepted August 31, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-fetoprotein-producing hepatocellular
carcinoma by adenovirus-mediated transfer of cytosine deaminase gene. Cancer Res. 57:461–465.This article has been cited by other articles:
 |
|
 |
|
  L. S. Kirschner Emerging Treatment Strategies for Adrenocortical Carcinoma: A New Hope J. Clin. Endocrinol. Metab., January 1, 2006; 91(1): 14 - 21. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Mansmann, J. Lau, E. Balk, M. Rothberg, Y. Miyachi, and S. R. Bornstein The Clinically Inapparent Adrenal Mass: Update in Diagnosis and Management Endocr. Rev., April 1, 2004; 25(2): 309 - 340. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Barzon, M. Boscaro, and G. Palu Endocrine Aspects of Cancer Gene Therapy Endocr. Rev., February 1, 2004; 25(1): 1 - 44. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Alesci, W. J. Ramsey, S. R. Bornstein, G. P. Chrousos, P. J. Hornsby, S. Benvenga, F. Trimarchi, and M. Ehrhart-Bornstein Adenoviral vectors can impair adrenocortical steroidogenesis: Clinical implications for natural infections and gene therapy PNAS, May 28, 2002; 99(11): 7484 - 7489. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
) or without (
) 0.3 mmol/L 8-Br-cAMP for 2 days
before measuring luciferase activity. Activities are expressed as
relative luciferase units (RLU), with the luciferase activity of H295
and Y-1 cells transfected with TK-Luc assigned a value of 1.
Enhancement of activity is observed principally in H295 cells after
treatment with 8-Br-cAMP, with no significant effect on basal activity.
B, Effects of the P450scc enhancer elements on HSV-TK promoter activity
in other cell lines. The cell lines indicated were transfected with
either TK-Luc or SCC1958/TK-Luc, and luciferase activity was measured
after incubation in the absence or presence of 0.3 mmol/L 8-Br-cAMP. As
in A, the luciferase activities are presented in relative luciferase
units (RLU), which represent the relative luciferase activity compared
to that in cells transfected with the control TK-Luc plasmid for each
cell line. The results demonstrate enhancement of luciferase activity
after 8-Br-cAMP in H295 adrenal cells, but not in other cell lines. In
all experiments, luciferase activities from triplicate transfections
were measured and adjusted to the protein concentrations. The
bars in each column represent SDs.
, Y-1–4; •,
Y-1–14; 
, Y-1–19; 
, Y-1–32. B—F, Sensitivity to GCV of
untreated or pretreated Y-1 cells and the stably transfected clones.
Untreated cells (•) or cells pretreated with 1 µmol/L ACTH (
) for 48
h were plated onto 96-well plates at 6000 cells/well. The
3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide assay
was performed after 5-day incubation in GCV. The points
represent the means of triplicate determinations, and
bars are the SDs. The results demonstrate
that all stably transfected clones have enhanced sensitivity to GCV,
and this sensitivity can be modulated by 8-Br-cAMP, forskolin, and ACTH
in the two SCC/11ß-TK clones (Y-1–4 and Y-1–19) in which modulation
of HSV-TK protein levels could be demonstrated (see Fig. 6