| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Universitätsklinik für Kinder und Jugendliche (J.D., K.-D.N., I.K., R.R., W.R.), 91054 Erlangen; and Universitätsfrauenklinik Giessen (M.K.), 35385 Giessen, Germany
Address all correspondence and requests for reprints to: Jörg Dötsch, M.D., Klinik für Kinder und Jugendliche, Friedrich-Alexander-University Erlangen-Nürnberg, Loschgestrasse 15, 91054 Erlangen, Germany. E-mail: joergwdoetsch{at}yahoo.com
 |
Abstract |
|---|
 Top Abstract IntroductionSubjects and MethodsReferences |
|---|
Placental tissue was obtained from 17 premature deliveries, 18 term deliveries, and 10 mothers with preeclampsia. Gene expression of leptin, NPY, and two housekeeping genes (ß-actin and glyceraldehyde-3-phosphate dehydrogenase was quantified using real-time PCR.
The leptin/ß-actin mRNA ratio was significantly higher in specimens of patients with preeclampsia than in those of gestational age-matched controls (0.63 ± 0.23 vs. 0.09 ± 0.04 relative U (RU); P = 0.03). NPY/ß-actin mRNA was significantly reduced in the preeclampsia group (0.003 ± 0.001 vs. 0.026 ± 0.008 RU in controls; P = 0.01). The NPY/leptin ratio was 0.11 ± 0.09 for preeclamptic placenta samples and 1.7 ± 0.6 RU for the controls (P = 0.02). The leptin/ß-actin ratio was significantly lower in placenta from premature deliveries than in term deliveries (0.02 ± 0.004 vs. 0.12 ± 0.05 RU; P = 0.01). Similar results were obtained for normalization to glyceraldehyde-3-phosphate dehydrogenase mRNA.
Our data suggest an increase of placental leptin production with gestational age. In patients with preeclampsia, elevated leptin expression goes along with suppressed NPY expression. This resembles hypothalamic regulation.
|
Introduction |
|---|
|
TopAbstractIntroductionSubjects and MethodsReferences |
|---|
In the hypothalamus of mice, leptin suppresses the expression of neuropeptide Y (NPY) that is well known to raise food intake in these animals (6). In humans, however, there is no clear evidence that leptin interacts with NPY secretion. In the cerebrospinal fluid of adipose and lean subjects, no relation between leptin and NPY levels is found. This may either be attributed to a lack of interaction between leptin and NPY in man or a mechanism that is restricted to limited portions of the brain and does not influence concentrations in the cerebrospinal fluid (7).
The objective of the present study was to examine the relation of leptin and NPY expression in placental tissue from patients with preeclampsia, in comparison with controls. A second goal was to investigate whether the placental expression of leptin and NPY shows a maturation with the progression of pregnancy.
|
Subjects and Methods |
|---|
|
TopAbstractIntroductionSubjects and MethodsReferences |
|---|
Placental tissue was obtained in collaboration with the
Department of Gynecology and Obstetrics at the University of Giessen.
The study was approved by the ethics committee of the University of
Giessen. Placental tissue was obtained at the time of vaginal delivery
or cesarean section from three different parts of the placenta after
removal of the amnionic membrane and maternal decidua. Placental tissue
from 18 healthy women with normal pregnancy (age, 24–36 yr; at 37–42
weeks of gestation) was compared with placenta from 17 patients giving
birth to premature infants after premature labor (27–33 weeks of
gestation; age, 15–41 yr) and to tissue from 11 patients with
preeclampsia (age, 22–37; at 27–41 weeks of gestation). Preeclampsia
was diagnosed according to international criteria (8). Because of the
limited number of patients, no distinction between mild and severe
preeclampsia was made. Patient characteristics are shown in Table 1
.
|
RNA was extracted using a commercial kit (RNAzol-B isolation kit, WAK-Chemie Medical GmbH, Bad Homburg, Germany). To monitor gene expression, we used quantitative real-time RT-PCR analysis. This novel approach makes use of the 5' exonuclease activity of the DNA polymerase (AmpliTaq Gold). Briefly, within the amplicon defined by a gene-specific PCR primer pair, a oligonucleotide probe, labeled with two fluorescent dyes, is created (designated as TaqMan probe). As long as the probe is intact, the emission of the reporter dye (i.e. 6-carboxyfluorescein, FAM) at the 5'-end is quenched by the second fluorescence dye (6-carboxytetramethylrhodamine, TAMRA) at the 3'-end. During the extension phase of a PCR, the polymerase cleaves the TaqMan probe, resulting in a release of reporter dye. The increasing amount of reporter dye emission is detected by an automated sequence detector combined with a special software (ABI Prism 7700 Sequence Detection System, Perkin-Elmer Corp., Foster City, CA). The algorithm normalizes the reporter signal to a passive reference. Next, the algorithm multiplies the SD of the background reporter signal in the first few cycles (in most PCR systems, cycles 3–15, respectively) by a default factor of 10, to determine a threshold. The cycle at which this baseline level is exceeded is defined as threshold cycle (CT). CT depends on the initial template copy number and on the efficiency of both the DNA amplification and the cleavage of the TaqMan probe. The CT values of the samples are interpolated to an external reference curve constructed by plotting the relative or absolute amounts of a serial dilution of a known template vs. the corresponding CT values.
Commercial reagents (TaqMan PCR Reagent Kit, Perkin-Elmer Corp.) and conditions were applied according to the manufacturer’s protocol. A total of 2.5 µL of complementary DNA (reverse transcription mixture) and oligonucleotides at a final concentration of 300 nmol/L of primers and 200 nmol/L of TaqMan hybridization probe were analyzed in a 25-µL vol. The oligonucleotides of each target of interest were designed by the Primer Express software (Perkin-Elmer Corp.) using uniform selection parameters that allow the application of standard cycle conditions.
Leptin and NPY gene expression was related to the housekeeping genes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and ß-actin. In addition, for NPY, the neuronal marker protein gene product 9.5 (PGP9.5) was used to normalize messenger RNA (mRNA) concentration.
The following primers and TaqMan probes were used:
GAPDH. Forward, 5‘-CCCATGTTCGTCATGGGTGT-3‘; reverse, 5‘-TGGTCATGAGTCCTTCCACGATA-3‘; TaqMan probe, 5‘(FAM)-CTGCACCA-CCAACTGCTTAGCACCC-(TAMRA)3‘.
ß-actin. Forward, 5‘-GCGAGAAGATGACCCAGGATC-3‘; reverse, 5‘-CC-AGTGGTACGGCCAGAGG-3‘; TaqMan probe, 5‘(FAM)-CCAGCCATGTACGTTGCTATCCAGGC-(TAMRA)3‘.
PGP9.5. Forward, 5‘-ACTGGGATTTGAGGATGGATCAG-3‘; reverse, 5‘-GCCTTCCTGTGCCACGG-3‘; TaqMan probe, 5‘(FAM)-AATGAGGCCA- TACAGGCAGCCCATG-(TAMRA)3‘.
NPY. Forward, 5‘-TGCCCAGACCCTTATTCGG-3‘; reverse, 5‘-CCGGAGGCCCTGGAAGT-3‘; TaqMan probe, 5‘(FAM)-AGT-CAAGCGCTA CCG CCAGAGCA-(TAMRA)3‘.
Leptin. Forward, 5‘-GTGCGGATTCTTGTGGCTTT-3‘; reverse, 5‘-GGAATGAAGTCCAAACCGGTG-3‘; TaqMan probe, 5‘(FAM)-CAATGACATTT- CACACACGTCAGTCTCCTCCAA(TAMRA)3‘.
The thermocycler parameters were 50 C for 2 min (for carry-over prevention with Uracil-N-glycosylase), 95 C for 10 min (for hot start PCR), followed by 40 cycles of 95 C for 15 sec and 60 C for 1 min.
Statistical analysis All values are expressed as mean ± SEM. Values were compared using Student’s t test for parametric data. A P value of less than 0.05 was considered significant.
Results
The placental tissue of patients with preeclampsia showed a
significantly higher leptin mRNA expression than the gestational
age-matched controls, irrespective of the housekeeping gene (Table 2a). In contrast, NPY
mRNA content in the placental tissue of mothers with preeclampsia was
significantly lower than in the controls (Table 2a). The NPY/leptin
mRNA ratio was 15- to 20-fold lower in the preeclampsia group than in
the control group (Fig. 1).
|
|
). This difference was prevalent,
irrespective of the housekeeping gene used for the normalization of
leptin mRNA (Table 2b). There was no difference in NPY gene expression
between placental tissue from women delivering term and premature
neonates (Table 2b). However, higher NPY gene expression levels were
only reached in the advanced stages of gestation (Fig. 3).
|
|
|
No relation was seen between maternal systolic and diastolic blood pressure in the preeclampsia group and the placental leptin/ß-actin mRNA expression (r2 = 0.005, P = 0.83; and r2 = 0.004, P = 0.85, respectively). Similar results were seen for normalization to GAPDH gene expression.
Discussion
The present study elicits a reduced NPY mRNA content in human placental tissue of patients with preeclampsia, whereas leptin gene expression is augmented. These results may indicate a paracrine suppressive effect of leptin on NPY expression in human placenta. This observation shows similarities to the regulation of NPY mRNA expression in the hypothalamus of mice (6). In both tissues, high leptin expression is associated with low NPY expression. It is of interest that hypoxia increases leptin production in human choriocarcinoma cells (4). Consequently, hypoxia might decrease NPY production in placenta via an increase of leptin. Because NPY is a potent vasoconstrictor via the NPY Y1 receptor (7), it may be speculated that the leptin-NPY mechanism counteracts the vasoconstriction associated with preeclamptic changes in the placenta. Alternatively, NPY may induce trophic changes in placental tissue via the NPY Y1 or NPY Y5 receptor (9, 10). It seems rather unlikely, however, that placental NPY production affects the NPY concentrations in the fetal or maternal circulation. Results from our group suggest that the increasing umbilical cord NPY plasma concentrations immediately after spontaneous delivery are caused by an increase in the NPY release from neonatal tissue. NPY plasma concentrations in the mothers do not change during pregnancy, making a substantial placental contribution to maternal NPY levels improbable (11).
We have no evidence that the placental leptin expression is associated with placental or neonatal weight. Consequently, as results from our group suggest, the relation between birth weight and serum leptin levels in umbilical cord blood (12) seems to be attributable to neonatal leptin production rather than to a placental derivation of the protein (13). These observations underline the concept of paracrine leptin effects in the placenta.
The comparison of leptin expression in placental tissue of premature and term deliveries suggests an effect of gestational age on the maturation of placental leptin production during ontogeny. This may suggest that leptin production in the placenta becomes more important during the last trimester of gestation. Alternatively, the increasing leptin mRNA might be a consequence of the declining placental perfusion and a subsequent increase in hypoxic compartments of the organ (4). Cell culture studies with placental trophoblast cells will have to show the exact pathomechanism of leptin action on the NPY mRNA expression in human placenta. These studies may also help to elucidated the signal transduction pathways that are involved in the interaction of these two systems.
There is a lack of change of placental NPY mRNA expression during gestational maturation. This might be caused by an immaturity of the leptin action on NPY gene expression, for instance, as a consequence of underdeveloped leptin receptor function. However, there is a certain tendency to higher NPY expression in the later stages of gestation, suggesting that only the mature placenta is able to produce greater amounts of NPY mRNA.
In summary, our data suggest that the possible role of placental leptin becomes most important towards the end of gestation. One mechanism of leptin action in the placenta may be the suppression of NPY. In this respect, it resembles hypothalamic regulation.
|
Acknowledgments |
|---|
Received December 31, 1998.
Revised April 20, 1999.
Accepted May 3, 1999.
|
References |
|---|
|
TopAbstractIntroductionSubjects and MethodsReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  U. Meissner, R. Spranger, M. Lehner, I. Allabauer, W. Rascher, and J. Dotsch Hypoxia-induced leptin production in human trophoblasts does not protect from apoptosis Eur. J. Endocrinol., September 1, 2005; 153(3): 455 - 461. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. von der Hardt, M.A. Kandler, M. Chada, A. Cubra, E. Schoof, K. Amann, W. Rascher, and J. Dotsch Brief adrenomedullin inhalation leads to sustained reduction of pulmonary artery pressure Eur. Respir. J., October 1, 2004; 24(4): 615 - 623. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Schroth, J. Kratzsch, M. Groschl, M. Rauh, W. Rascher, and J. Dotsch Increased Soluble Leptin Receptor in Children with Nephrotic Syndrome J. Clin. Endocrinol. Metab., November 1, 2003; 88(11): 5497 - 5501. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Pighetti, G. A. Tommaselli, A. D'Elia, C. Di Carlo, A. Mariano, A. Di Carlo, and C. Nappi Maternal Serum and Umbilical Cord Blood Leptin Concentrations With Fetal Growth Restriction Obstet. Gynecol., September 1, 2003; 102(3): 535 - 543. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Kandler, K. von der Hardt, S. Mahfoud, M. Chada, E. Schoof, T. Papadopoulos, W. Rascher, and J. Dotsch Pilot Intervention: Aerosolized Adrenomedullin Reduces Pulmonary Hypertension J. Pharmacol. Exp. Ther., September 1, 2003; 306(3): 1021 - 1026. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Zhao, T. H. Kunz, N. Tumba, L. Clamon Schulz, C. Li, M. Reeves, and E. P. Widmaier Comparative analysis of expression and secretion of placental leptin in mammals Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2003; 285(2): R438 - R446. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. von der Hardt, M. A. Kandler, L. Fink, E. Schoof, J. Dotsch, R. M. Bohle, and W. Rascher Laser-assisted microdissection and real-time PCR detect anti-inflammatory effect of perfluorocarbon Am J Physiol Lung Cell Mol Physiol, July 1, 2003; 285(1): L55 - L62. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Cameo, P. Bischof, and J. C. Calvo Effect of Leptin on Progesterone, Human Chorionic Gonadotropin, and Interleukin-6 Secretion by Human Term Trophoblast Cells in Culture Biol Reprod, February 1, 2003; 68(2): 472 - 477. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Cavadas, A. P. Silva, F. Mosimann, M. D. Cotrim, C. A. F. Ribeiro, H. R. Brunner, and E. Grouzmann NPY Regulates Catecholamine Secretion from Human Adrenal Chromaffin Cells J. Clin. Endocrinol. Metab., December 1, 2001; 86(12): 5956 - 5963. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Groschl, M. Rauh, R. Wagner, W. Neuhuber, M. Metzler, G. Tamguney, J. Zenk, E. Schoof, H. G. Dorr, W. F. Blum, et al. Identification of Leptin in Human Saliva J. Clin. Endocrinol. Metab., November 1, 2001; 86(11): 5234 - 5239. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Schoof, M. Girstl, W. Frobenius, M. Kirschbaum, H. G. Dörr, W. Rascher, and J. Dötsch Decreased Gene Expression of 11{beta}-Hydroxysteroid Dehydrogenase Type 2 and 15-Hydroxyprostaglandin Dehydrogenase in Human Placenta of Patients with Preeclampsia J. Clin. Endocrinol. Metab., March 1, 2001; 86(3): 1313 - 1317. [Abstract] [Full Text]
|
|
|
|
|
|
M. C. Henson and V. D. Castracane Leptin in Pregnancy Biol Reprod, November 1, 2000; 63(5): 1219 - 1228. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
