| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
From the Clinical Research Centers |
Departments of Surgery (M.S.-M., S.E.W., D.N.H., R.R.W., A.A.F.), Anesthesiology (R.R.W.), and Internal Medicine (R.J.U., J.J.), University of Texas Medical Branch, and Shriners Burn Hospital for Children (D.N.H., R.R.W.), Galveston, Texas 77550; and the Department of Molecular and Medical Pharmacology, University of California, Olympic Analytical Laboratory (D.H.C.), Los Angeles, California 90025
Address all correspondence and requests for reprints to: Melinda Sheffield-Moore, Ph.D., Metabolism Unit, Shriners Burns Institute, 815 Market Street, Galveston, Texas 77550. E-mail: melmoore{at}utmb.edu
 |
Abstract |
|---|
 Top Abstract IntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
We recently showed that T enanthate (TE), administered im to healthy young men, increased net protein synthesis and reutilization of intracellular amino acids in skeletal muscle (7). In addition, several other studies have found T administration to increase muscle protein synthesis (1, 5, 8), although these studies failed to measure protein breakdown. One of the major limitations of previous studies of fractional synthetic rate (FSR) is that no estimation of protein breakdown could be made simultaneously. Consequently, the traditional approach to the study of muscle protein kinetics (i.e. FSR) provided no information on the net balance between synthesis and breakdown. Therefore, our laboratory developed a new method for measuring fractional protein breakdown that is independent of the arterio-venous (A-V) model (9).
Although natural androgens such as T clearly stimulate muscle protein synthesis, they also possess androgenic or virilizing effects. Often this limits the clinician’s use of these androgens to specific patient populations such as hypogonadal men. However, efforts have been made to find alternative anabolic agents that can be used in women and children suffering from muscle-wasting diseases or trauma. Oxandrolone [Oxandrin (OX) Bio-Technology General, Iselin, NJ], a synthetic analog of T, is an oral anabolic steroid currently used as an adjunctive therapy to promote weight gain in patients after surgery, chronic infections, and severe trauma. OX improved weight gain in patients experiencing AIDS-wasting myopathy (10) as well as in convalescing burn patients (30–50% total body surface area burns) (11). In addition, OX is used by clinicians to treat children with growth disorders such as Turner’s syndrome and constitutional delay of growth and puberty (12, 13). A recent pilot study in boys with Duchenne muscular dystrophy found that OX, given at a dose of 0.1 mg/kg·day, improved muscle strength over a 3-month period (14). Given that OX is administered orally, as opposed to im as with TE, its ease of administration makes it attractive to clinicians and patients alike. Further, OX is purported to have a much greater anabolic potential than T, with fewer of the androgenic effects. However, no studies have demonstrated whether OX, similar to TE, promotes the stimulation of protein synthesis in skeletal muscle.
Hence, we investigated whether OX, a purported anabolic agent, improves net muscle protein synthesis and transport of amino acids in fasted young men. The present study was designed to mimic the 5-day TE study in normal males previously discussed (7). We sought to evaluate the short term (5-day) effects a moderate dose (15 mg/day) of OX on the incorporation of amino acids into muscle proteins using an established protein kinetic model (15, 16). We further examined the effect of OX on the messenger ribonucleic acid (mRNA) concentrations of skeletal muscle insulin-like growth factor I (IGF-I) and androgen receptors (AR).
|
Subjects and Methods |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Six healthy men [age, 22 ± 3 (±SD) yr; weight, 77 ± 13 kg; height, 178 ± 7 cm] were studied before and after taking a daily dose of oral OX (15 mg/day) for 5 days. All subjects gave informed written consent according to the guidelines established by the institutional review board at the University of Texas Medical Branch (Galveston, TX). Subject eligibility was assessed by performing a medical screening, which included an electrocardiogram, blood count, plasma electrolytes, blood glucose concentration, and liver and renal function tests. Subjects presenting with heart or liver disease, hypo- or hypercoagulation disorders, vascular diseases, hypertension, diabetes, or an allergy to iodides were excluded from participation.
Experimental protocol
All isotope infusion studies were performed at the General Clinical Research Center at the University of Texas Medical Branch. Subjects were admitted the night before each study and were fasted from 2200 h until completion of the 5-h isotope infusion study. At approximately 0630 h the following morning (day 0), a 20-gauge polyethylene catheter (Insyte-W, Becton Dickinson and Co., Sandy, UT) was inserted into the antecubital vein of one arm for the infusion of amino acids. A second 20-gauge polyethylene catheter was placed in the contralateral wrist for blood sampling for measurement of systemic indocyanine green (ICG). A heating pad was placed around the arm and wrist to maintain a temperature of about 65 C during blood flow measurements.
At 0700 h on days 0 and 5, baseline blood samples were drawn for the analysis of background amino acid enrichment, ICG concentration, and peak T and OX concentrations. A primed continuous infusion of labeled phenylalanine was initiated at the following infusion rate (IR) and priming dose (PD): L-[ring-2H5]phenylalanine, IR = 0.05 µmol/kg·min, PD = 2 µmol/kg. At approximately 0730 h, a 3-Fr 8-cm polyethylene Cook catheter (Bloomington, IN) was placed under local anesthesia into the femoral artery and vein. Femoral catheters were required for A-V blood sampling and infusion of ICG (artery) for determination of leg blood flow.
Biopsies of the vastus lateralis were obtained at 2 h, 4 h 30
min, and 5 h of tracer infusion using a 5-mm Bergström
needle as previously described (16). Tissue was immediately frozen in
liquid nitrogen and stored at -80 C until analysis. After the 2-h
biopsy, a primed (2 µmol/kg) continuous infusion of
L-[15N]phenylalanine was initiated and
maintained until 4 h (Fig. 1
).
Arterial and intracellular
L-[15N]phenylalanine enrichments at plateau
and again after decay were obtained for purposes of determining the
fractional breakdown rate (FBR). The 4 h 30 min and 5 h
biopsies were used to determine FBR. The fractional synthetic rate
(FSR) of skeletal muscle protein was determined by the incorporation of
L-[ring-2H5]phenylalanine into
protein from 2–5 h.
|
At the end of the 5-h infusion study, subjects were fed, and all peripheral and femoral catheters were removed. Beginning at 2100 h on day 0, all subjects were given 15 mg OX (BTG Pharmaceuticals Co., Iselin, NJ), orally, for 5 days. On day 3, subjects returned to the General Clinical Research Center at 0700 h for venous blood sampling to determine total T and OX concentrations. On day 5, the above experimental protocol was repeated.
Analytical methods
Blood. The concentrations of unlabeled and labeled
phenylalanine were determined by gas chromatography-mass spectrometry
(GC-MS) as previously described (16). Briefly, A-V blood samples were
collected in preweighed tubes containing 15% sulfosalicylic acid. A
known internal standard (100 µL/mL blood) was added and thoroughly
mixed. The composition of this standard mixture was 50.3 µmol/L
L-[ring-13C6]phenylalanine. After
reweighing the tubes to determine the final blood volume, tubes were
centrifuged, and the supernatant was collected and stored at -20 C
until analysis. Blood amino acids were separated using cation exchange
chromatography (16) and enrichments of the internal standard, and
infused tracers were determined on their
tert-butyldimethylsilyl (t-BDMS)
derivatives (17). Using the GC-MS, the isotopic enrichment of free
amino acids in blood was determined by positive chemical ionization and
selected ion monitoring (model 5973, Hewlett-Packard Co.,
Palo Alto, CA). Finally, leg blood flow was determined
spectrophotometrically by measuring serum ICG concentration at 
= 805 nm.
Muscle. Muscle samples were weighed, and protein was precipitated with 500 µL 14% perchloric acid. A known internal standard solution (2 µL/mg muscle tissue) was added to measure the intracellular concentrations of phenylalanine. The solution contained 2.4 µmol/L L-[ring-13C6]phenylalanine. The supernatant was collected after homogenization of the tissue and centrifugation. This procedure was repeated three times. The pooled supernatant with muscle amino acids was separated using cation exchange chromatography (16). Intracellular amino acid enrichments and concentrations were determined on their tert-butyl-methylsilyl derivatives (17) using GC-MS in the electron impact mode. Intracellular enrichment was determined by correction for extracellular fluid based on the chloride method (18). The remaining pellet was washed several times with 0.9% saline and again with absolute ethanol, dried at 50 C overnight, and hydrolyzed in 6 N HCl at 110 C for 24 h. The hydrolysate was then passed over a cation exchange column in the same manner as the blood was processed. Samples were analyzed for phenylalanine enrichment by GC-MS (model 8000, MD 800, Fisons Instruments, Manchester, UK) using chemical ionization and the standard curve approach (19).
Hormone assays. The concentration of total T was measured in serum with a commercial RIA kit (Diagnostic Products, Los Angeles, CA). Free or bioavailable T was measured by equilibrium dialysis [Mayo Medical Laboratories (Rochester, MN), Quest Diagnostics, Inc., Nichols Institute (San Juan Capistrano, CA)]. Serum OX concentrations were measured by University of California-Los Angeles Olympic Analytical Laboratory. Briefly, a liquid-liquid extraction was performed by adding 50 µL internal standard [16,16,17-3H]T (d3T; 12 µg/mL; MSD Isotopes, Montreal, Que.), 1 mL 50% saturated sodium acetate buffer (0.5 mol/L; pH 5.5), and ethyl ether (5 mL) to 0.5 mL plasma. After vortexing (10 min) and centrifugation (15 min at 2000 rpm), the ethyl ether layer was dried under nitrogen at room temperature and reconstituted in 200 µL methanol for high performance liquid chromatography analysis. Liquid chromatography was performed on a Shimadzu system (Shimadzu, Columbia, MD) equipped with a Hypersil BDS C18, 50 x 2-mm column (Keystone Scientific, Inc., Bellefonte, PA) and Hypersil BDS C18, 20 x 2-mm precolumn, operated at a flow rate of 400 µL/min. The injection volume was 5 µL. The gradient was methanol-water (1:1) for 1 min, methanol-water (9:1) for the next 1 min, a 1-min hold, and a return to the starting condition in 0.5 min. MS analyses were performed on a triple quadrupole Perkin Elmer Corp.-Sciex API 300 (Norwalk, CT) equipped with an APCI interface. The nebulizer temperature was optimized for maximum sensitivity at 350 C. Positive ions (m+1) for OX (307.2; Searle Pharmaceutical, Chicago, IL) and d3T (292.2) were admitted into the second quadrupole for collision-induced dissociation. Product ions 289.2 and 97.0 were monitored and used to quantitate OX and d3T, respectively. Concentrations were determined by reference to a six-point calibration curve.
Total RNA isolation and qualitative RT-PCR. Total RNA was isolated from muscle biopsy samples (50–75 mg) using RNAzol B (Tel-Test, Inc., Friendswood, TX). Two micrograms of total RNA were then converted to DNA using a Reverse Transcription System (Promega Corp., Madison, WI). The DNA (5 µL) was then subjected to PCR in the presence of the appropriate primers. The products of the PCR were run on Southern gel, and amplified DNA products were sized by DNA ladder. Southern blots were then made and hybridized to oligonucleotides of the DNA fragment. Glyceraldehyde phosphate dehydrogenase (GAP) was coamplified in each sample as an internal control. For the AR, the downstream primer was included in the reverse transcriptase reaction. The primers and hybridization oligonucleotides for the IGF-I and AR are as follows: IGF-I: sense, 5'-AAATCAGCAGTCTTGGAACC-3'; antisense, 5' CTTCTGGGTCTTGGGCATGT 3'; oligonucleotide, 5'-CAAGCCCACAG-GGTATGGCTCCAGCAGT-3'; AR: sense, 5'-GATGCTCTACTTCGCCCCTGA-3'; antisense, 5'-CCCAGCAAATAGAATTCCATGAC-3'; oligonucleotide, 5'-CTGGGTGTGGAAATAGATG-3'; and GAP: sense, 5'-GGTATCGTGGAAGGACTCAT-3'; antisense, 5'-TCCACCACCCTGT-TGCTGTA-3'; oligonucleotide, 5'-GTGGGTGTCGCTGTTGAAGT-3'.
Southern blot band densities were measured using the ImageQuant analysis program (Molecular Dynamics, Inc., Sunnyvale, CA).
Calculations
Kinetic model. The kinetics of intracellular free amino
acids have been described previously (16). However, we will briefly
detail the kinetic parameters that make up the three-pool model of leg
amino acid kinetics (Fig. 2).
|
 |
 |
 |
 |
 |
 |
 |
 |
 |
Protein synthesis efficiency (PSE). Using phenylalanine, we
calculated the relative efficiency of protein synthesis as follows:
 |
FSR. Using the traditional precursor-product method, we
determined the FSR of muscle proteins by measuring the rate of
phenylalanine tracer incorporation into protein and the enrichment of
the intracellular pool as the precursor
 |
FBR. We will briefly discuss the new method for measuring fractional protein breakdown, which has been derived and described in detail previously (9). Further, the FBR method has recently been validated in a report from this laboratory (20). This method employs a variation of the traditional precursor-product method for determining FSR. In this case, the product is free intracellular amino acids, and the precursors are arterial blood and tissue protein.
The FBR technique involves stopping enrichment after reaching an
isotopic equilibrium of L-[15N]phenylalanine
and determining the rate of decay of the intracellular amino acid
enrichment. The rate of decay of the free intracellular enrichment is
determined by the arterial decay (which continues to provide a certain
amount of label to the intracellular pool as well as unlabeled amino
acids) and the FBR (which provides the rest of the unlabeled amino
acids). Because FBR is constant at physiological steady state, and the
decay curves in the arterial and intracellular pools are measurable,
FBR is measurable. The following equation is used for the calculation
of FBR:
 |
Without the variables P and T/QF in the above equation, the equation is simply the traditional precursor-product equation. The traditional precursor-product equation assumes that the product is only derived from one precursor. However, when determining FBR, the product has two sources, plasma amino acids and protein-bound amino acids. These two sources are therefore represented by the variable P. P is equal to the ratio of protein breakdown to transport of amino acids into the cell and is calculated by determining the dilution of amino acid enrichment between plasma and the intracellular space at isotopic steady state.
The factor T/QF is necessary to make the units of FBR comparable to those of FSR, such that the units of FBR are rate of protein breakdown divided by the bound amino acid pool size. The traditional precursor-product equation calculates the rate of conversion of precursor to product divided by the product pool size. However, with FBR, the rate of protein breakdown is divided by the free intracellular amino acid pool size. Finally, in this FBR model, as well as in the kinetic determination of the rate of appearance from protein breakdown (FM,O) and disappearance to protein synthesis (FO,M), an assumption must be made that the label is not recycled from protein breakdown back to the free intracellular pool. This is reasonable, given the low enrichment of the muscle pool, compared to the free intracellular enrichment at isotopic equilibrium. This leaves arterial blood as the only source of tracer for the free intracellular pool. In contrast, unlabeled amino acids from both arterial blood and protein breakdown contribute to the free intracellular pool.
Statistical analysis. Comparisons between basal and
treatment conditions were performed using paired t tests.
Statistical significance was established at P 
0.05.
Data are presented as the mean ± SE.
|
Results |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
, arterial
steady state was achieved during the sampling hour (240–300 min) of
both the control period and after 5 days of OX administration. However,
arterial enrichments were significantly higher after OX treatment
(Table 1; P < 0.05). Due to noncompliance with
medications by one subject, all data presented include only the results
from five subjects.
|
). Serum free T concentrations were
within normal physiological range on days 0, 3, and 5. However, by day
5, serum free T concentrations were significantly reduced (98 ±
10 pg/mL; P < 0.001) below day 0 (121 ± 12
pg/mL) and day 3 (126 ± 9 pg/mL) values. Hence, the total
androgen concentration (T + OX) was reduced in parallel to the
reduction in T (Fig. 3).
|
; P < 0.05), whereas
FBR remained unchanged (0.138 ± 0.005% vs.
0.118 ± 0.0008%/h; P =
0.40). Whole body appearance of
phenylalanine decreased from 0.80 ± 0.03 to 0.75 ± 0.03
µmol/kg·min after OX treatment (P < 0.05).
|
. OX treatment had no effect on amino acid
delivery to (Fin) or the release of labeled phenylalanine
from the leg (Fout). Moreover, the inward transport rate
(FM,A) of phenylalanine remained unchanged. However, 5 days
of OX administration resulted in a significant reduction in the rate of
outward transport of phenylalanine (FV,M; P
< 0.05). The intracellular rate of appearance of phenylalanine
(FM,O), an index of proteolysis, did not change after OX
administration (Table 2). However, consistent with the direct
incorporation data, the rate of intracellular utilization of
phenylalanine for protein synthesis (FO,M) increased
significantly after OX treatment (Table 2; P < 0.05).
As a result of the increase in FO,M and the lack of change
in FM,O, net balance (NB) shifted from a net negative
output (-30 ± 6) during the fasted control period to an
approximate zero balance (-1 ± 4) during an overnight fast after
5 days of OX (Table 2; P < 0.05). Protein synthesis
efficiency increased significantly from control to OX periods (24
± 0.03% vs. 39 ± 0.07%; P < 0.05).
Finally, OX had no effect on leg blood flow.
|
shows a representative autoradiogram of
a Southern blot hybridization for skeletal muscle AR and a graph of the
densitometry data from all five subjects. IGF-I mRNA concentrations
were not significantly increased after 5 days of OX treatment (control,
2.3 ± 0.6; OX, 3.1 ± 0.5). GAP concentration did not
change. The data are presented as a ratio of the AR band density over
the GAP band density.
|
|
Discussion |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
A recent study from our laboratory (7) demonstrated that 5 days after a single im injection of TE (200 mg), FSR and model-derived protein synthesis increased 2-fold, with no change in FBR. Further, in agreement with the present findings, Ferrando et al. (7) demonstrated an increased utilization of intracellular amino acids by showing a strong relationship between protein breakdown and protein synthesis. Although our kinetic data strongly support these findings, the magnitude of the synthetic response with OX was not as great as that with TE. With OX, we found 44% and 28% increases in FSR and model-derived protein synthesis (FO,M), respectively. Several important factors may account for these differences.
In our previous study, the total T concentration increased to twice the physiological norm 2 days after TE injection (2094 ± 561 ng/dL). Further, T was still in the upper physiological range (953 ± 283 ng/dL) by day 5 and was statistically different from preinjection T concentration (425 ± 99 ng/dL) (7). In contrast, the magnitude of response we found in serum OX concentration was much less than that reported with TE. For example, total serum OX, as measured in the morning 10 h after oral ingestion, was consistent on days 3 and 5, whereas total serum and free T concentrations declined significantly from days 0 and 3 to day 5. Viewed in combination, total serum androgen levels with OX treatment were far below those obtained with TE. Although the total androgen exposure to the skeletal muscle with OX may have been considerably less than that we found previously with TE, an increase in protein synthesis was nonetheless observed. This suggests that OX may exert a greater anabolic influence on skeletal muscle than TE, thereby overcoming the decrease in the T concentration.
Further evidence indicates that the method of administration and metabolism of the anabolic agent may account for the magnitude of difference in protein synthesis with OX compared to TE. For example, im TE injections are administered in a lipid base such that they can be stored in adipose tissue and released slowly, giving a sustained duration of action. After im injection of 200 mg TE, serum T levels rise and can reach the supraphysiological range within 24 h of administration. Over a period of several weeks, these levels gradually decline to hypogonadal levels (21). In the present study, serum OX levels on day 5 were 2.19 ng/dL 10 h after oral administration. However, by 18 h, serum OX levels fell to 0.48 ng/dL, representing a 78% reduction in serum OX in only 8 h. Because of this rapid decline in OX blood levels, it may be warranted to administer OX twice a day to maintain higher sustained blood levels of total androgen, possibly further enhancing its anabolic effect on skeletal muscle.
Moreover, OX’s potent protein synthetic response was sufficient to ameliorate the net amino acid efflux and protein catabolism associated with an overnight fast. Given that most trauma and burn patients are acutely hypercatabolic, and most cancer and AIDS patients are chronically catabolic, the ability to reverse the inevitable losses in lean body mass using an oral anabolic agent has considerable clinical implications. However, the timeframe needed for protein accretion to occur in these patient groups is not known. At a minimum, efficient reutilization of intracellular amino acids is necessary for continued maintenance of the metabolic state (7, 22). We know that during the fasted state, protein breakdown is normally much higher than protein synthesis (16, 22). Despite being fasted overnight, all subjects had an increased reutilization of amino acids as outward transport (FV,M) decreased 28% after OX treatment. We further showed a 65% increase in the efficiency of protein synthesis with OX. In combination, this could lead to an accrual of lean body mass in the fed state.
Androgens induce their specific response via the AR, which, in turn, regulates the transcription of androgen-responsive target genes. Although we know that accumulation of DNA is essential for muscle growth, the mechanisms of androgen-induced DNA accretion in skeletal muscle are unclear. AR (23) and AR mRNA (24) have been detected in human skeletal muscle. However, to date there are no human studies that have examined the response of skeletal muscle ARs to androgen exposure. Moreover, it has been suggested that prior cellular exposure to androgens may somehow prime these cells for the action of secondary agents such as IGF-I. Therefore, a secondary objective of this study was to examine the effect of OX administration on mRNA concentrations of IGF-I and ARs.
A recent study in exercising rats indicates that the accretion of skeletal muscle may be dependent on an increased number of ARs (25). Inoue et al. (25) examined the physiological importance of the increase in ARs on exercise-induced muscle hypertrophy. They determined that the androgen pathway had a significant effect on exercise-induced muscle hypertrophy and found the hypertrophy to be associated with an increased number of ARs in the exercised muscle (25). Moreover, a study conducted by Doumit et al. (26) found that pretreatment of porcine satellite cells with T for 24 h up-regulated AR, but did not alter the responsiveness of these cells to IGF-I or other growth factors. Similarly, we found an increased expression of AR mRNA with no change in im IGF-I mRNA concentrations after a short term administration of OX. These data along with our findings of increased mRNA concentrations of ARs with short term exposure to OX lend support to the contention that ARs may regulate, either directly or indirectly, the accumulation of DNA required for muscle growth.
More recent evidence lends support to the complementary roles of androgens, ARs, and IGF-I. Urban et al. (5) found increased mRNA concentrations of IGF-I in skeletal muscle of elderly men given 4 weeks of replacement doses of TE. Further, by inducing severe androgen deficiency in young men for 10 weeks, Mauras et al. (27) showed marked decreases in mRNA concentrations of IGF-I and suggested that within skeletal muscle tissue, androgens are necessary for local IGF-I production, independent of GH production and systemic IGF-I concentrations. In addition, new data from this study of androgen-deficient men indicate that ARs are significantly decreased in response to severe hypogonadism (28). Although there is no direct evidence that OX binds to the ARs, the findings of the present study and those reported by Hayes et al. (28) suggest that androgens may work directly through the androgen receptor to exert their effects on protein metabolism. Nevertheless, we do not know from the present study the physiological importance of the increased expression of mRNA for AR.
In summary, this study demonstrates that OX, administered once a day at a moderate dose (15 mg/day), promotes net muscle protein synthesis. Moreover, these data suggest that OX induced an increase in AR expression as a mechanism for the increase in net muscle protein synthesis.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received March 3, 1999.
Revised May 4, 1999.
Accepted May 11, 1999.
|
References |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  D. Paddon-Jones, K. R Short, W. W Campbell, E. Volpi, and R. R Wolfe Role of dietary protein in the sarcopenia of aging Am. J. Clinical Nutrition, May 1, 2008; 87(5): 1562S - 1566S. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Paddon-Jones, M. Sheffield-Moore, M. G. Cree, S. J. Hewlings, A. Aarsland, R. R. Wolfe, and A. A. Ferrando Atrophy and Impaired Muscle Protein Synthesis during Prolonged Inactivity and Stress J. Clin. Endocrinol. Metab., December 1, 2006; 91(12): 4836 - 4841. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A M Solomon and P M G Bouloux Modifying muscle mass - the endocrine perspective. J. Endocrinol., November 1, 2006; 191(2): 349 - 360. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sheffield-Moore, D. Paddon-Jones, S. L. Casperson, C. Gilkison, E. Volpi, S. E. Wolf, J. Jiang, J. I. Rosenblatt, and R. J. Urban Androgen Therapy Induces Muscle Protein Anabolism in Older Women J. Clin. Endocrinol. Metab., October 1, 2006; 91(10): 3844 - 3849. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Balagopal, R. Olney, D. Darmaun, E. Mougey, M. Dokler, G. Sieck, and D. Hammond Oxandrolone enhances skeletal muscle myosin synthesis and alters global gene expression profile in Duchenne muscular dystrophy Am J Physiol Endocrinol Metab, March 1, 2006; 290(3): E530 - E539. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Vlahopoulos, W. E. Zimmer, G. Jenster, N. S. Belaguli, S. P. Balk, A. O. Brinkmann, R. B. Lanz, V. C. Zoumpourlis, and R. J. Schwartz Recruitment of the Androgen Receptor via Serum Response Factor Facilitates Expression of a Myogenic Gene J. Biol. Chem., March 4, 2005; 280(9): 7786 - 7792. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Bhasin, L. Woodhouse, R. Casaburi, A. B. Singh, R. P. Mac, M. Lee, K. E. Yarasheski, I. Sinha-Hikim, C. Dzekov, J. Dzekov, et al. Older Men Are as Responsive as Young Men to the Anabolic Effects of Graded Doses of Testosterone on the Skeletal Muscle J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 678 - 688. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Christiansen, C. H. Gravholt, S. Fisker, N. Moller, M. Andersen, B. Svenstrup, P. Bennett, P. Ivarsen, J. S. Christiansen, and J. O. L. Jorgensen Very short term dehydroepiandrosterone treatment in female adrenal failure: impact on carbohydrate, lipid and protein metabolism Eur. J. Endocrinol., January 1, 2005; 152(1): 77 - 85. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Sinha-Hikim, W. E. Taylor, N. F. Gonzalez-Cadavid, W. Zheng, and S. Bhasin Androgen Receptor in Human Skeletal Muscle and Cultured Muscle Satellite Cells: Up-Regulation by Androgen Treatment J. Clin. Endocrinol. Metab., October 1, 2004; 89(10): 5245 - 5255. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. T. Schroeder, L. Zheng, K. E. Yarasheski, D. Qian, Y. Stewart, C. Flores, C. Martinez, M. Terk, and F. R. Sattler Treatment with oxandrolone and the durability of effects in older men J Appl Physiol, March 1, 2004; 96(3): 1055 - 1062. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. A. Evans Current Concepts in Anabolic-Androgenic Steroids Am. J. Sports Med., March 1, 2004; 32(2): 534 - 542. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Wang, D. H. Catlin, L. M. Demers, B. Starcevic, and R. S. Swerdloff Measurement of Total Serum Testosterone in Adult Men: Comparison of Current Laboratory Methods Versus Liquid Chromatography-Tandem Mass Spectrometry J. Clin. Endocrinol. Metab., February 1, 2004; 89(2): 534 - 543. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. J. Lee, R. W. Thompson, J. M. McClung, and J. A. Carson Regulation of androgen receptor expression at the onset of functional overload in rat plantaris muscle Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2003; 285(5): R1076 - R1085. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. J. Marcell Review Article: Sarcopenia: Causes, Consequences, and Preventions J. Gerontol. A Biol. Sci. Med. Sci., October 1, 2003; 58(10): M911 - 916. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Estrada, A. Espinosa, M. Muller, and E. Jaimovich Testosterone Stimulates Intracellular Calcium Release and Mitogen-Activated Protein Kinases Via a G Protein-Coupled Receptor in Skeletal Muscle Cells Endocrinology, August 1, 2003; 144(8): 3586 - 3597. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. T. Schroeder, M. Terk, and F. R. Sattler Androgen therapy improves muscle mass and strength but not muscle quality: results from two studies Am J Physiol Endocrinol Metab, July 1, 2003; 285(1): E16 - E24. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Sinha-Hikim, S. M. Roth, M. I. Lee, and S. Bhasin Testosterone-induced muscle hypertrophy is associated with an increase in satellite cell number in healthy, young men Am J Physiol Endocrinol Metab, July 1, 2003; 285(1): E197 - E205. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. J. Lee, J. McClung, G. A. Hand, and J. A. Carson Overload-induced androgen receptor expression in the aged rat hindlimb receiving nandrolone decanoate J Appl Physiol, March 1, 2003; 94(3): 1153 - 1161. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. R. Sattler, E. T. Schroeder, M. P. Dube, S. V. Jaque, C. Martinez, P. J. Blanche, S. Azen, and R. M. Krauss Metabolic effects of nandrolone decanoate and resistance training in men with HIV Am J Physiol Endocrinol Metab, December 1, 2002; 283(6): E1214 - E1222. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. B. Rutkove, R. A. Parker, R. A. Nardin, C. E. Connolly, K. J. Felice, and E. M. Raynor A pilot randomized trial of oxandrolone in inclusion body myositis Neurology, April 9, 2002; 58(7): 1081 - 1087. [Abstract] [Full Text] [PDF]
|
|
