help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Milne, S. A.
Right arrow Articles by Baird, D. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Milne, S. A.
Right arrow Articles by Baird, D. T.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*PROGESTERONE
The Journal of Clinical Endocrinology & Metabolism Vol. 84, No. 7 2563-2567
Copyright © 1999 by The Endocrine Society


Original Studies

Perivascular Interleukin-8 Messenger Ribonucleic Acid Expression in Human Endometrium Varies across the Menstrual Cycle and in Early Pregnancy Decidua1

S. A. Milne, H. O. D. Critchley, T. A. Drudy, R. W. Kelly and D. T. Baird

Department of Obstetrics and Gynaecology (S.A.M., H.O.D.C., T.A.D., D.T.B.), University of Edinburgh, Medical Research Council Reproductive Biology Unit (R.W.K.), Centre for Reproductive Biology, Edinburgh, EH3 9EW, United Kingdom

Address all correspondence and requests for reprints to: S. A. Milne, Department of Obstetrics & Gynaecology, University of Edinburgh, 37 Chalmers Street, Edinburgh, EH3 9EW, United Kingdom.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Human endometrium and decidua contain large numbers of different leukocyte populations, the concentration of which fluctuates during the menstrual cycle and pregnancy. There is, for example, a large influx of neutrophils into premenstrual endometrium associated with an increased expression of interleukin (IL)-8 protein, which is chemotactic for neutrophils. Our aim in this study was to localize IL-8 messenger RNA (mRNA) expression in endometrium and decidua using in situ hybridization. In situ hybridization was carried out with a 35S-uridine 5'-triphosphate-labeled riboprobe using standard procedures. Late secretory endometrial and decidual biopsies demonstrated clear perivascular localization of IL-8 mRNA, with additional expression colocalized to activated macrophages. Midluteal endometrium showed minimal IL-8 expression, whereas endometrium obtained from women administered progesterone for 4 days from (LH peak + 8 days), to simulate luteal regression, demonstrated significantly increased localization of IL-8 mRNA, 48 h after withdrawal of progesterone. In conclusion, IL-8 mRNA expression is localized to perivascular cells of late secretory endometrium and decidua.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
HUMAN ENDOMETRIUM is comprised of hormonally responsive glandular epithelium and stroma with a large number of leukocytes (1, 2), including macrophages, granulocytes, natural killer (NK), B-, and T cells (3, 4). Although the majority of endometrial leukocytes are the phenotypically unique large granular lymphocytes and macrophages, there is a premenstrual influx of neutrophils and eosinophils into the endometrium (1, 3, 4, 5). These changes suggest hormonal control of migration and/or replication in the endometrium.

Interleukin (IL)-8 is a member of the structurally-related chemokine superfamily and exerts its chemotactic activity primarily on neutrophils (6, 7, 8). IL-8 was initially described in monocytes and has since been shown to be produced by a variety of different cell types, including neutrophils (9), T cells (10), endothelial cells (11, 12), epithelial cells (13), smooth muscle cells (14, 15), and fibroblasts (16). IL-8 is generated as a 99-amino-acid precursor, which is secreted after the cleavage of its 20-amino-acid leader sequence and can be induced by a variety of factors, including lipopolysaccharide, tumor necrosis factor {alpha}, and IL-1 (17, 18).

Several studies have investigated the production of IL-8 in endometrium and decidua, looking at levels of both messenger RNA (mRNA) and protein. A significant increase in IL-8 protein during pregnancy has been measured in amniotic fluid (19) and choriodecidual cells at term (20), as well as in endometrial stromal and epithelial cells in culture (21). Progesterone has been demonstrated to down-regulate IL-8 release from endometrium (22), whereas progesterone withdrawal in late secretory phase endometrium (23) or administration of mifepristone (a progesterone receptor antagonist) in first trimester pregnancies (24) has been shown to increase IL-8 protein levels.

Investigations have been carried out to localize the site of IL-8 protein synthesis, but the data are conflicting. Perivascular localization has been demonstrated in proliferative and secretory phase endometrium (25, 26) and decidua (27) with colocalization of monocyte chromoattractant protein (MCP)-1 and cycooxygenase (COX)-2 in the endometrium (26). In contrast to this, other studies describe glandular and surface epithelial localization of IL-8 protein (28). This discrepancy is an important issue that needs resolving because the source of inflammatory mediators, such as IL-8, are the targets for novel therapeutic agents in the treatment of menstrual or fertility disorders.

The aim of our investigation was to localize the areas of IL-8 mRNA transcription, in both endometrial and decidual tissue, using a sensitive in situ hybridization assay. Once the methodology was optimized, the effect of withdrawal of progesterone on IL-8 expression was examined.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Patients

The endometrial and decidual biopsies used in this study have already been extensively characterized by our group (23). Ethical approval was obtained from Lothian Research Ethics Committee (reference nos: 1702/93/6/73 and 1702/94/6/1), and written informed consent was obtained from all subjects before tissue collection.

Control cycle endometrial biopsies (n = 7) were collected, with an endometrial suction curette (Pipelle, Laboratoire CCD, Paris, France), from women with regular menstrual cycles (25–35 days). Tissue sections were routinely stained with hematoxylin and eosin, and the stage of the cycle was determined by histological dating, according to established criterion (29). Early pregnancy decidua (n = 6) was collected (away from the implantation site) by curettage, from women undergoing surgical termination of pregnancy (35–63 days).

Endometrial tissue biopsies were collected from 15 fertile women with regular cycles (25–35 days). To simulate the onset of menstruation, progesterone (200 mg Cyclogest, Hoechst UK Ltd., Hounslow, UK, vaginally twice daily) was administered from LH + 8 for 4 days and then ceased (as a surrogate for luteal regression) (23) peak + 8 days. The onset of the LH surge was determined using a commercially available home urine LH Kit (Conceive, Quidel, San Diego, CA). Detection of the urine LH surge (judged as when basal LH levels doubled) was thereafter confirmed by RIA. Endometrial pipelle biopsies were collected from three different treatment groups: 1) LH peak + 8–10 days normal midluteal phase (n = 5); 2) 24 h (n = 5); and 3) 48 h (n = no change after ceasing progesterone.

In situ hybridization

The probe was generated from menstrual cycle RNA using primers for IL-8 and standard RT-PCR procedures. The antisense primer used was TGAATTCTCAGCCCTCTTCAAAAACTTCTC, and the sense primer was GTGTGAAGGTGCAGTTTTGCCAAGGAGTGC. The 298-bp band generated was ligated into pCR2.1 vector and transfected using a TA cloning kit (Invitrogen, San Diego, CA). The pCR2.1 vector lacked a SP6 site, so both an antisense- and a sense plasmid were selected. Plasmid sequences were compared with the GenBank sequence for IL-8 (GenBank Accession No. Y00787) (17) and demonstrated homology of more than 99%. Sections (5-µm thick) from frozen blocks were cut onto Gelatin-coated Superfrost slides (BDH Laboratory Supplies, Poole, UK). After fixing in 4% paraformaldehyde for 20 min, sections were treated with Proteinase K (1 µg/mL) for 15 min at 37 C in Tris-HCl (pH 7.6, 100 mmol/L) containing EDTA (50 mmol/L). Slides were then acetylated twice in triethanolamine (80 mmol/L) containing acetic anhydride (0.3%) for 10 min. Hybridization mixture (deionized formamide, 50%; dextran sulphate, 10%; 4x STE buffer; 1x Denhardt’s solution; sheared salmon sperm DNA, 125 µg/mL; and dithiothreitol, 10 mmol/L) containing 1 x 106 cpm riboprobe (SA, approximately 2.0 x 109 cpm/µg RNA) was added to each section before overnight incubation at 55 C. Posthybridization washes of 2x saline-sodium citrate (SSC) for 20 min at 65 C, ribonuclease A (100 µg/mL in Tris-HCl, pH 7.6, 10 mmol/L; NaCl, 500 mmol/L; EDTA, 1 mmol/L) for 10 min, three 2x SSC for 10 min, 0.1x SSC at 65 C for 10 min, and two 0.1x SSC for 10 min were completed before dehydrating the slides in ethanol. Slides were coated twice with NTB2 emulsion (Scientific Imaging Systems, Rochester, NY) and exposed in the dark at 4 C for 3 weeks. All treatments were carried out at room temperature unless otherwise specified.

Quantification of riboprobe localization

Slides were examined under dark field using a Provis microscope (Zeiss, Oberkochen, Germany). The concentration of grains in both the stromal and perivascular regions were calculated using ImagePro 1.3 (Media Cybernetics, Silver Spring, MD). These were pooled, and the result for each section was calculated as the ratio of counts/µm2 in the perivascular region to the counts/µm2 in stromal cells. Statistical analysis, using ANOVA and Fishers protected least significant difference, was carried out using Statview 4.5 (Abacus Concepts Inc., Berkeley, CA).

Immunohistochemical protocol

Monoclonal mouse antibodies raised against human CD34 (Serotec, Oxford, UK) and Ber-MAC3 (DAKO Corp. Ltd., Cambridge, UK) were used to label endothelial cells and activated tissue macrophages, respectively. IL-8 was detected using a rabbit polyclonal antibody raised against human IL-8 (22, 25), and all immunohistochemical assays employed the technique previously reported (25, 26). In brief, frozen sections were fixed in neutral buffered formalin (10%) and washed in PBS, and endogenous peroxidase activity was quenched with H2O2 (3%) in distilled water. Nonimmune horse serum was applied for 20 min before overnight incubation at 4 C with primary antibody. An avidin-biotin peroxidase detection system was then applied (Vectastain ABC, Vector Laboratories, Inc., Burlingame, CA) with 3, 3'-diaminobenzidine as the chromagen. Sections were counterstained with Harris’s hematoxylin before mounting. Anti-CD34 was used at a 1:250 dilution, Ber-MAC3 at a 1:100 dilution, and the rabbit polyclonal against IL-8 at a 1:500 dilution. A concentration-matched mouse IgG (Vector Laboratories, Inc., Burlingame, CA) was used as the negative control for anti-CD34 and anti-MAC3 antibodies, whereas preabsorbed antibody to IL-8 was used as the anti-IL-8 negative control. All treatments were carried out at room temperature unless otherwise specified.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Endometrium

No localization of IL-8 riboprobe was observed in day-3 menstrual or day-14 ovulatory biopsies (data not shown). However, late secretory endometrium, dated to day 26 of the cycle, demonstrated marked perivascular localization of riboprobe (Fig. 1Go, i and j).



View larger version (167K):
[in this window]
[in a new window]
 
Figure 1. Serial tissue sections of first-trimester decidua, demonstrating (a) vascular structure (V) in hematoxylin-and-eosin stained tissue, (b) IL-8 antisense riboprobe showing expression over perivascular (V) region, (c) endothelial cells labeled with anti-CD34 antibody (brown), and (d) IL-8 sense riboprobe (indicating no nonselective localization of the riboprobe). Nonserial first-trimester decidua, immunohistochemically stained with (e) IL-8 antibody (brown), selectively marking vasculature, and (f) negative control of IL-8 antibody preabsorbed with synthetic IL-8 peptide with no vascular localization. First-trimester decidua (g), immunohistochemically stained for presence of activated macrophages (M) with anti-MAC3 antibody (brown), and (h) serial section to (g), demonstrating positive expression of IL-8 mRNA in some activated macrophages. Serial endometrial sections (day 26), demonstrating (i) endothelial cell immunostaining with anti-CD34 antibody (brown) and (j) IL-8 antisense riboprobe localization to the perivascular cells. Serial endometrial tissue sections, 48 h after ceasing progesterone administered from day LH + 8 in the luteal phase for 4 days (k), demonstrating endothelial cells stained with anti-CD34 (brown), and (l) localization of IL-8 antisense riboprobe to the perivascular cells. V, Vascular structure; M, activated macrophages. Scale bars: a–d, g, h and i–l = 100 µm; e and f = 50 µm.

 
Decidua

Decidua contained more prominent vasculature than endometrial tissue, so the perivascular localization of IL-8 mRNA was more distinct (Fig. 1Go, a–d, g, and h). This is supported by immunohistochemical staining for IL-8 protein, which also localized to the perivascular region in decidua (Fig. 1eGo). In addition to the perivascular production of IL-8 mRNA, activated macrophages also produce a component of the total IL-8, as highlighted in the serial sections stained for MAC3 (Fig. 1Go, g and h).

From serial immunohistochemical sections stained with anti-CD34, it can be seen that the silver grains from IL-8 riboprobe localization are distributed in a broader pattern than the endothelial cell layer (Fig. 1Go, b and c) suggesting localization to perivascular cells rather than endothelial cells.

Endometrium after progesterone withdrawal

Negligible localization of IL-8 riboprobe was observed in the control midluteal endometrium sampled on day LH + 8–10 (Fig. 2Go). Low expression of IL-8 mRNA was observed in endometrium, 24 h after progesterone withdrawal; and the IL-8 mRNA that was present was localized to the perivascular cells (Fig. 2Go). In contrast, endometrium, 48 h after progesterone withdrawal, demonstrated strong perivascular localization significantly increased from the 24-h withdrawal samples (Figs. 1Go, k and l; and 2). Serum progesterone levels for this biopsy series are already published (23).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 2. Vascular:stromal grain count ratio. Midluteal samples (LH + 8), 24 h and 48 h after progesterone (P) withdrawal; control decidua (35–63 days gestation). Results are expressed as average ± SEM of vascular:stromal ratio values.

 

    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
This paper provides clear evidence for perivascular localization of IL-8 mRNA in late secretory endometrium and decidua. The data presented here support previous work from this laboratory, demonstrating immunohistochemical perivascular localization of IL-8 protein in late secretory, premenstrual, and decidual biopsies (23, 25, 26).

The exact nature of the cellular component in the perivascular region, however, has not been fully elucidated. We have demonstrated that activated macrophages are likely to be partly involved in the perivascular production of IL-8 and, almost certainly, contribute to the overall generation of IL-8 in reproductive tissue. However, endothelial cells are less likely to play a major role in perivascular IL-8 production because of the broad silver grain distribution for IL-8 mRNA, compared with the narrow endothelial cell staining (Fig. 1Go, b, c, g, and h). From the pattern of localization, the cells generating the majority of IL-8 are most likely either vascular smooth muscle cells, fibroblasts or, more probably, myofibroblasts. These cell types have all been demonstrated to generate IL-8 in vitro (15, 16); and further studies, such as nonradioactive in situ hybridization, are required to determine exactly which cell population(s) are involved.

To date, only one other publication has investigated IL-8 mRNA expression in endometrial and decidual tissues (30). This group demonstrated localization in decidual stromal cells, decidual lymphocytes, and endometrial glandular epithelium. Our study, however, supports a perivascular localization of IL-8 immunoreactivity in late secretory endometrium and decidua. Arici and co-workers (28) have demonstrated glandular expression of IL-8 protein in late secretory endometrium. No glandular localization was observed in this study, although, because IL-8 is a soluble factor, it could collect in the glandular compartment and show up as positive immunoreactivity. The antibodies used by Arici and colleagues (28) and that used by Critchley et al. (25) and Jones et al. (26) are not the same and may exhibit different selectivity, thus explaining the different localization patterns. Interestingly, Arici and co-workers (1998) do mention some vascular staining in their results, although this is not discussed in detail.

All these studies (26, 28) describe a similar menstrual cycle profile for IL-8 mRNA expression in endometrium, with low expression during the midproliferative to midsecretory phase and high expression around the time of menses. These observations of menstrual cycle change in IL-8 mRNA expression support data recently published from our laboratory examining in detail the endometrial tissue changes after progesterone withdrawal in vivo (23). Control endometrium (LH + 8–10 days) was shown to have peak serum progesterone levels and low IL-8 protein production, whereas IL-8 protein levels were much greater 48 h, compared with 24 h, after progesterone withdrawal. In agreement with this, our data for IL-8 mRNA localization has the same profile of expression. Decidua, on the other hand, was shown to produce IL-8 protein above basal levels; and our data for IL-8 mRNA expression in decidua again mirrors these results.

It has previously been suggested that progesterone withdrawal up-regulates IL-8 production in both endometrial and decidual tissues and that progesterone in the luteal phase suppresses IL-8 expression (22). Preferential expression of progesterone receptor (PR)A subtype has been demonstrated in the secretory phase, premenstrually and in first-trimester decidua, whereas PRB is the major subtype expressed in the proliferative phase (31). As such, the inhibitory effects of progesterone on IL-8 expression may be mediated by both the PRA and PRB subtypes. Proliferative endometrium is subjected to very low circulating progesterone but has high receptor expression; so IL-8 transcription could be inhibited. In the secretory phase progesterone concentrations rise and epithelial PR expression declines; however, after progesterone withdrawal at menses, inhibition of IL-8 transcription is removed. Although decidual tissue is subjected to very high circulating progesterone, as well as PRA subtype expression, some IL-8 transcription may occur because of receptor desensitization. It can be speculated that this would be advantageous in the decidua because IL-8 is also a mitogen and can stimulate angiogenesis (14, 15), a necessary mechanism in decidua to allow increased blood supply to the placenta.

In conclusion, this paper demonstrates that IL-8 mRNA expression in premenstrual endometrium and decidua is localized to perivascular cells and is up-regulated by withdrawal of progesterone. Further experiments are planned to clearly identify which discrete cell populations are responsible for the perivascular production of IL-8 and to elucidate the mechanisms by which progesterone regulates IL-8 expression.


    Acknowledgments
 
We are grateful to Sister Cathy Hall for assistance with patient recruitment and biopsy collection. We wish, also, to acknowledge the assistance of Linda Harkness for her helpful advice.


    Footnotes
 
1 This work was supported by project grants from the Medical Research Council (G9406438PA and G9620138). Back

Received November 20, 1998.

Revised March 19, 1999.

Accepted March 26, 1999.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Bulmer JN, Longfellow M, Ritson A. 1991 Leukocytes and resident blood cells in endometrium. Ann NY Acad Sci. 622:57–68.[Medline]
  2. Starkey P, Clover L, Rees M. 1991 Variation during the menstrual cycle of immune cell populations in human endometrium. Eur J Obstet Gynecol Reprod Biol. 39:203–207.[CrossRef][Medline]
  3. Kamat BR, Isaacson PG. 1987 The immunocytochemical distribution of leukocytic subpopulations in human endometrium. Am J Pathol. 127:66–73.[Abstract]
  4. Jeziorska M, Salamonsen LA, Woolley DE. 1995 Mast-cell and eosinophil distribution and activation in human endometrium throughout the menstrual-cycle. Biol Reprod. 53:312–320.[Abstract]
  5. King A, Loke YW. 1990 Uterine large granular lymphocytes: a possible role in embryonic implantation? Am J Obstet Gynecol. 162:308–310.[Medline]
  6. Oppenheim JJ, Zachariae COC, Mukaida N, Matsushima K. 1991 Properties of the novel proinflammatory supergene intercrine cytokine family. Annu Rev Immunol. 9:617–648.[Medline]
  7. Leonard EJ, Skeel A, Yoshimura T, Noer K, Kutvirt S, Vanepps D. 1990 Leukocyte specificity and binding of human neutrophil attractant activation protein-1. J Immunol. 144:1323–1330.[Abstract]
  8. Larsen CG, Anderson AO, Appela E, Oppenheim JJ, Matsushima K. 1989 The neutrophil-activating peptide (NAP-1) is also chemotactic for T lymphocytes. Science. 243:1464–1466.[Abstract/Free Full Text]
  9. Takahashi GW, Andrews DF, Lilly MB, Singer JW, Alderson MR. 1993 Effect of granulocyte-macrophage colony-stimulating factor and interleukin-3 on interleukin-8 production by human neutrophils and monocytes. Blood. 81:357–364.[Abstract/Free Full Text]
  10. Gregory H, Young J, Schroder JM, Mrowietz U, Christophers E. 1988 Structure determination of a human-lymphocyte derived neutrophil activating peptide (LYNAP). Biochem Biophys Res Commun. 151:883–890.[CrossRef][Medline]
  11. Gimbrone MA, Obin MS, Brock AF, et al. 1989 Endothelial interleukin-8 — a novel inhibitor of leukocyte-endothelial interactions. Science. 246:1601–1603.[Abstract/Free Full Text]
  12. Strieter RM, Kunkel SL, Showell HJ, et al. 1989 Endothelial cell gene expression of a neutrophil chemotactic factor by TNF{alpha}, LPS, and IL-1ß. Science. 243:1467–1469.[Abstract/Free Full Text]
  13. Elner VM, Strieter RM, Elner SG, Baggiolini M, Lindley I, Kunkel SL. 1990 Neutrophil chemotactic factor (IL-8) gene-expression by cytokine-treated retinal-pigment epithelial-cells. Am J Pathol. 136:745–750.[Abstract]
  14. Van Damme J, Decock B, Conings R, Lenaerts JP, Opdenakker G, Billiau A. 1989 The chemotactic activity for granulocytes produced by virally infected fibroblasts is identical to monocyte-derived interleukin-8. Eur J Immunol. 19:1189–1194.[Medline]
  15. Yue T-L, Wang X, Sung C-P, et al. 1994 Interleukin-8:a mitogen and chemoattractant for vascular smooth muscle cells. Circ Res. 75:1–7.[Abstract/Free Full Text]
  16. Strieter RM, Kasahara K, Allen R, Showell HJ, Standiford TJ, Kunkel SL. 1990 Human neutrophils exhibit disparate chemotactic factor gene-expression. Biochem Biophys Res Commun. 173:725–730.[CrossRef][Medline]
  17. Matsushima K, Morishita K, Yoshimura T, et al. 1988 Molecular cloning of a human monocyte-derived neutrophil chemotactic factor (MDNCF) and the induction of MDNCF mRNA by interleukin-1 and tumour necrosis factor. J Exp Med. 167:1883–1893.[Abstract/Free Full Text]
  18. Mukaida N, Shiroo M, Matsushima K. 1989 Genomic structure of the human monocyte-derived neutrophil chemotactic factor IL-8. J Immunology. 143:1366–1371.[Abstract]
  19. Laham N, Rice GE, Bishop GJ, Ransome C, Brennecke SP. 1993 Interleukin-8 concentrations in amniotic fluid and peripheral venous plasma during human pregnancy and parturition. Acta Endocrinol (Copenh). 129:220–224.[Abstract/Free Full Text]
  20. Kelly RW, Leask R, Calder AA. 1992 Choriodecidual production of interleukin-8 and mechanism of parturition. Lancet. 339:776–777.[CrossRef][Medline]
  21. Arici A, Head J, MacDonald P, Casey M. 1993 Regulation of interleukin-8 gene expression in endometrial cells in culture. Mol Cell Endocrinol. 94:195–204.[CrossRef][Medline]
  22. Kelly RW, Illingworth P, Baldie G, Leask R, Brouwer S, Calder AA. 1994 Progesterone control of interleukin-8 production in endometrium and chorio-decidual cells underlines the role of the neutrophil in menstruation and parturition. Hum Reprod. 9:253–258.[Abstract/Free Full Text]
  23. Critchley HOD, Jones RL, Lea RG, et al. 1999 Role of inflammatory mediators in human endometrium during progesterone withdrawal and early pregnancy. J Clin Endocrinol Metab. 84:240–248.[Abstract/Free Full Text]
  24. Critchley HOD, Kelly RW, Lea RG, Drudy TA, Jones RL, Baird DT. 1996 Sex steroid regulation of leukocyte traffic in human decidua. Hum Reprod. 11:2257–2262.[Abstract/Free Full Text]
  25. Critchley HOD, Kelly RW, Kooy J. 1994 Perivascular location of a chemokine interleukin-8 in human endometrium: a preliminary report. Hum Reprod. 9:1406–1409.[Abstract/Free Full Text]
  26. Jones RL, Kelly RW, Critchley HOD. 1997 Chemokine and cyclooxygenase-2 expression in human endometrium coincides with leukocyte accumulation. Hum Reprod. 12:1300–1306.
  27. Maehara K, Kanayama N, Maradny EE, Uezato T, Fujita M, Terao T. 1996 Mechanical stretching induces interleukin-8 gene expression in fetal membranes: a possible role for the initiation of human parturition. Eur J Obstet Gynecol. 70:191–196.[CrossRef][Medline]
  28. Arici A, Seli E, Senturk LM, Gutierrez LS, Oral E, Taylor HS. 1998 Interleukin-8 in the human endometrium. J Clin Endocrinol Metab. 83:1783–1787.[Abstract/Free Full Text]
  29. Noyes RW, Hertig AT, Rock J. 1950 Dating the endometrial biopsy. Fertil Steril. 1:3–25.
  30. Saito S, Kasahara T, Sakakura S, Umekage H, Harada N, Ichijo M. 1994 Detection and localisation of interleukin-8 mRNA and protein in human placenta and decidual tissues. J Reprod Immunol. 27:161–172.[CrossRef][Medline]
  31. Wang H, Critchley HOD, Kelly RW, Shen D, Baird DT. 1998 Progesterone receptor subtype B is differentially regulated in human endometrial stroma. Mol Hum Reprod. 4:407–412.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol Hum ReprodHome page
A. Germeyer, A. M. Sharkey, M. Prasadajudio, R. Sherwin, A. Moffett, K. Bieback, S. Clausmeyer, L. Masters, R. M. Popovici, A. P. Hess, et al.
Paracrine effects of uterine leucocytes on gene expression of human uterine stromal fibroblasts
Mol. Hum. Reprod., January 1, 2009; 15(1): 39 - 48.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
H. N. Jabbour, R. W. Kelly, H. M. Fraser, and H. O. D. Critchley
Endocrine Regulation of Menstruation
Endocr. Rev., February 1, 2006; 27(1): 17 - 46.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
M. Rossi, A. M Sharkey, P. Vigano, G. Fiore, R. Furlong, P. Florio, G. Ambrosini, S. K Smith, and F. Petraglia
Identification of genes regulated by interleukin-1{beta} in human endometrial stromal cells
Reproduction, November 1, 2005; 130(5): 721 - 729.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
E. C. Ulukus, M. Ulukus, Y. Seval, W. Zheng, and A. Arici
Expression of interleukin-8 and monocyte chemotactic protein-1 in adenomyosis
Hum. Reprod., October 1, 2005; 20(10): 2958 - 2963.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. A. Milne, T. A. Henderson, R. W. Kelly, P. T. Saunders, D. T. Baird, and H. O. D. Critchley
Leukocyte Populations and Steroid Receptor Expression in Human First-Trimester Decidua; Regulation by Antiprogestin and Prostaglandin E Analog
J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4315 - 4321.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Y. Hirota, Y. Osuga, T. Hirata, K. Koga, O. Yoshino, M. Harada, C. Morimoto, E. Nose, T. Yano, O. Tsutsumi, et al.
Evidence for the Presence of Protease-Activated Receptor 2 and Its Possible Implication in Remodeling of Human Endometrium
J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1662 - 1669.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. Luk, Y. Seval, U. A. Kayisli, M. Ulukus, C. E. Ulukus, and A. Arici
Regulation of Interleukin-8 Expression in Human Endometrial Endothelial Cells: A Potential Mechanism for the Pathogenesis of Endometriosis
J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1805 - 1811.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
K. Kitaya, T. Nakayama, N. Daikoku, S. Fushiki, and H. Honjo
Spatial and Temporal Expression of Ligands for CXCR3 and CXCR4 in Human Endometrium
J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2470 - 2476.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. J. Lockwood, P. Kumar, G. Krikun, S. Kadner, P. Dubon, H. Critchley, and F. Schatz
Effects of Thrombin, Hypoxia, and Steroids on Interleukin-8 Expression in Decidualized Human Endometrial Stromal Cells: Implications for Long-Term Progestin-Only Contraceptive-Induced Bleeding
J. Clin. Endocrinol. Metab., March 1, 2004; 89(3): 1467 - 1475.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. J. Lockwood, G. Krikun, A. B. C. Koo, S. Kadner, and F. Schatz
Differential Effects of Thrombin and Hypoxia on Endometrial Stromal and Glandular Epithelial Cell Vascular Endothelial Growth Factor Expression
J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4280 - 4286.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
P. Caballero-Campo, F. Dominguez, J. Coloma, M. Meseguer, J. Remohi, A. Pellicer, and C. Simon
Hormonal and embryonic regulation of chemokines IL-8, MCP-1 and RANTES in the human endometrium during the window of implantation
Mol. Hum. Reprod., April 1, 2002; 8(4): 375 - 384.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
A. Akoum, C. Lawson, S. McColl, and M. Villeneuve
Ectopic endometrial cells express high concentrations of interleukin (IL)-8 in vivo regardless of the menstrual cycle phase and respond to oestradiol by up-regulating IL-1-induced IL-8 expression in vitro
Mol. Hum. Reprod., September 1, 2001; 7(9): 859 - 866.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
O. Yoshino, Y. Osuga, K. Koga, O. Tsutsumi, T. Yano, T. Fujii, K. Kugu, M. Momoeda, T. Fujiwara, K. Tomita, et al.
Evidence for the expression of interleukin (IL)-18, IL-18 receptor and IL-18 binding protein in the human endometrium
Mol. Hum. Reprod., July 1, 2001; 7(7): 649 - 654.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
K. Kitaya, J. Yasuda, I. Yagi, Y. Tada, S. Fushiki, and H. Honjo
IL-15 Expression at Human Endometrium and Decidua
Biol Reprod, September 1, 2000; 63(3): 683 - 687.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Milne, S. A.
Right arrow Articles by Baird, D. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Milne, S. A.
Right arrow Articles by Baird, D. T.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*PROGESTERONE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals