| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Academic Medical Center (S.A.R.v.d.G., C.R.-S., G.J.M.V., J.J.M.d.V.), University of Amsterdam, Emma Childrens Hospital AMC, Laboratory of Pediatric Endocrinology, Amsterdam, The Netherlands; Laboratório de Tireóide (LIM-25) (C.S., G.M.-N.), Hospital das Clínicas, Universidade de Sâo Paulo, Sâo Paulo 01065970, Brazil; Division Genética (H.M.T.), Hospital de Clínicas "José de San Martin", Facultad de Medicina and Cátedra de Genética y Biología Molecular, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, 1120, Buenos Aires, Argentina
Address all correspondence and requests for reprints: Simone A.R. van de Graaf, Academic Medical Center G2123, Laboratory of Pediatric Endocrinology, PO Box 22700, 1100 DE, Amsterdam, The Netherlands, Fax: **31.20.6916396, e-mail: S.A.vandeGraaf@amc.uva.nl.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
One of these proteins is thyroglobulin (Tg), the predominant glycoprotein (660 kDa) of the thyroid gland, which functions as matrix protein in thyroid hormonogenesis. Catalyzed by thyroid peroxidase (TPO), tyrosine residues in the Tg molecule are iodinated, and subsequently some specific ones are coupled to form mainly T4 and some T3 (2, 3). The human Tg gene, located on chromosome 8 (8q24.28q24.3), is over 300 kb and contains over 37 exons (4, 5, 6). We recently revised the Tg messenger RNA (mRNA) sequence that was originally reported in 1987 (7). This revealed 8307 nucleotides of coding sequence (instead of 8304), of which 66 triplets (instead of 67) encode a tyrosine residue (8). Until now, 19 polymorphisms have been identified in the thyroglobulin gene locus, of which 8 result in amino acid residue variation (8, 9, 10). Furthermore, at least 12 alternative splice products have been identified in normal Tg mRNAs (10, 11, 12, 13, 14, 15, 16). Beside these wildtype variations, some mutations in the Tg gene have been identified in animal models and in man, resulting in aberrant Tg protein expression and linked to subsequent impaired thyroid hormone synthesis.
In Afrikander cattle a homozygous nonsense mutation, Arg697OPA (exon 9), results in the expression of a truncated Tg protein of 75 kDa. In this case also, an alternatively spliced mRNA lacking exon 9 sequence is observed, encoding a Tg protein of 250 kDa (17, 18). In Dutch goats, a homozygous nonsense mutation, Tyr296AMB, results in a truncated Tg protein product (40 kDa in vivo) and causes hypothyroidism with goiter (19, 20). Furthermore, in a mouse model, congenital goiter (cog/cog) is linked to the Tg locus (21), and the mutation has recently been identified as Leu2366Pro (22).
So far in only three patients with congenital hypothyroidism and goiter has a mutation in the Tg gene been elucidated. A homozygous mutation at the acceptor splice site of intron 3 results in the in-frame deletion of exon 4 sequences (nt 275 - 478) from the mRNA, which results in an aberrant Tg protein lacking hormonogenic site Tyr130 (15). A homozygous in-frame mRNA deletion is described of 138 bp (nt 55525789)(23). The preferential accumulation of a Tg mRNA alternative splice product with an in-frame deletion of 171 bp (nt 45294699, exon 22) has also been reported, linked to a homozygous nonsense mutation at position 1510 (13).
In the present study, we have identified a homozygous nonsense mutation in the thyroglobulin mRNA of a moderately hypothyroid patient with goiter.
| Materials and Methods |
|---|
|
|
|---|
Figure 1
shows the pedigree of a
Brazilian family with goiter in three affected siblings (Table 1
).
|
|
Patient IV-6 (index patient): male, first examined at the age of 13. At presentation, he showed clinical signs of hypothyroidism and stunted growth (bone age, 7 yr). His mental function was normal. The thyroid gland was diffusely enlarged (60 g; normal: 7.4 ± 2.2 g), and ultrasonography indicated a nodule of 13 mm in the right lobe.
Patient IV-10: male, first examined at the age of 2. He developed slowly and showed retarded growth (bone age, 3 months). His mental function appeared to be normal. Ultrasonography of the thyroid gland indicated a diffuse heterogeneous goiter of 13.5 g (normal: 4.1 ± 1.1 g).
Patients IV-2 and IV-6 were subjected to subtotal thyroidectomy to correct compressive symptoms and have received total thyroxine supplementation since that time.
Both anti-TPO and anti-Tg antibody tests were repeatedly negative in all three patients. No data were available on iodine intake and urinary secretion.
Microscopic examination of the goitrous tissue revealed the classic macro-follicular pattern, with dilated follicles lined with high columnar cells and follicular lumen devoid of colloid. Immunostaining for Tg indicated the presence of Tg-related antigens only inside the cells.
RNA isolation and complementary DNA (cDNA) preparation, genomic DNA isolation
Total RNA was isolated from goitrous (patient IV-6) and control thyroid tissue using TRIzol®Reagent (Life Technologies BV). cDNA was synthesized using random hexamers and reverse transcriptase according to standard procedures.
Genomic DNA of patient IV-6 was isolated from one of the TRIzol fractions, and genomic DNA of the indicated family members was isolated from white blood cells by the SDS-proteinase K method (24).
DNA amplification
PCR amplification (25) was performed using 100 ng cDNA as template in a total reaction volume of 25 µL.
For nucleotide sequencing, fragments of 500 bp (with 2070 bp overlap) were amplified with 2.5 units of AmpliTaq DNA polymerase (Perkin Elmer) using the protocol: 2 min 94 C; 35 cycles of 15 sec 94 C, 1 min 60 C, 1 min 72 C; 10 min 72 C. The human Tg specific oligonucleotides (synthesized on Expedite Nucleic Acid Synthesis System, Millipore Corp.) coupled to M13 tags are already described (10). Reactions were electrophoresed on 0.8 agarose gel and purified using the Quiaquick DNA gel extraction kit (Quiagen).
For determination of alternative splice products, a cDNA fragment ranging from exon 4 to exon 9 (nt 400-1350) was amplified with 2.5 units of AmpliTaq DNA polymerase (Perkin Elmer) using the protocol: 2 min 94 C; 35 cycles of 15 sec 94 C, 1 min 57 C, 1.5 min 72 C; 10 min 72 C. M13 linked oligonucleotides 2F (nt 400) and 3R (nt 1350) were used (10).
For subcloning purposes, the same conditions and oligonucleotides were used.
For restriction fragment length polymorphism (RFLP) analysis, genomic DNA was amplified using the protocol: 5 min 95 C; 35 cycles of 1 min 95 C, 1 min 57 C, 1.5 min 72 C; 10 min 72 C, 2.5 units of AmpliTaq DNA polymerase (Perkin Elmer), and the following oligonucleotides: (794) 5' TGGACCTTCCTTCCACCTTCACTG 3' and (1002) 5' CCTTCCGTCTGGCACTGCA 3'.
Nucleotide sequence analysis
DNA amplification resulted in 20 fragments of approximately 500 bp covering the entire thyroglobulin cDNA of patient IV-6.
Both the sense and antisense strand were sequenced using either the M13 tags linked to the PCR fragments with the Big Dye Primer Cycle Sequencing Kit or the Tg-specific oligonucleotides with the Big Dyedeoxyterminator Cycle Sequencing Kit, depending on the GC content of the fragment (both kits from PE Applied Biosystems/Perkin Elmer). After electrophoresis on a sequencing gel, the samples were analyzed on the ABI Prism 377 DNA sequencer and aligned to the Tg cDNA sequence (8, 10) using AutoAssembler software (PE Applied Biosystems/Perkin Elmer).
Determination of alternative splice products
The coding region of nt 400-1350 (exon 49) was amplified on mRNA of patient IV-6 and of wildtype, and the reactions were run on a 1.2% agarose gel stained with ethidium bromide.
Subcloning of mutated Tg fragment
The TGI construct (8) containing wildtype Tg nucleotides -6 to 2110 in the pcDNA3 plasmid (TG-WT) was restricted with Bsu36 I, thereby deleting the wildtype sequence from nt 686-1137, and purified from a 0.8% agarose gel. The amplified product of 950 bp, containing the mutation at nt position 886 was also restricted with Bsu36 I. The mutant fragment of 451 bp was purified from a 1.2% agarose gel and ligated into the digested TG-WT resulting in TG-M. By automatic sequencing using Tg specific primers, the nt sequence was validated.
The protocols used for digesting with Bsu36 I (Biolabs) and for
ligation with T4 ligase (Boehringer Mannheim; rapid DNA
ligation kit) were according to the manufacturer. For gel purification,
the Quiaquick DNA gel extraction kit (Quiagen) was used.
Standard heat shock transformation was performed with DH5
competent
cells (Gibco BRL).
Expression of Tg in rabbit reticulocyte lysate and analysis
For in vitro transcription and translation a TnT® T7 Coupled Reticulocyte Lysate System was used (Promega Corp.), providing rabbit reticulocyte lysate, a reaction buffer, T7 RNA polymerase, and an amino acid mixture lacking cysteine. Reactions of 25 µL were done, adding Rnasin® Ribonuclease Inhibitor (Promega Corp.), a mixture of 35S-methionine and 35S-cysteine (ICN Pharmaceuticals, Inc.; Tran35S-label). To obtain glycosylation, Canine Pancreatic Microsomal Membranes (CPMM) (Promega Corp.) were added. In each reaction 300 ng plasmid DNA was used as template (TG-WT or TG-M or positive control). Positive control 1 was used to check for expression of a protein of 61 kDa mol wt. Control sample 2 was used to check for glycosylation. Incubation was done at 30 C for 90 min.
Aliquots of 5 µL (minus CPMM) or 10 µL (plus CPMM) of reticulocyte lysate reactions, together with a molecular weight marker (Biolabs; Rainbow general), were subjected to SDS-PAGE according to Laemmlis method (17.5%), and the gel was dried afterwards. The radioactive signal of expressed proteins was detected using a Phosphorimager and Image Quant software (Molecular Dynamics, Inc.).
Protein products from 40 µL reticulocyte lysate reactions, were immunoprecipitated using a rabbit polyclonal antibody specific for human Tg (26) coupled to protein A-sepharose CL-4B (Pharmacia Biotech) and were analyzed identically.
Restriction fragment length polymorphism analysis
The mutation detected by nucleotide sequencing at position 886 created an AlwN I recognition site. This enzyme was used according to the manufacturers protocol to screen for the presence of the mutation in the amplified genomic DNA Tg fragment of the indicated family members (III-1, III-2, IV-6, IV-10, IV-2, V-1, V-2) and of a wildtype control. The samples were run on 2.5% agarose gel and stained with ethidium bromide.
| Results |
|---|
|
|
|---|
|
To determine whether the nonsense mutation caused alternative splicing of exon 7, a cDNA fragment ranging from exon 4 to 9 was amplified from mRNA of patient IV-6 and a wildtype control (data not shown). No difference in either splicing or abundance of the amplified product was detected.
The mutation was expected to result in a truncated Tg molecule upon
translation, still harboring putative N-glycosylation sites. To examine
translation and putative glycosylation in relation to the mutation, a
cell-free in vitro transcription/translation system (rabbit
reticulocyte lysate + T7 RNA polymerase) was used in which
glycosylation conditions could be established by addition of microsomal
membranes (CPMM). For comparison two expression constructs were
used containing the first 2110 bp of coding Tg sequence: wildtype
(TG-WT) and mutant (TG-M). 35S-labeled methionine and
cysteine were incorporated, enabling visualization of the expressed
protein after SDS-PAGE using the Phosphorimager. The apparent mol wts
of the proteins expressed from TG-WT and TG-M were respectively 76,000
and 30,000 (Fig. 3A
). After addition of
CPMM, both TG-WT and TG-M proteins were glycosylated, as
observed by a shift in apparent molecular weight, although the
expression of the TG-WT was low (Fig. 3B
). The controls 1 and 2
provided by the manufacturer showed that both translation (Fig. 3A
, lane control 1) and glycosylation (Fig. 3B
, lane control 2) occurred.
To validate that the expressed proteins were human thyroglobulin
fragments, the reaction samples were immunoprecipitated with an
anti-human-Tg polyclonal. Specific recognition of the Tg wildtype
and mutant proteins with and without glycosylation is shown in Fig. 3C
and 3D
respectively.
|
| Discussion |
|---|
|
|
|---|
After sequencing the total Tg cDNA of patient IV-6, a homozygous
nonsense mutation was determined, which resulted in an AlwN I
recognition site (Fig. 2
). RFLP analysis demonstrated that both parents
were heterozygous for this mutation and that all three affected
siblings carried the same mutated Tg alleles. The mutation is a
cytosine-to-thymidine transition at nt position 886 in exon 7, creating
a stopcodon at amino acid Arg277. The change occurs in a CpG
dinucleotide and can be caused by deamination of a methylated cytosine
to thymine (28). Furthermore, the CGA arginine codon is considered a
"hot spot" for mutations (29).
RNA transcripts containing a premature stopcodon may be relatively unstable because the untranslated part of the messenger is not protected by ribosomes (13, 19). However, we have no indication that the mRNA of patient IV-6 was very unstable because, after total RNA isolation and RT-PCR amplification of 500 - 950 bp fragments, the results of normal and patients thyroid tissues were similar with respect to the quantity of the generated products. The amount of tissue, however, was not sufficient to perform a Northern blot.
No differences were detected in expression of the described alternative transcripts (10) compared with normals (data not shown). After RT-PCR amplification of a fragment from nt 400-1350 (exon 4 to 9) no differences in product length and abundance were detected between patient and wildtype samples. This excluded an alternative splice event of the Tg RNA, as is described for Afrikander cattle (17) and human (13), where a nonsense mutation at amino acid residue 687 and residue 1510, respectively, results in a relatively increased expression of a smaller messenger RNA species lacking the mutated exon. The specific skipping of exons containing a nonsense mutation has also been described elsewhere (30).
Upon translation the mutated Tg transcript generated a Tg protein,
validated by immunoprecipitation with a specific antihuman-Tg antibody,
with an apparent mol wt of 30,000 (Fig. 3
). This was in good accordance
with the predicted mol wt of 30,778 (276 amino acid residues). Three
putative N-linked glycosylation sites are still present in this
truncated protein, of which two have been shown to be glycosylated in
the mature protein (Asn57 and Asn179) (31). The use of microsomal
membranes in the in vitro expression assay indicated that
the aberrant Tg protein could indeed be glycosylated.
It has been reported that the phenotypic expression of defective Tg
protein varies considerably when different families or affected
siblings within the same family are compared (32). Although the
laboratory tests were performed at a younger age in patient IV-10 than
in patients IV-2 and IV-6, it seems that the consequences of the
defective Tg synthesis in patient IV-2 are less severe. Apparently the
goiter is able to compensate for the hypothyroid status with a somewhat
elevated TSH. Her brothers show diminished total T4 levels
while their total T3 levels are in the normal range (Table 1
).
Thyroid hormone synthesis involves a two-step modification of tyrosine residues. Iodination and subsequent coupling take place at the apical membrane of the cell, and both reactions are catalyzed by thyroid peroxidase (2, 3). The specific iodinated tyrosine residues that are involved in the coupling reaction can either accept (hormonogenic sites) or donate iodinated phenyl groups. The most important acceptor site in all vertebrate species examined is at Tyr5, while priority for hormonogenesis at the other acceptor sites Tyr1291, Tyr2554, and Tyr2747 varies among species (2). For human Tg, three potential donor sites have been identified so far (Tyr130, Tyr847, Tyr1488) (33). The truncated form of Tg described here harbors both the acceptor Tyr5 and the donor Tyr130 residues. This feature, as well as its size and ability to become glycosylated, makes it comparable to the truncated Tg product in the goitrous Dutch goats. In these animals the glycosylated Tg fragment (mol wt of 40,000) was able to synthesize T4in vivo, and the amounts produced were comparable to normal when 1 mg iodide/day was administered, although goiter remained (34). It has also been reported that, in man, oral administration of excess iodine can partially correct the hypothyroid condition in patients with defective Tg synthesis (35). Therefore iodide administration may explain in part the variability in the clinical presentation of the affected individuals within this family.
In conclusion, molecular analysis of a family with hereditary hypothyroidism and goiter reveals a novel autosomal recessive mutation in the thyroglobulin gene. The mutation is a C-to-T transition at nt position 886 in exon 7, creating a stopcodon at amino acid Arg277. The expressed truncated Tg protein has a mol wt of 30,778, can be glycosylated, and is still able to produce thyroid hormone.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received December 30, 1998.
Revised March 25, 1999.
Accepted April 8, 1999.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
P. S. Kim, J. Lee, P. Jongsamak, S. Menon, B. Li, S. A. Hossain, J.-H. Bae, B. Panijpan, and P. Arvan Defective Protein Folding and Intracellular Retention of Thyroglobulin-R19K Mutant as a Cause of Human Congenital Goiter Mol. Endocrinol., February 1, 2008; 22(2): 477 - 484. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Caputo, C. M Rivolta, V. J Gutnisky, L. Gruneiro-Papendieck, A. Chiesa, G. Medeiros-Neto, R. Gonzalez-Sarmiento, and H. M Targovnik Recurrence of the p.R277X/p.R1511X compound heterozygous mutation in the thyroglobulin gene in unrelated families with congenital goiter and hypothyroidism: haplotype analysis using intragenic thyroglobulin polymorphisms J. Endocrinol., October 1, 2007; 195(1): 167 - 177. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kanou, A. Hishinuma, K. Tsunekawa, K. Seki, Y. Mizuno, H. Fujisawa, T. Imai, Y. Miura, T. Nagasaka, C. Yamada, et al. Thyroglobulin Gene Mutations Producing Defective Intracellular Transport of Thyroglobulin Are Associated with Increased Thyroidal Type 2 Iodothyronine Deiodinase Activity J. Clin. Endocrinol. Metab., April 1, 2007; 92(4): 1451 - 1457. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hishinuma, S. Fukata, S. Nishiyama, Y. Nishi, M. Oh-Ishi, Y. Murata, Y. Ohyama, N. Matsuura, K. Kasai, S. Harada, et al. Haplotype Analysis Reveals Founder Effects of Thyroglobulin Gene Mutations C1058R and C1977S in Japan J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 3100 - 3104. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Alzahrani, E. Y. Baitei, M. Zou, and Y. Shi Metastatic Follicular Thyroid Carcinoma Arising from Congenital Goiter as a Result of a Novel Splice Donor Site Mutation in the Thyroglobulin Gene J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 740 - 746. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Rivolta, C. M. Moya, V. J. Gutnisky, V. Varela, J. M. Miralles-Garcia, R. Gonzalez-Sarmiento, and H. M. Targovnik A New Case of Congenital Goiter with Hypothyroidism Caused by a Homozygous p.R277X Mutation in the Exon 7 of the Thyroglobulin Gene: A Mutational Hot Spot Could Explain the Recurrence of This Mutation J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3766 - 3770. [Abstract] [Full Text] [PDF] |
||||
![]() |
S M Park and V K K Chatterjee Genetics of congenital hypothyroidism J. Med. Genet., May 1, 2005; 42(5): 379 - 389. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. J. Gutnisky, C. M. Moya, C. M. Rivolta, S. Domene, V. Varela, J. V. Toniolo, G. Medeiros-Neto, and H. M. Targovnik Two Distinct Compound Heterozygous Constellations (R277X/IVS34-1G>C and R277X/R1511X) in the Thyroglobulin (TG) Gene in Affected Individuals of a Brazilian Kindred with Congenital Goiter and Defective TG Synthesis J. Clin. Endocrinol. Metab., February 1, 2004; 89(2): 646 - 657. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Caron, C. M. Moya, D. Malet, V. J. Gutnisky, B. Chabardes, C. M. Rivolta, and H. M. Targovnik Compound Heterozygous Mutations in the Thyroglobulin Gene (1143delC and 6725G->A [R2223H]) Resulting in Fetal Goitrous Hypothyroidism J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3546 - 3553. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ozisik, G. Mantovani, J. C. Achermann, L. Persani, A. Spada, J. Weiss, P. Beck-Peccoz, and J. L. Jameson An Alternate Translation Initiation Site Circumvents an Amino-Terminal DAX1 Nonsense Mutation Leading to a Mild Form of X-Linked Adrenal Hypoplasia Congenita J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 417 - 423. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Leonardi, P. Vito, C. Mauro, F. Pacifico, L. Ulianich, E. Consiglio, S. Formisano, and B. Di Jeso Endoplasmic Reticulum Stress Causes Thyroglobulin Retention in this Organelle and Triggers Activation of Nuclear Factor-{kappa}B Via Tumor Necrosis Factor Receptor-Associated Factor 2 Endocrinology, June 1, 2002; 143(6): 2169 - 2177. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hishinuma, S.-I. Furudate, M. Oh-Ishi, N. Nagakubo, T. Namatame, and T. Ieiri A Novel Missense Mutation (G2320R) in Thyroglobulin Causes Hypothyroidism in rdw Rats Endocrinology, November 1, 2000; 141(11): 4050 - 4055. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |