| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Department of Obstetrics and Gynaecology (S.A.M., H.O.D.C., T.A.D., D.T.B.), University of Edinburgh, Medical Research Council Reproductive Biology Unit (R.W.K.), Centre for Reproductive Biology, Edinburgh, EH3 9EW, United Kingdom
Address all correspondence and requests for reprints to: S. A. Milne, Department of Obstetrics & Gynaecology, University of Edinburgh, 37 Chalmers Street, Edinburgh, EH3 9EW, United Kingdom.
 |
Abstract |
|---|
 Top Abstract IntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Interleukin (IL)-8 is a member of the structurally-related chemokine
superfamily and exerts its chemotactic activity primarily on
neutrophils (6, 7, 8). IL-8 was initially described in monocytes and has
since been shown to be produced by a variety of different cell types,
including neutrophils (9), T cells (10), endothelial cells (11, 12),
epithelial cells (13), smooth muscle cells (14, 15), and fibroblasts
(16). IL-8 is generated as a 99-amino-acid precursor, which is secreted
after the cleavage of its 20-amino-acid leader sequence and can be
induced by a variety of factors, including lipopolysaccharide, tumor
necrosis factor 
, and IL-1 (17, 18).
Several studies have investigated the production of IL-8 in endometrium and decidua, looking at levels of both messenger RNA (mRNA) and protein. A significant increase in IL-8 protein during pregnancy has been measured in amniotic fluid (19) and choriodecidual cells at term (20), as well as in endometrial stromal and epithelial cells in culture (21). Progesterone has been demonstrated to down-regulate IL-8 release from endometrium (22), whereas progesterone withdrawal in late secretory phase endometrium (23) or administration of mifepristone (a progesterone receptor antagonist) in first trimester pregnancies (24) has been shown to increase IL-8 protein levels.
Investigations have been carried out to localize the site of IL-8 protein synthesis, but the data are conflicting. Perivascular localization has been demonstrated in proliferative and secretory phase endometrium (25, 26) and decidua (27) with colocalization of monocyte chromoattractant protein (MCP)-1 and cycooxygenase (COX)-2 in the endometrium (26). In contrast to this, other studies describe glandular and surface epithelial localization of IL-8 protein (28). This discrepancy is an important issue that needs resolving because the source of inflammatory mediators, such as IL-8, are the targets for novel therapeutic agents in the treatment of menstrual or fertility disorders.
The aim of our investigation was to localize the areas of IL-8 mRNA transcription, in both endometrial and decidual tissue, using a sensitive in situ hybridization assay. Once the methodology was optimized, the effect of withdrawal of progesterone on IL-8 expression was examined.
|
Subjects and Methods |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
The endometrial and decidual biopsies used in this study have already been extensively characterized by our group (23). Ethical approval was obtained from Lothian Research Ethics Committee (reference nos: 1702/93/6/73 and 1702/94/6/1), and written informed consent was obtained from all subjects before tissue collection.
Control cycle endometrial biopsies (n = 7) were collected, with an endometrial suction curette (Pipelle, Laboratoire CCD, Paris, France), from women with regular menstrual cycles (25–35 days). Tissue sections were routinely stained with hematoxylin and eosin, and the stage of the cycle was determined by histological dating, according to established criterion (29). Early pregnancy decidua (n = 6) was collected (away from the implantation site) by curettage, from women undergoing surgical termination of pregnancy (35–63 days).
Endometrial tissue biopsies were collected from 15 fertile women with
regular cycles (25–35 days). To simulate the onset of menstruation,
progesterone (200 mg Cyclogest, H
chst UK Ltd.,
Hounslow, UK, vaginally twice daily) was administered
from LH + 8 for 4 days and then ceased (as a surrogate for
luteal regression) (23) peak + 8 days. The onset of the LH surge was
determined using a commercially available home urine LH Kit (Conceive,
Quidel, San Diego, CA). Detection of the urine LH surge (judged
as when basal LH levels doubled) was thereafter confirmed by RIA.
Endometrial pipelle biopsies were collected from three different
treatment groups: 1) LH peak + 8–10 days normal midluteal phase
(n = 5); 2) 24 h (n = 5); and 3) 48 h (n = no
change after ceasing progesterone.
In situ hybridization
The probe was generated from menstrual cycle RNA using primers for IL-8 and standard RT-PCR procedures. The antisense primer used was TGAATTCTCAGCCCTCTTCAAAAACTTCTC, and the sense primer was GTGTGAAGGTGCAGTTTTGCCAAGGAGTGC. The 298-bp band generated was ligated into pCR2.1 vector and transfected using a TA cloning kit (Invitrogen, San Diego, CA). The pCR2.1 vector lacked a SP6 site, so both an antisense- and a sense plasmid were selected. Plasmid sequences were compared with the GenBank sequence for IL-8 (GenBank Accession No. Y00787) (17) and demonstrated homology of more than 99%. Sections (5-µm thick) from frozen blocks were cut onto Gelatin-coated Superfrost slides (BDH Laboratory Supplies, Poole, UK). After fixing in 4% paraformaldehyde for 20 min, sections were treated with Proteinase K (1 µg/mL) for 15 min at 37 C in Tris-HCl (pH 7.6, 100 mmol/L) containing EDTA (50 mmol/L). Slides were then acetylated twice in triethanolamine (80 mmol/L) containing acetic anhydride (0.3%) for 10 min. Hybridization mixture (deionized formamide, 50%; dextran sulphate, 10%; 4x STE buffer; 1x Denhardt’s solution; sheared salmon sperm DNA, 125 µg/mL; and dithiothreitol, 10 mmol/L) containing 1 x 106 cpm riboprobe (SA, approximately 2.0 x 109 cpm/µg RNA) was added to each section before overnight incubation at 55 C. Posthybridization washes of 2x saline-sodium citrate (SSC) for 20 min at 65 C, ribonuclease A (100 µg/mL in Tris-HCl, pH 7.6, 10 mmol/L; NaCl, 500 mmol/L; EDTA, 1 mmol/L) for 10 min, three 2x SSC for 10 min, 0.1x SSC at 65 C for 10 min, and two 0.1x SSC for 10 min were completed before dehydrating the slides in ethanol. Slides were coated twice with NTB2 emulsion (Scientific Imaging Systems, Rochester, NY) and exposed in the dark at 4 C for 3 weeks. All treatments were carried out at room temperature unless otherwise specified.
Quantification of riboprobe localization
Slides were examined under dark field using a Provis microscope (Zeiss, Oberkochen, Germany). The concentration of grains in both the stromal and perivascular regions were calculated using ImagePro 1.3 (Media Cybernetics, Silver Spring, MD). These were pooled, and the result for each section was calculated as the ratio of counts/µm2 in the perivascular region to the counts/µm2 in stromal cells. Statistical analysis, using ANOVA and Fishers protected least significant difference, was carried out using Statview 4.5 (Abacus Concepts Inc., Berkeley, CA).
Immunohistochemical protocol
Monoclonal mouse antibodies raised against human CD34 (Serotec, Oxford, UK) and Ber-MAC3 (DAKO Corp. Ltd., Cambridge, UK) were used to label endothelial cells and activated tissue macrophages, respectively. IL-8 was detected using a rabbit polyclonal antibody raised against human IL-8 (22, 25), and all immunohistochemical assays employed the technique previously reported (25, 26). In brief, frozen sections were fixed in neutral buffered formalin (10%) and washed in PBS, and endogenous peroxidase activity was quenched with H2O2 (3%) in distilled water. Nonimmune horse serum was applied for 20 min before overnight incubation at 4 C with primary antibody. An avidin-biotin peroxidase detection system was then applied (Vectastain ABC, Vector Laboratories, Inc., Burlingame, CA) with 3, 3'-diaminobenzidine as the chromagen. Sections were counterstained with Harris’s hematoxylin before mounting. Anti-CD34 was used at a 1:250 dilution, Ber-MAC3 at a 1:100 dilution, and the rabbit polyclonal against IL-8 at a 1:500 dilution. A concentration-matched mouse IgG (Vector Laboratories, Inc., Burlingame, CA) was used as the negative control for anti-CD34 and anti-MAC3 antibodies, whereas preabsorbed antibody to IL-8 was used as the anti-IL-8 negative control. All treatments were carried out at room temperature unless otherwise specified.
|
Results |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
No localization of IL-8 riboprobe was observed in day-3 menstrual
or day-14 ovulatory biopsies (data not shown). However, late secretory
endometrium, dated to day 26 of the cycle, demonstrated marked
perivascular localization of riboprobe (Fig. 1
, i and j).
|
Decidua contained more prominent vasculature than endometrial
tissue, so the perivascular localization of IL-8 mRNA was more distinct
(Fig. 1
, a–d, g, and h). This is supported by immunohistochemical
staining for IL-8 protein, which also localized to the perivascular
region in decidua (Fig. 1e). In addition to the perivascular production
of IL-8 mRNA, activated macrophages also produce a component of the
total IL-8, as highlighted in the serial sections stained for MAC3
(Fig. 1, g and h).
From serial immunohistochemical sections stained with anti-CD34, it can
be seen that the silver grains from IL-8 riboprobe localization are
distributed in a broader pattern than the endothelial cell layer (Fig. 1, b and c) suggesting localization to perivascular cells rather than
endothelial cells.
Endometrium after progesterone withdrawal
Negligible localization of IL-8 riboprobe was observed in the
control midluteal endometrium sampled on day LH + 8–10 (Fig. 2). Low expression of IL-8 mRNA was
observed in endometrium, 24 h after progesterone withdrawal; and
the IL-8 mRNA that was present was localized to the perivascular cells
(Fig. 2). In contrast, endometrium, 48 h after progesterone
withdrawal, demonstrated strong perivascular localization significantly
increased from the 24-h withdrawal samples (Figs. 1, k and l; and 2).
Serum progesterone levels for this biopsy series are already published
(23).
|
|
Discussion |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
The exact nature of the cellular component in the perivascular region,
however, has not been fully elucidated. We have demonstrated that
activated macrophages are likely to be partly involved in the
perivascular production of IL-8 and, almost certainly, contribute to
the overall generation of IL-8 in reproductive tissue. However,
endothelial cells are less likely to play a major role in perivascular
IL-8 production because of the broad silver grain distribution for IL-8
mRNA, compared with the narrow endothelial cell staining (Fig. 1, b, c,
g, and h). From the pattern of localization, the cells generating the
majority of IL-8 are most likely either vascular smooth muscle cells,
fibroblasts or, more probably, myofibroblasts. These cell types have
all been demonstrated to generate IL-8 in vitro (15, 16);
and further studies, such as nonradioactive in situ
hybridization, are required to determine exactly which cell
population(s) are involved.
To date, only one other publication has investigated IL-8 mRNA expression in endometrial and decidual tissues (30). This group demonstrated localization in decidual stromal cells, decidual lymphocytes, and endometrial glandular epithelium. Our study, however, supports a perivascular localization of IL-8 immunoreactivity in late secretory endometrium and decidua. Arici and co-workers (28) have demonstrated glandular expression of IL-8 protein in late secretory endometrium. No glandular localization was observed in this study, although, because IL-8 is a soluble factor, it could collect in the glandular compartment and show up as positive immunoreactivity. The antibodies used by Arici and colleagues (28) and that used by Critchley et al. (25) and Jones et al. (26) are not the same and may exhibit different selectivity, thus explaining the different localization patterns. Interestingly, Arici and co-workers (1998) do mention some vascular staining in their results, although this is not discussed in detail.
All these studies (26, 28) describe a similar menstrual cycle profile for IL-8 mRNA expression in endometrium, with low expression during the midproliferative to midsecretory phase and high expression around the time of menses. These observations of menstrual cycle change in IL-8 mRNA expression support data recently published from our laboratory examining in detail the endometrial tissue changes after progesterone withdrawal in vivo (23). Control endometrium (LH + 8–10 days) was shown to have peak serum progesterone levels and low IL-8 protein production, whereas IL-8 protein levels were much greater 48 h, compared with 24 h, after progesterone withdrawal. In agreement with this, our data for IL-8 mRNA localization has the same profile of expression. Decidua, on the other hand, was shown to produce IL-8 protein above basal levels; and our data for IL-8 mRNA expression in decidua again mirrors these results.
It has previously been suggested that progesterone withdrawal up-regulates IL-8 production in both endometrial and decidual tissues and that progesterone in the luteal phase suppresses IL-8 expression (22). Preferential expression of progesterone receptor (PR)A subtype has been demonstrated in the secretory phase, premenstrually and in first-trimester decidua, whereas PRB is the major subtype expressed in the proliferative phase (31). As such, the inhibitory effects of progesterone on IL-8 expression may be mediated by both the PRA and PRB subtypes. Proliferative endometrium is subjected to very low circulating progesterone but has high receptor expression; so IL-8 transcription could be inhibited. In the secretory phase progesterone concentrations rise and epithelial PR expression declines; however, after progesterone withdrawal at menses, inhibition of IL-8 transcription is removed. Although decidual tissue is subjected to very high circulating progesterone, as well as PRA subtype expression, some IL-8 transcription may occur because of receptor desensitization. It can be speculated that this would be advantageous in the decidua because IL-8 is also a mitogen and can stimulate angiogenesis (14, 15), a necessary mechanism in decidua to allow increased blood supply to the placenta.
In conclusion, this paper demonstrates that IL-8 mRNA expression in premenstrual endometrium and decidua is localized to perivascular cells and is up-regulated by withdrawal of progesterone. Further experiments are planned to clearly identify which discrete cell populations are responsible for the perivascular production of IL-8 and to elucidate the mechanisms by which progesterone regulates IL-8 expression.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received November 20, 1998.
Revised March 19, 1999.
Accepted March 26, 1999.
|
References |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
, LPS, and IL-1ß. Science. 243:1467–1469.This article has been cited by other articles:
 |
|
 |
|
  A. Germeyer, A. M. Sharkey, M. Prasadajudio, R. Sherwin, A. Moffett, K. Bieback, S. Clausmeyer, L. Masters, R. M. Popovici, A. P. Hess, et al. Paracrine effects of uterine leucocytes on gene expression of human uterine stromal fibroblasts Mol. Hum. Reprod., January 1, 2009; 15(1): 39 - 48. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. N. Jabbour, R. W. Kelly, H. M. Fraser, and H. O. D. Critchley Endocrine Regulation of Menstruation Endocr. Rev., February 1, 2006; 27(1): 17 - 46. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Rossi, A. M Sharkey, P. Vigano, G. Fiore, R. Furlong, P. Florio, G. Ambrosini, S. K Smith, and F. Petraglia Identification of genes regulated by interleukin-1{beta} in human endometrial stromal cells Reproduction, November 1, 2005; 130(5): 721 - 729. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. C. Ulukus, M. Ulukus, Y. Seval, W. Zheng, and A. Arici Expression of interleukin-8 and monocyte chemotactic protein-1 in adenomyosis Hum. Reprod., October 1, 2005; 20(10): 2958 - 2963. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. A. Milne, T. A. Henderson, R. W. Kelly, P. T. Saunders, D. T. Baird, and H. O. D. Critchley Leukocyte Populations and Steroid Receptor Expression in Human First-Trimester Decidua; Regulation by Antiprogestin and Prostaglandin E Analog J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4315 - 4321. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Hirota, Y. Osuga, T. Hirata, K. Koga, O. Yoshino, M. Harada, C. Morimoto, E. Nose, T. Yano, O. Tsutsumi, et al. Evidence for the Presence of Protease-Activated Receptor 2 and Its Possible Implication in Remodeling of Human Endometrium J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1662 - 1669. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Luk, Y. Seval, U. A. Kayisli, M. Ulukus, C. E. Ulukus, and A. Arici Regulation of Interleukin-8 Expression in Human Endometrial Endothelial Cells: A Potential Mechanism for the Pathogenesis of Endometriosis J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1805 - 1811. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kitaya, T. Nakayama, N. Daikoku, S. Fushiki, and H. Honjo Spatial and Temporal Expression of Ligands for CXCR3 and CXCR4 in Human Endometrium J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2470 - 2476. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. J. Lockwood, P. Kumar, G. Krikun, S. Kadner, P. Dubon, H. Critchley, and F. Schatz Effects of Thrombin, Hypoxia, and Steroids on Interleukin-8 Expression in Decidualized Human Endometrial Stromal Cells: Implications for Long-Term Progestin-Only Contraceptive-Induced Bleeding J. Clin. Endocrinol. Metab., March 1, 2004; 89(3): 1467 - 1475. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. J. Lockwood, G. Krikun, A. B. C. Koo, S. Kadner, and F. Schatz Differential Effects of Thrombin and Hypoxia on Endometrial Stromal and Glandular Epithelial Cell Vascular Endothelial Growth Factor Expression J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4280 - 4286. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Caballero-Campo, F. Dominguez, J. Coloma, M. Meseguer, J. Remohi, A. Pellicer, and C. Simon Hormonal and embryonic regulation of chemokines IL-8, MCP-1 and RANTES in the human endometrium during the window of implantation Mol. Hum. Reprod., April 1, 2002; 8(4): 375 - 384. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Akoum, C. Lawson, S. McColl, and M. Villeneuve Ectopic endometrial cells express high concentrations of interleukin (IL)-8 in vivo regardless of the menstrual cycle phase and respond to oestradiol by up-regulating IL-1-induced IL-8 expression in vitro Mol. Hum. Reprod., September 1, 2001; 7(9): 859 - 866. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Yoshino, Y. Osuga, K. Koga, O. Tsutsumi, T. Yano, T. Fujii, K. Kugu, M. Momoeda, T. Fujiwara, K. Tomita, et al. Evidence for the expression of interleukin (IL)-18, IL-18 receptor and IL-18 binding protein in the human endometrium Mol. Hum. Reprod., July 1, 2001; 7(7): 649 - 654. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Kitaya, J. Yasuda, I. Yagi, Y. Tada, S. Fushiki, and H. Honjo IL-15 Expression at Human Endometrium and Decidua Biol Reprod, September 1, 2000; 63(3): 683 - 687. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
