help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van de Graaf, S. A. R.
Right arrow Articles by Medeiros-Neto, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van de Graaf, S. A. R.
Right arrow Articles by Medeiros-Neto, G.
Right arrowPubmed/NCBI databases
*OMIM
*Substance via MeSH
*Genetics Home Reference
Hazardous Substances DB
*THYROGLOBULIN
The Journal of Clinical Endocrinology & Metabolism Vol. 84, No. 7 2537-2542
Copyright © 1999 by The Endocrine Society


Original Studies

A Premature Stopcodon in Thyroglobulin Messenger RNA Results in Familial Goiter and Moderate Hypothyroidism

Simone A. R. van de Graaf, Carrie Ris-Stalpers, Geertruda J. M. Veenboer, Marianne Cammenga, Cécilia Santos, Héctor M. Targovnik, Jan J. M. de Vijlder and Geraldo Medeiros-Neto

Academic Medical Center (S.A.R.v.d.G., C.R.-S., G.J.M.V., J.J.M.d.V.), University of Amsterdam, Emma Children’s Hospital AMC, Laboratory of Pediatric Endocrinology, Amsterdam, The Netherlands; Laboratório de Tireóide (LIM-25) (C.S., G.M.-N.), Hospital das Clínicas, Universidade de Sâo Paulo, Sâo Paulo 01065–970, Brazil; Division Genética (H.M.T.), Hospital de Clínicas "José de San Martin", Facultad de Medicina and Cátedra de Genética y Biología Molecular, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, 1120, Buenos Aires, Argentina

Address all correspondence and requests for reprints: Simone A.R. van de Graaf, Academic Medical Center G2–123, Laboratory of Pediatric Endocrinology, PO Box 22700, 1100 DE, Amsterdam, The Netherlands, Fax: **31.20.6916396, e-mail: S.A.vandeGraaf@amc.uva.nl.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Impaired thyroglobulin (Tg) synthesis is one of the putative causes for dyshormonogenesis of the thyroid gland. This type of hypothyroidism is characterized by intact iodide trapping, normal organification of iodide, and usually low serum Tg levels in relation to high TSH, and when untreated the patients develop goiter. In thyroid tissue from a 13-yr-old patient suspected of a thyroglobulin synthesis defect, the Tg mRNA was studied. The complete coding region of 8307 bp was directly sequenced and revealed a homozygous point mutation: a C886T transition in exon 7. Upon translation this mutation would result in a stopcodon at amino acid position 277, replacing the arginine residue. A Tg cDNA construct containing the mutation was expressed in rabbit reticulocyte lysate resulting in a truncated protein of 30 kDa. Expression in the presence of microsomal membranes resulted in a gel shift of this Tg molecule, indicating glycosylation ability. Two other siblings had a clinical presentation like the index patient, while their parents were unaffected. Additional restriction fragment length polymorphism analysis of the pedigree verified that the homozygous nonsense mutation cosegregated with the clinical phenotype. Clinically, hypothyroidism was not severe in the affected siblings because the truncated Tg glycoprotein was still capable of thyroid hormonogenesis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PRIMARY congenital hypothyroidism (CH) is caused by disorders of thyroid gland development (80%) or dyshormonogenesis (20%). In thyroid dyshormonogenesis a mutation is expected in one of the genes encoding a key protein involved in the biosynthesis of thyroid hormones (1, 2).

One of these proteins is thyroglobulin (Tg), the predominant glycoprotein (660 kDa) of the thyroid gland, which functions as matrix protein in thyroid hormonogenesis. Catalyzed by thyroid peroxidase (TPO), tyrosine residues in the Tg molecule are iodinated, and subsequently some specific ones are coupled to form mainly T4 and some T3 (2, 3). The human Tg gene, located on chromosome 8 (8q24.2–8q24.3), is over 300 kb and contains over 37 exons (4, 5, 6). We recently revised the Tg messenger RNA (mRNA) sequence that was originally reported in 1987 (7). This revealed 8307 nucleotides of coding sequence (instead of 8304), of which 66 triplets (instead of 67) encode a tyrosine residue (8). Until now, 19 polymorphisms have been identified in the thyroglobulin gene locus, of which 8 result in amino acid residue variation (8, 9, 10). Furthermore, at least 12 alternative splice products have been identified in normal Tg mRNAs (10, 11, 12, 13, 14, 15, 16). Beside these wildtype variations, some mutations in the Tg gene have been identified in animal models and in man, resulting in aberrant Tg protein expression and linked to subsequent impaired thyroid hormone synthesis.

In Afrikander cattle a homozygous nonsense mutation, Arg697OPA (exon 9), results in the expression of a truncated Tg protein of 75 kDa. In this case also, an alternatively spliced mRNA lacking exon 9 sequence is observed, encoding a Tg protein of 250 kDa (17, 18). In Dutch goats, a homozygous nonsense mutation, Tyr296AMB, results in a truncated Tg protein product (40 kDa in vivo) and causes hypothyroidism with goiter (19, 20). Furthermore, in a mouse model, congenital goiter (cog/cog) is linked to the Tg locus (21), and the mutation has recently been identified as Leu2366Pro (22).

So far in only three patients with congenital hypothyroidism and goiter has a mutation in the Tg gene been elucidated. A homozygous mutation at the acceptor splice site of intron 3 results in the in-frame deletion of exon 4 sequences (nt 275 - 478) from the mRNA, which results in an aberrant Tg protein lacking hormonogenic site Tyr130 (15). A homozygous in-frame mRNA deletion is described of 138 bp (nt 5552–5789)(23). The preferential accumulation of a Tg mRNA alternative splice product with an in-frame deletion of 171 bp (nt 4529–4699, exon 22) has also been reported, linked to a homozygous nonsense mutation at position 1510 (13).

In the present study, we have identified a homozygous nonsense mutation in the thyroglobulin mRNA of a moderately hypothyroid patient with goiter.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Patients

Figure 1Go shows the pedigree of a Brazilian family with goiter in three affected siblings (Table 1Go).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. Family pedigree of index patient.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Clinical and laboratory data from the affected siblings

 
Patient IV-2: female, first examined at the age of 17. She developed normally and had menarche at 15 yr of age. Her height was 149 cm, and her weight 43.5 kg. The thyroid gland was diffusely enlarged (65 g; normal: 7.4 ± 2.2 g), and ultrasonography indicated a nodule of 15 mm in the left lobe with micro-calcifications. She has two unaffected children (V-1, V-2) from a consanguineous marriage.

Patient IV-6 (index patient): male, first examined at the age of 13. At presentation, he showed clinical signs of hypothyroidism and stunted growth (bone age, 7 yr). His mental function was normal. The thyroid gland was diffusely enlarged (60 g; normal: 7.4 ± 2.2 g), and ultrasonography indicated a nodule of 13 mm in the right lobe.

Patient IV-10: male, first examined at the age of 2. He developed slowly and showed retarded growth (bone age, 3 months). His mental function appeared to be normal. Ultrasonography of the thyroid gland indicated a diffuse heterogeneous goiter of 13.5 g (normal: 4.1 ± 1.1 g).

Patients IV-2 and IV-6 were subjected to subtotal thyroidectomy to correct compressive symptoms and have received total thyroxine supplementation since that time.

Both anti-TPO and anti-Tg antibody tests were repeatedly negative in all three patients. No data were available on iodine intake and urinary secretion.

Microscopic examination of the goitrous tissue revealed the classic macro-follicular pattern, with dilated follicles lined with high columnar cells and follicular lumen devoid of colloid. Immunostaining for Tg indicated the presence of Tg-related antigens only inside the cells.

RNA isolation and complementary DNA (cDNA) preparation, genomic DNA isolation

Total RNA was isolated from goitrous (patient IV-6) and control thyroid tissue using TRIzol®Reagent (Life Technologies BV). cDNA was synthesized using random hexamers and reverse transcriptase according to standard procedures.

Genomic DNA of patient IV-6 was isolated from one of the TRIzol fractions, and genomic DNA of the indicated family members was isolated from white blood cells by the SDS-proteinase K method (24).

DNA amplification

PCR amplification (25) was performed using 100 ng cDNA as template in a total reaction volume of 25 µL.

For nucleotide sequencing, fragments of 500 bp (with 20–70 bp overlap) were amplified with 2.5 units of AmpliTaq DNA polymerase (Perkin Elmer) using the protocol: 2 min 94 C; 35 cycles of 15 sec 94 C, 1 min 60 C, 1 min 72 C; 10 min 72 C. The human Tg specific oligonucleotides (synthesized on Expedite Nucleic Acid Synthesis System, Millipore Corp.) coupled to M13 tags are already described (10). Reactions were electrophoresed on 0.8 agarose gel and purified using the Quiaquick DNA gel extraction kit (Quiagen).

For determination of alternative splice products, a cDNA fragment ranging from exon 4 to exon 9 (nt 400-1350) was amplified with 2.5 units of AmpliTaq DNA polymerase (Perkin Elmer) using the protocol: 2 min 94 C; 35 cycles of 15 sec 94 C, 1 min 57 C, 1.5 min 72 C; 10 min 72 C. M13 linked oligonucleotides 2F (nt 400) and 3R (nt 1350) were used (10).

For subcloning purposes, the same conditions and oligonucleotides were used.

For restriction fragment length polymorphism (RFLP) analysis, genomic DNA was amplified using the protocol: 5 min 95 C; 35 cycles of 1 min 95 C, 1 min 57 C, 1.5 min 72 C; 10 min 72 C, 2.5 units of AmpliTaq DNA polymerase (Perkin Elmer), and the following oligonucleotides: (794) 5' TGGACCTTCCTTCCACCTTCACTG 3' and (1002) 5' CCTTCCGTCTGGCACTGCA 3'.

Nucleotide sequence analysis

DNA amplification resulted in 20 fragments of approximately 500 bp covering the entire thyroglobulin cDNA of patient IV-6.

Both the sense and antisense strand were sequenced using either the M13 tags linked to the PCR fragments with the Big Dye Primer Cycle Sequencing Kit or the Tg-specific oligonucleotides with the Big Dyedeoxyterminator Cycle Sequencing Kit, depending on the GC content of the fragment (both kits from PE Applied Biosystems/Perkin Elmer). After electrophoresis on a sequencing gel, the samples were analyzed on the ABI Prism 377 DNA sequencer and aligned to the Tg cDNA sequence (8, 10) using AutoAssembler software (PE Applied Biosystems/Perkin Elmer).

Determination of alternative splice products

The coding region of nt 400-1350 (exon 4–9) was amplified on mRNA of patient IV-6 and of wildtype, and the reactions were run on a 1.2% agarose gel stained with ethidium bromide.

Subcloning of mutated Tg fragment

The TGI construct (8) containing wildtype Tg nucleotides -6 to 2110 in the pcDNA3 plasmid (TG-WT) was restricted with Bsu36 I, thereby deleting the wildtype sequence from nt 686-1137, and purified from a 0.8% agarose gel. The amplified product of 950 bp, containing the mutation at nt position 886 was also restricted with Bsu36 I. The mutant fragment of 451 bp was purified from a 1.2% agarose gel and ligated into the digested TG-WT resulting in TG-M. By automatic sequencing using Tg specific primers, the nt sequence was validated.

The protocols used for digesting with Bsu36 I (Biolabs) and for ligation with T4 ligase (Boehringer Mannheim; rapid DNA ligation kit) were according to the manufacturer. For gel purification, the Quiaquick DNA gel extraction kit (Quiagen) was used. Standard heat shock transformation was performed with DH5{alpha} competent cells (Gibco BRL).

Expression of Tg in rabbit reticulocyte lysate and analysis

For in vitro transcription and translation a TnT® T7 Coupled Reticulocyte Lysate System was used (Promega Corp.), providing rabbit reticulocyte lysate, a reaction buffer, T7 RNA polymerase, and an amino acid mixture lacking cysteine. Reactions of 25 µL were done, adding Rnasin® Ribonuclease Inhibitor (Promega Corp.), a mixture of 35S-methionine and 35S-cysteine (ICN Pharmaceuticals, Inc.; Tran35S-label). To obtain glycosylation, Canine Pancreatic Microsomal Membranes (CPMM) (Promega Corp.) were added. In each reaction 300 ng plasmid DNA was used as template (TG-WT or TG-M or positive control). Positive control 1 was used to check for expression of a protein of 61 kDa mol wt. Control sample 2 was used to check for glycosylation. Incubation was done at 30 C for 90 min.

Aliquots of 5 µL (minus CPMM) or 10 µL (plus CPMM) of reticulocyte lysate reactions, together with a molecular weight marker (Biolabs; Rainbow general), were subjected to SDS-PAGE according to Laemmli’s method (17.5%), and the gel was dried afterwards. The radioactive signal of expressed proteins was detected using a Phosphorimager and Image Quant software (Molecular Dynamics, Inc.).

Protein products from 40 µL reticulocyte lysate reactions, were immunoprecipitated using a rabbit polyclonal antibody specific for human Tg (26) coupled to protein A-sepharose CL-4B (Pharmacia Biotech) and were analyzed identically.

Restriction fragment length polymorphism analysis

The mutation detected by nucleotide sequencing at position 886 created an AlwN I recognition site. This enzyme was used according to the manufacturers protocol to screen for the presence of the mutation in the amplified genomic DNA Tg fragment of the indicated family members (III-1, III-2, IV-6, IV-10, IV-2, V-1, V-2) and of a wildtype control. The samples were run on 2.5% agarose gel and stained with ethidium bromide.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The index patient (IV-6), suspected of having a defect in thyroglobulin synthesis as a cause for hypothyroidism, was subjected to subtotal thyroidectomy, and thyroid tissue was available to screen for Tg mutations. RT-PCR was performed on the total RNA isolated from this tissue, resulting in 20 overlapping fragments of 500 bp each, covering the total coding region of 8307 bp. Direct sequencing revealed a cytosine-to-thymidine mutation at nt position 886 (Fig. 2AGo). Its position in the gene near the end of exon 7 is schematically given in Fig. 2BGo, and the supposed amino acid sequence after translation is also shown. Instead of encoding for an arginine residue on position 277, the triplet harboring the mutation encodes a stopcodon.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 2. Screening for mutation in Tg mRNA. A, Part of wildtype and mutated (patient IV-6) thyroglobulin mRNA sequence. The arrow points to the homozygous C886T transition. B, Schematic drawing of thyroglobulin mRNA. Top: coding region from nt 1–8307 (italics) appears as an open box, 5' and 3' untranslated regions are indicated as solid lines. Middle: part of the Tg gene showing exon 7 and exon 8 (introns as dashed lines). Bottom: coding nt sequences and corresponding aa sequences are shown (AlwN I recognition site is underlined). C, Agarose electrophoresis and ethidium bromide visualization of AlwN I RFLP analysis. Shown are the mol wt marker lane (bp), wildtype control plus or minus AlwN I, respectively, and the PCR amplified genomic DNA fragment (exon 7 - 8) of several family members after digestion. The open arrow indicates undigested wildtype fragment, and the filled arrows indicate mutant fragments resulting from AlwN I digestion.

 
Because the C886T transition induces a AlwN I restriction site, carriership for the mutation could be established using RFLP analysis. Therefore a fragment ranging from exon 7 to 8 (including intron 7 of 200 bp) was amplified on genomic DNA, isolated from blood of different family members: III-1, III-2, IV-6 (index patient), IV-10, IV-2, V-1, and V-2 (Fig. 1Go). The wildtype amplified fragment of 400 bp was not digestible by AlwN I. The AlwN I digestion of the mutated fragment resulted in two fragments of about 300 and 100 bp (Fig. 2CGo). All affected siblings (IV-6, -10, -2) showed two fragments after digestion (300 and 100 bp) and are homozygous for the mutation. Both parents (III-1, -2) and the youngest offspring (V-1, -2) showed three fragments after digestion (400, 300, and 100 bp) and are heterozygous (carriers).

To determine whether the nonsense mutation caused alternative splicing of exon 7, a cDNA fragment ranging from exon 4 to 9 was amplified from mRNA of patient IV-6 and a wildtype control (data not shown). No difference in either splicing or abundance of the amplified product was detected.

The mutation was expected to result in a truncated Tg molecule upon translation, still harboring putative N-glycosylation sites. To examine translation and putative glycosylation in relation to the mutation, a cell-free in vitro transcription/translation system (rabbit reticulocyte lysate + T7 RNA polymerase) was used in which glycosylation conditions could be established by addition of microsomal membranes (CPMM). For comparison two expression constructs were used containing the first 2110 bp of coding Tg sequence: wildtype (TG-WT) and mutant (TG-M). 35S-labeled methionine and cysteine were incorporated, enabling visualization of the expressed protein after SDS-PAGE using the Phosphorimager. The apparent mol wts of the proteins expressed from TG-WT and TG-M were respectively 76,000 and 30,000 (Fig. 3AGo). After addition of CPMM, both TG-WT and TG-M proteins were glycosylated, as observed by a shift in apparent molecular weight, although the expression of the TG-WT was low (Fig. 3BGo). The controls 1 and 2 provided by the manufacturer showed that both translation (Fig. 3AGo, lane control 1) and glycosylation (Fig. 3BGo, lane control 2) occurred. To validate that the expressed proteins were human thyroglobulin fragments, the reaction samples were immunoprecipitated with an anti-human-Tg polyclonal. Specific recognition of the Tg wildtype and mutant proteins with and without glycosylation is shown in Fig. 3CGo and 3DGo respectively.



View larger version (93K):
[in this window]
[in a new window]
 
Figure 3. In vitro expression of wildtype and mutant Tg fragment. Incubations of rabbit reticulocyte lysates with wildtype (TG-WT) or mutant (TG-M) or control (provided by the kit) templates or no template (none) were performed with 35S-labeled amino acids. After SDS-PAGE, proteins were visualized using the Phosphorimager. Open arrows indicate wildtype Tg proteins, and filled arrows indicate mutant Tg proteins. Panels A and C correspond with the arrows on the left. In the reactions shown in panels B and D, microsomal membranes were added to provide glycosylation (corresponding with arrows on the right). Panels C and D show the electrophoresis of immunoprecipitated samples. The mol wt marker bands are indicated (kDa).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this paper we present the results of studies conducted in a family in which goiter and hypothyroidism occur. Three siblings out of ten, from a consanguineous marriage, showed thyroid function abnormalities (Fig. 1Go), in accordance with a Mendelian pattern of inheritance of an autosomal recessive mutation. The affected family members all showed goiter with moderate hypothyroidism. Serum Tg levels were relatively low despite the high serum TSH levels and did not increase after exogenous bovine TSH stimulation (27). The absence of an iodide organification defect was based on the results of the radioactive iodide uptake studies (RAI): a high and rapid uptake and no iodide washout effect by administered perchlorate ions (Table 1Go). These characteristics indicated a defect in thyroglobulin synthesis.

After sequencing the total Tg cDNA of patient IV-6, a homozygous nonsense mutation was determined, which resulted in an AlwN I recognition site (Fig. 2Go). RFLP analysis demonstrated that both parents were heterozygous for this mutation and that all three affected siblings carried the same mutated Tg alleles. The mutation is a cytosine-to-thymidine transition at nt position 886 in exon 7, creating a stopcodon at amino acid Arg277. The change occurs in a CpG dinucleotide and can be caused by deamination of a methylated cytosine to thymine (28). Furthermore, the CGA arginine codon is considered a "hot spot" for mutations (29).

RNA transcripts containing a premature stopcodon may be relatively unstable because the untranslated part of the messenger is not protected by ribosomes (13, 19). However, we have no indication that the mRNA of patient IV-6 was very unstable because, after total RNA isolation and RT-PCR amplification of 500 - 950 bp fragments, the results of normal and patient’s thyroid tissues were similar with respect to the quantity of the generated products. The amount of tissue, however, was not sufficient to perform a Northern blot.

No differences were detected in expression of the described alternative transcripts (10) compared with normals (data not shown). After RT-PCR amplification of a fragment from nt 400-1350 (exon 4 to 9) no differences in product length and abundance were detected between patient and wildtype samples. This excluded an alternative splice event of the Tg RNA, as is described for Afrikander cattle (17) and human (13), where a nonsense mutation at amino acid residue 687 and residue 1510, respectively, results in a relatively increased expression of a smaller messenger RNA species lacking the mutated exon. The specific skipping of exons containing a nonsense mutation has also been described elsewhere (30).

Upon translation the mutated Tg transcript generated a Tg protein, validated by immunoprecipitation with a specific antihuman-Tg antibody, with an apparent mol wt of 30,000 (Fig. 3Go). This was in good accordance with the predicted mol wt of 30,778 (276 amino acid residues). Three putative N-linked glycosylation sites are still present in this truncated protein, of which two have been shown to be glycosylated in the mature protein (Asn57 and Asn179) (31). The use of microsomal membranes in the in vitro expression assay indicated that the aberrant Tg protein could indeed be glycosylated.

It has been reported that the phenotypic expression of defective Tg protein varies considerably when different families or affected siblings within the same family are compared (32). Although the laboratory tests were performed at a younger age in patient IV-10 than in patients IV-2 and IV-6, it seems that the consequences of the defective Tg synthesis in patient IV-2 are less severe. Apparently the goiter is able to compensate for the hypothyroid status with a somewhat elevated TSH. Her brothers show diminished total T4 levels while their total T3 levels are in the normal range (Table 1Go).

Thyroid hormone synthesis involves a two-step modification of tyrosine residues. Iodination and subsequent coupling take place at the apical membrane of the cell, and both reactions are catalyzed by thyroid peroxidase (2, 3). The specific iodinated tyrosine residues that are involved in the coupling reaction can either accept (hormonogenic sites) or donate iodinated phenyl groups. The most important acceptor site in all vertebrate species examined is at Tyr5, while priority for hormonogenesis at the other acceptor sites Tyr1291, Tyr2554, and Tyr2747 varies among species (2). For human Tg, three potential donor sites have been identified so far (Tyr130, Tyr847, Tyr1488) (33). The truncated form of Tg described here harbors both the acceptor Tyr5 and the donor Tyr130 residues. This feature, as well as its size and ability to become glycosylated, makes it comparable to the truncated Tg product in the goitrous Dutch goats. In these animals the glycosylated Tg fragment (mol wt of 40,000) was able to synthesize T4in vivo, and the amounts produced were comparable to normal when 1 mg iodide/day was administered, although goiter remained (34). It has also been reported that, in man, oral administration of excess iodine can partially correct the hypothyroid condition in patients with defective Tg synthesis (35). Therefore iodide administration may explain in part the variability in the clinical presentation of the affected individuals within this family.

In conclusion, molecular analysis of a family with hereditary hypothyroidism and goiter reveals a novel autosomal recessive mutation in the thyroglobulin gene. The mutation is a C-to-T transition at nt position 886 in exon 7, creating a stopcodon at amino acid Arg277. The expressed truncated Tg protein has a mol wt of 30,778, can be glycosylated, and is still able to produce thyroid hormone.


    Acknowledgments
 
We thank J. Vono, M.D., for the clinical work on this family.


    Footnotes
 
This work was supported in part by the Ludgardine Bouwman Foundation (The Netherlands) and by Grant 96/00998 from the Sâo Paulo State (Brazil) Research Foundation (FAPESP).

Received December 30, 1998.

Revised March 25, 1999.

Accepted April 8, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. de Vijlder JJM, Vulsma T. 1996 Hereditary metabolic disorders causing hypothyroidism. In: Braverman LE, Utiger RD, eds. Werner’s & Ingbar’s The Thyroid. Philadelphia: J.B. Lippincott Company; 749–755.
  2. Dunn JT. 1996 Thyroglobulin: chemistry and biosynthesis. In: Braverman LE, Utiger RD, eds. Werner’s & Ingbar’s The Thyroid. Philadelphia: J.B. Lippincott Company; 85–95.
  3. de Vijlder JJM, den Hartog MT. 1997 Anionic iodotyrosine residues are required for iodothyronine synthesis. Eur J Endocrinol. 138:227–231.
  4. Baas F, Bikker H, Geurts van Kessel A, et al. 1985 The human thyroglobulin gene: a polymorphic marker localized distal to c-myc on chromosome 8 band q24. Hum Genet. 69:138–145.[CrossRef][Medline]
  5. Bergé-Lefranc JL, Cartouzou G, Mattei MG, Passage E, Malezet-Desmoulins C, Lissitzky S. 1985 Localization of the thyroglobulin gene by in situ hybridization to human chromosomes. Hum Genet. 69:28–31.[CrossRef][Medline]
  6. Baas F, van Ommen GJ, Bikker H, Arnberg AC, de Vijlder JJM. 1986 The human thyroglobulin gene is over 300 kb long and contains introns of up to 64 kb. Nucleic Acids Res. 14:5171–5186.[Abstract/Free Full Text]
  7. Malthièry Y, Lissitzky S. 1987 The primary structure of human thyroglobulin deduced from the sequence of its 8448 base complementary DNA. Eur J Biochem. 165:491–498.[Medline]
  8. van de Graaf SAR, Pauws E, de Vijlder JJM, Ris-Stalpers C. 1997 The revised 8307 base pair coding sequence of human thyroglobulin transiently expressed in eukaryotic cells. Eur J Endocrinol. 136:508–515.[Abstract/Free Full Text]
  9. Mendive FM, Vassart G, Targovnik HM. 1997 Identification of a new thyroglobulin variant: the guanine-to-adenine transition resulting in substitution of arginine 2510 by glutamine. Thyroid. 7:587–591.[Medline]
  10. van de Graaf SAR, Cammenga C, Ponne NJ, et al. 1999 The screening for mutations in the thyroglobulin cDNA from six patients with congenital hypothyroidism. Biochimie. 81:425–432.[Medline]
  11. Mason ME, Dunn D, Wortsman J, et al. 1995 Thyroids from siblings with Pendred’s syndrome contain thyroglobulin messenger ribonucleic acid variants. J Clin Endocrinol Metab. 80:497–503.[Abstract]
  12. Bertaux F, Noel M, Lasmoles F, Fragu P. 1995 Identification of the exon structure and four alternative transcripts of the thyroglobulin-encoding gene. Gene. 156:297–301.[CrossRef][Medline]
  13. Targovnik HM, Medeiros-Neto G, Varela V, Cochaux P, Wajchenberg BL, Vassart G. 1993 A nonsense mutation causes human hereditary congenital goiter with preferential production of a 171-nucleotide-deleted thyroglobulin ribonucleic acid messenger. J Clin Endocrinol Metab. 77:210–215.[Abstract]
  14. Targovnik HM, Cochaux P, Corach D, Vassart G. 1992 Identification of a minor Tg mRNA transcript in RNA from normal and goitrous thyroids. Mol Cel Endocrinol. 84:R23–R26.
  15. Ieiri T, Cochaux P, Targovnik HM, et al. 1991 A 3' splice site mutation in the thyroglobulin gene responsible for congenital goiter with hypothyroidism. J Clin Invest. 88:1901–1905.
  16. Bertaux F, Noel M, Malthièry Y, Fragu P. 1991 Demonstration of a hetero-genous transcription pattern of thyroglobulin mRNA in human thyroid tissues. Biochem Biophys Res Commun. 178:586–592.[CrossRef][Medline]
  17. Ricketts MH, Simons MJ, Parma J, Mercken L, Dong Q, Vassart G. 1987 A nonsense mutation causes hereditary goitre in the Afrikander cattle and unmasks alternative splicing of thyroglobulin transcripts. Proc Natl Acad Sci USA. 84:3181–3184.[Abstract/Free Full Text]
  18. Tassi VPN, Di Lauro R, van Jaarsveld P, Alvino CG. 1984 Two abnormal thyroglobulin-like polypeptides are produced from Afrikander cattle congenital goiter mRNA. J Biol Chem. 259:10507–10510.[Abstract/Free Full Text]
  19. Veenboer GJM, de Vijlder JJM. 1993 Molecular basis of the thyroglobulin synthesis defect in Dutch goats. Endocrinology. 132:377–381.[Abstract/Free Full Text]
  20. Sterk A, van Dijk JE, Veenboer GJM, Moorman AFM, de Vijlder JJM. 1989 Normal sized thyroglobulin mRNA in Dutch goats with a thyroglobulin synthesis defect is translated into a 35,000 molecular weight N-terminal fragment. Endocrinology. 124:477–483.[Abstract/Free Full Text]
  21. Taylor BA, Rowe L. 1987 The congenital goiter mutation is linked to the thyroglobulin gene in the mouse. Proc Natl Acad Sci USA. 84:1986–1990.[Abstract/Free Full Text]
  22. Kim PS, Hossain SA, Park YN, Lee I, Yoo SE, Arvan P. 1998 A single amino acid change in the acetylcholesterase-like domain of thyroglobulin causes congenital goiter with hypothyroidism in the cog/cog mouse - a model of human endoplasmatic storage diseases. Proc Natl Acad Sci USA. 95:9909–9913.[Abstract/Free Full Text]
  23. Targovnik HM, Vono J, Billerbeck AEC, et al. 1995 A 138-nucleotide-deletion in the thyroglobulin ribonucleic acid messenger in a congenital goiter with defective thyroglobulin synthesis. J Clin Endocrinol Metab. 80:3356–3360.[Abstract]
  24. Sambrook J, Fritsch EF, Maniatis T. 1989 Molecular cloning-a laboratory manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory.
  25. Saiki RK, Gelfland DH, Stoffel S, et al. 1988 Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239:487–491.[Abstract/Free Full Text]
  26. Den Hartog MT, de Boer M, Veenboer GJM, de Vijlder JJM. 1990 Generation and characterization of monoclonal antibodies directed against noniodinated and iodinated thyroglobulin, among which are antibodies against hormonogenic sites. Endocrinology. 127:3160–3165.[Abstract/Free Full Text]
  27. Medeiros-Neto G, Marcondes JA, Cavaliere H, Wajchenberg BL, Knobel M. 1985 Serum thyroglobulin (Tg) stimulation with bovine TSH: an useful test for diagnosis of congenital goitrous hypothyroidism due to defective Tg synthesis. Acta Endocrinol (Copenh). 110:61–65.[Abstract/Free Full Text]
  28. Coulondre C, Miller JH, Farabaugh PJ, Gilbert W. 1978 Molecular basis of base substitution hotspots in Escherichia coli. Nature. 274:775–780.[CrossRef][Medline]
  29. Antonarakis SE, Kazazian HH. 1988 The molecular basis of hemophilia A in man. Trends Genet. 4:233–237.[CrossRef][Medline]
  30. Dietz HC, Valle D, Francomano CA, Kendzior RJ, Pyeritz RE, Cutting GR. 1993 The skipping of constitutive exons in vivo induced by nonsense mutations. Science. 259:680–683.[Abstract/Free Full Text]
  31. Yang S-X, Pollock HG, Rawitch AB. 1996 Glycosylation in human thyroglobulin: location of the N-linked oligosaccharide units and comparison with bovine thyroglobulin. Arch Biochem Biophys. 327:61–70.[CrossRef][Medline]
  32. Medeiros-Neto G, Targovnik HM, Vassart G. 1993 Defective thyroglobulin synthesis and secretion causing goiter and hypothyroidism. Endocr Rev. 14:165–183.[Abstract/Free Full Text]
  33. Lamas L, Anderson PC, Fox JW, Dunn JT. 1989 Consensus sequences for early iodination and hormonogenesis in human thyroglobulin. J Biol Chem. 264:13541–13545.[Abstract/Free Full Text]
  34. de Vijlder JJM, van Voorthuizen WF, van Dijk JE, et al. 1978 Hereditary congenital goiter with thyroglobulin deficiency in a breed of goats. Endocrinology. 102:2105–2111.
  35. Vono J, Lima N, Knobel M, Medeiros-Neto GA. 1996 The effect of oral administration of iodine to patients with goiter and hypothyroidism due to defective synthesis of thyroglobulin. Thyroid. 6:11–15.[Medline]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
P. S. Kim, J. Lee, P. Jongsamak, S. Menon, B. Li, S. A. Hossain, J.-H. Bae, B. Panijpan, and P. Arvan
Defective Protein Folding and Intracellular Retention of Thyroglobulin-R19K Mutant as a Cause of Human Congenital Goiter
Mol. Endocrinol., February 1, 2008; 22(2): 477 - 484.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M. Caputo, C. M Rivolta, V. J Gutnisky, L. Gruneiro-Papendieck, A. Chiesa, G. Medeiros-Neto, R. Gonzalez-Sarmiento, and H. M Targovnik
Recurrence of the p.R277X/p.R1511X compound heterozygous mutation in the thyroglobulin gene in unrelated families with congenital goiter and hypothyroidism: haplotype analysis using intragenic thyroglobulin polymorphisms
J. Endocrinol., October 1, 2007; 195(1): 167 - 177.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Y. Kanou, A. Hishinuma, K. Tsunekawa, K. Seki, Y. Mizuno, H. Fujisawa, T. Imai, Y. Miura, T. Nagasaka, C. Yamada, et al.
Thyroglobulin Gene Mutations Producing Defective Intracellular Transport of Thyroglobulin Are Associated with Increased Thyroidal Type 2 Iodothyronine Deiodinase Activity
J. Clin. Endocrinol. Metab., April 1, 2007; 92(4): 1451 - 1457.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Hishinuma, S. Fukata, S. Nishiyama, Y. Nishi, M. Oh-Ishi, Y. Murata, Y. Ohyama, N. Matsuura, K. Kasai, S. Harada, et al.
Haplotype Analysis Reveals Founder Effects of Thyroglobulin Gene Mutations C1058R and C1977S in Japan
J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 3100 - 3104.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. S. Alzahrani, E. Y. Baitei, M. Zou, and Y. Shi
Metastatic Follicular Thyroid Carcinoma Arising from Congenital Goiter as a Result of a Novel Splice Donor Site Mutation in the Thyroglobulin Gene
J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 740 - 746.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. M. Rivolta, C. M. Moya, V. J. Gutnisky, V. Varela, J. M. Miralles-Garcia, R. Gonzalez-Sarmiento, and H. M. Targovnik
A New Case of Congenital Goiter with Hypothyroidism Caused by a Homozygous p.R277X Mutation in the Exon 7 of the Thyroglobulin Gene: A Mutational Hot Spot Could Explain the Recurrence of This Mutation
J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3766 - 3770.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S M Park and V K K Chatterjee
Genetics of congenital hypothyroidism
J. Med. Genet., May 1, 2005; 42(5): 379 - 389.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
V. J. Gutnisky, C. M. Moya, C. M. Rivolta, S. Domene, V. Varela, J. V. Toniolo, G. Medeiros-Neto, and H. M. Targovnik
Two Distinct Compound Heterozygous Constellations (R277X/IVS34-1G>C and R277X/R1511X) in the Thyroglobulin (TG) Gene in Affected Individuals of a Brazilian Kindred with Congenital Goiter and Defective TG Synthesis
J. Clin. Endocrinol. Metab., February 1, 2004; 89(2): 646 - 657.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. Caron, C. M. Moya, D. Malet, V. J. Gutnisky, B. Chabardes, C. M. Rivolta, and H. M. Targovnik
Compound Heterozygous Mutations in the Thyroglobulin Gene (1143delC and 6725G->A [R2223H]) Resulting in Fetal Goitrous Hypothyroidism
J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3546 - 3553.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Ozisik, G. Mantovani, J. C. Achermann, L. Persani, A. Spada, J. Weiss, P. Beck-Peccoz, and J. L. Jameson
An Alternate Translation Initiation Site Circumvents an Amino-Terminal DAX1 Nonsense Mutation Leading to a Mild Form of X-Linked Adrenal Hypoplasia Congenita
J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 417 - 423.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Leonardi, P. Vito, C. Mauro, F. Pacifico, L. Ulianich, E. Consiglio, S. Formisano, and B. Di Jeso
Endoplasmic Reticulum Stress Causes Thyroglobulin Retention in this Organelle and Triggers Activation of Nuclear Factor-{kappa}B Via Tumor Necrosis Factor Receptor-Associated Factor 2
Endocrinology, June 1, 2002; 143(6): 2169 - 2177.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Hishinuma, S.-I. Furudate, M. Oh-Ishi, N. Nagakubo, T. Namatame, and T. Ieiri
A Novel Missense Mutation (G2320R) in Thyroglobulin Causes Hypothyroidism in rdw Rats
Endocrinology, November 1, 2000; 141(11): 4050 - 4055.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van de Graaf, S. A. R.
Right arrow Articles by Medeiros-Neto, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van de Graaf, S. A. R.
Right arrow Articles by Medeiros-Neto, G.
Right arrowPubmed/NCBI databases
*OMIM
*Substance via MeSH
*Genetics Home Reference
Hazardous Substances DB
*THYROGLOBULIN


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals