| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Thyroid Cancer Research Laboratory, Medical Service, Veterans Affairs Medical Center, Lexington, Kentucky 40511; and the Division of Endocrinology and Molecular Medicine, Department of Internal Medicine, University of Kentucky Medical Center, Lexington, Kentucky 40536-0084
Address all correspondence and requests for reprints to: Kenneth B. Ain, M.D., Thyroid Nodule and Oncology Clinical Service, Division of Endocrinology and Molecular Medicine, Department of Internal Medicine, Room MN520, University of Kentucky Medical Center, 800 Rose Street, Lexington, Kentucky 40536-0084. E-mail: kbain1{at}pop.uky.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The complementary DNA sequence for human NIS (hNIS) as well as the exon-intron organization have been revealed by Smanik et al. (3, 4). We reported the cloning and characterization of a 1.3-kb region of the upstream regulatory region and defined a minimal essential hNIS promoter that shows tissue-specific expression in a human thyroid cell line (5). Other investigators have further evaluated hNIS promoter constructs (6, 7). It is possible that alterations in hNIS expression, responsible for the loss of iodide-concentrating ability in human thyroid cancer metastases, may correspond to changes in hNIS promoter activity. This may be similar to the loss of E-cadherin expression demonstrated in human thyroid cancer cell lines, correlating to methylation of CpG islands in the E-cadherin promoter (8). As the hNIS promoter has CpG-rich regions as well as additional CpG islands downstream from the transcription start site, DNA methylation may be responsible for alterations in hNIS expression.
Nearly half of all human genes have CpG islands associated with transcriptional start sites. Unmethylated CpG islands are seen in highly transcribed genes, whereas heavily methylated CpG islands inhibit transcription (9). Although overall DNA methylation is often decreased in cancers, CpG islands in critical gene promoter regions can become hypermethylated, resulting in loss of gene expression (10). Such methylation may be effective in silencing gene expression despite variable degrees of CpG site methylation from 20100% (11). Laboratory and clinical studies have suggested that chemical agents may demethylate these regions and restore gene expression. Examples include use of 5-azacytidine to restore expression of O6-methylguanine-DNA methyltransferase in human cervical, brain, and colon carcinomas (12, 13); phenylacetate to induce fetal hemoglobin expression in human leukemic cells (14); and sodium butyrate to induce PRL receptor expression in human breast cancer cells (15).
In this study we tested the hypothesis that methylation of the characterized hNIS promoter and potentially regulatory downstream regions correlate with the loss of hNIS messenger ribonucleic acid (mRNA) expression as well as the clinical loss of iodide uptake in samples of thyroid tumor tissues. In addition, using human thyroid carcinoma cell lines and putative demethylation agents, we evaluated the reversibility of loss of hNIS mRNA expression and functional activity measured as iodide uptake.
| Materials and Methods |
|---|
|
|
|---|
The human thyroid cell lines used in this study were MRO87 and WRO82 (both follicular carcinomas, provided by G. J. F. Juillard, University of California-Los Angeles School of Medicine), NPA87 (papillary carcinoma, from Juillard), KAT-5 and KAT-10 [both papillary carcinomas, from our laboratory (16)], KAK-1 [benign follicular adenoma, from our laboratory (17)], and KAT-7 (benign follicular hyperplasia, from our laboratory). Cultures were previously treated with medium containing D-valine (18) and cis-4-hydroxy-L-proline (19) to ensure the absence of fibroblasts. Human thyroid tissues were obtained from fresh surgical samples (approved by the University of Kentucky institutional review board). Some tumor samples were supplied by the Cooperative Human Tissue Network (Philadelphia, PA), and some were obtained from surgical samples at the Clinical Center, NIH (Bethesda, MD; under an approved protocol).
Cell culture
Cell lines for evaluation of iodide uptake and hNIS expression were grown in phenol red-free RPMI 1640 with 5% FBS, 100 nmol/L sodium selenite, and 0.1 nmol/L bovine TSH (basal medium) (20). They were plated at a density of 35 x 104 cells/9.4 cm2 in triplicate in basal medium and grown for 23 days at 37 C in 5% CO2. They were treated with dimethylsulfoxide (25 µmol/L daily for 3 days), sodium butyrate (0.5 or 1.0 mmol/L), phenylacetate (pH 7.0; 5 or 10 mmol/L), or 5-azacytidine (0.5 or 1.0 µmol/L in 25 µmol/L dimethylsulfoxide daily for 3 days) until control cells were 80% confluent (34 days), then changed to fresh basal medium and grown for an additional 24 h.
Analysis of CpG content in the hNIS gene sequence
The hNIS gene sequence of the 5'-flanking region (5) and the contiguous transcribed region extending up to the first intron (3, 4) were analyzed using WINDOW and STATPLOT computer programs (Genetics Computer Group, Madison, WI) to denote CpG dinucleotide frequencies.
Nucleic acid isolation and amplification
Total RNA and genomic DNA from normal human thyroid, thyroid tumors, and cell lines (treated with the agents described above) were isolated by the acid-guanidinium-phenol-chloroform method (21). All surgical samples were snap-frozen and stored at -80 C until processed by homogenization in Trizol reagent (Life Technologies, Gaithersburg, MD) while still frozen. Complementary DNA (cDNA) was synthesized from 1.0 µg total RNA using Moloney murine leukemia virus reverse transcriptase with random hexamer primers (CLONTECH Laboratories, Inc., Palo Alto, CA). Each 50 µL PCR vessel contained 60 mmol/L Tris-HCl (pH 9.0), 15 mmol/L ammonium sulfate, 3.5 mmol/L MgCl2 [1.5 mmol/L for human thyroid transcription factor-1 (hTTF-1)], 250 µmol/L deoxy-NTPs (Boehringer Mannheim, Indianapolis, IN), 0.2 µmol/L of each primer pair, 1 U AmpliTaq DNA polymerase (Perkin Elmer, Norwalk, CT), 0.2 µg TaqStart Antibody (CLONTECH Laboratories, Inc.), and 3% cDNA. ß-Actin amplification primers (Stratagene, La Jolla, CA) confirmed cDNA integrity, purity, and template equivalence for semiquantification. PCR primers (upstream 5' to 3', downstream 5' to 3', in all cases) used for amplification were CTGCCCCAGACCAGTACATGCC/TGACGGTGAAGGAGCCCTGAAG for hNIS (5) [to amplify a coding region spanning four introns (4) yielding a 303-bp product from cDNA] and AAGTCCAGCATTGCGGCACA/GAGGGAAGTGCTTATGGTCC for PAX-8 (22) (to amplify a 329-bp product). Amplification conditions for hNIS and PAX-8 were denaturation at 95 C for 5 min, 40 cycles of 20 s at 95 C and 60 s at 68 C, followed by extension at 72 C for 3 min. The hTTF-1 product was amplified with intron-spanning primers, GCCGTACCAGGACACCATGAG/CAGGTACTTCTGTTGCTTGAAG, which amplify a 263-bp fragment. The conditions were 95 C for 5 min; 45 cycles of 95 C for 20 s, 60 C for 60 s, and 72 C for 30 s; followed by extension at 72 C for 3 min. The RT-PCR products were resolved on 2% agarose gels and visualized by ethidium bromide staining.
Methylation-specific PCR analysis
This method uses PCR primer pairs to distinguish methylated from unmethylated DNA in bisulfite-modified target DNA, in which bisulfite converts unmethylated cytosines to uracil (23, 24). Genomic DNAs from normal and tumoral human thyroid tissues and cell lines were isolated by standard techniques (21), and 1.0-µg aliquots were denatured by NaOH (10 min at 37 C), then treated with 10 mmol/L hydroquinone and 3.0 mol/L sodium bisulfite (pH 5.0 under mineral oil for 16 h at 50 C). Modified DNA was purified on a resin column (QIAGEN, Chatsworth, CA) and further treated with 0.3 N NaOH for 5 min before ethanol precipitation. The PCR mixture contained 16.6 mmol/L ammonium sulfate, 67 mmol/L Tris-HCl (pH 8.8), 6.7 mmol/L MgCl2, 10 mmol/L ß-mercaptoethanol, 1.25 mmol/L deoxy-NTPs, 0.2 µL TaqStart antibody, 1 U AmpliTaq DNA polymerase, 10 pmol each of sense and antisense methylation-specific primers, and 50 ng bisulfite-modified DNA target. Primers used for analysis of the hNIS promoter CpG island methylation were selected for cytosine-rich regions containing CpG dinucleotides near the 3'-end of the primers, hNIS-MET-P (sense, 5' to 3', TTAGGTTTGGAGGCGGAGTCGC; antisense, 5' to 3', ACCGACTATCTATCCCTCTCCCTAAACG) for a 143-bp product from methylated DNA and hNIS-UNMET-P (sense, 5' to 3', TTGTTTTTAGGTTTGGAGGTGGAGTTGT; antisense, 5' to 3', CAACCAACTATCTATCCCTCTCCCTAAACA) for a 151-bp product from unmethylated genomic DNA. Additional sets of primers were similarly designed to analyze further downstream elements. They were hNIS-MET-L (sense, ATAGATAGATAGTAGGGGCGGAC; antisense, GACCTCCATAAAAACGAATACG) for a 265-bp product, hNIS-UNMET-L (sense, TAGGATAGATAGATAGTAGGGGTGGAT; antisense, CTCCACAACCTCCATAAAAACAAATACA) for a 275-bp product, hNIS-MET-C (sense, AGGTCGTGGAGATCGGGGAAC; antisense, ACGATAAACCTCCGACGACACG) for a 242-bp product, and hNIS-UNMET-C (sense, TTATGGAGGTTGTGGAGATTGGGGAAT; antisense, CATAACAATAAACCTCCAACAACACA) for a 252-bp product. The amplification conditions were Taq polymerase activation at 95 C for 5 min and 40 cycles of denaturation at 94 C for 20 s, annealing at 60 C for 30 s, and polymerization at 72 C for 30 s. Methylation-specific PCR products were resolved by agarose gel electrophoresis and visualized by ethidium bromide staining and UV transillumination.
Iodide uptake assay
Cell lines treated with differentiation agents and control
cultures were washed with 2 mL buffer containing 10 mmol/L HEPES (pH
8.3), 5.5 mmol/L glucose, 5.4 mmol/L KCl, 1.3 mmol/L CaCl2,
0.4 mmol/L Na2HPO4, 0.44 mmol/L
KH2PO4, and either 137 mmol/L NaCl (buffer A)
or 100 mmol/L choline chloride (buffer B). After a 60-min incubation in
the same buffer supplemented with Na[125I] (1.0 µCi/2
mL) and 1.0 µmol/L NaI, cells were washed once with buffer A, lysed
with 0.1 mol/L NaOH and
-counted (5). A parallel set of dishes,
similarly plated and treated, was used for normalization of uptake
activity, using the
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay (25)
as an index of cell viability.
counts of cells incubated in buffer
B were subtracted from counts of cells incubated in buffer A under
corresponding conditions to account for nonspecific binding of
radioiodide.
Clinical radioiodine uptake
Assessment of radioiodine uptake in clinical tumor samples was based upon the results of 131I whole body scans (using 5 mCi 131I tracer doses) performed 68 weeks after excision of the primary tumor during surgical thyroidectomy. The presence of radioiodine uptake in metastatic tumor deposits was presumed to be indicative of positive radioiodine uptake in the primary tumor sample. This is based upon the assumption that tumor redifferentiation, spontaneously restoring loss of iodide uptake is far less common than tumor dedifferentiation. The absence of radioiodine uptake in palpable or radiologically discernible tumor metastases was presumed to reflect loss of radioiodine uptake in the primary tumor sample. This designation is probably correct; however, it is possible that metastases may have less functionality than their parent tumors. In the absence of persistent tumor metastases, the assessment of radioiodine uptake was not possible. Some tumor samples were obtained from recurrent tumors that had been documented to lack radioiodine uptake on the basis of previous whole body scanning.
| Results |
|---|
|
|
|---|
The hNIS promoter region and its contiguous downstream regions up
to the first intron were analyzed for the presence of CpG islands. The
frequency plot (Fig. 1
) shows a region of
the promoter surrounding the transcription start site (5) and extending
upstream for about 100 bp to be rich in CpG dinucleotides (region P).
This was the only upstream region in the characterized promoter that
was CpG rich. Sequence comparison revealed that this region shared
significant homology to the rat NIS promoter region (26). This region
was selected for analysis of methylation status in clinical tumors and
cell lines. Additional CpG-rich sequences are present downstream from
this region, extending to the first intron. Regions L and C, selected
for methylation analysis, corresponded to CpG-rich sequences in the
hNIS leader and coding regions, respectively, within the first
exon.
|
Primary thyroid tumors were analyzed by RT-PCR for the expression
of hNIS mRNA (Fig. 2
and Table 1
). Messenger RNA for hNIS was poorly
expressed in all 6 tall cell papillary carcinomas, ranging from
undetectable in 4 tumors to moderately positive in 2 tumors (5 cases
shown in Fig. 2
). In contrast, hNIS mRNA expression was clearly
detectable in both follicular carcinomas, 9 of 10 typical papillary
carcinomas (variable levels of expression), and both anaplastic thyroid
carcinomas. Two of the 3 Hurthle cell carcinomas were negative for hNIS
mRNA expression. Among the 19 tumor samples that were able to be
assessed for clinical radioiodide uptake, 13 cases exhibited
concordance of hNIS mRNA expression with whole body scanning (7 with
concordant positive findings and 6 with concordant negative findings).
In 6 cases (dispersed between all of the tumor histologies except
follicular carcinoma) there was no detectable radioiodine uptake on
whole body scanning despite detectable hNIS mRNA in the tumor sample.
Analysis of thyroid transcription factor mRNA expression in these
discordant cases revealed that all expressed PAX-8, and only 2 of the 6
cases expressed TTF-1. As only 1 of 7 tumor samples, with concordant
positive radioiodine uptake and hNIS mRNA expression, lacked TTF-1 mRNA
expression, loss of this factor may contribute to the loss of hNIS
function, but is not totally explanatory.
|
|
The NIS promoter was only faintly methylated in normal human
thyroid tissues and pooled human white blood cells. As described in the
previous section, hNIS mRNA was undetectable in 4 of 6 tall cell
papillary carcinomas and was low in the other 2. In all 6 of these
cases the hNIS promoter (region P) was strongly methylated (Fig. 3
and Table 1
). Region L was methylated
in all but 1 case, but displayed lower signal intensities for the
methylated amplification product. A CpG-rich segment of the coding
region (region C) displayed heterogeneous methylation among tall cell
tumors without any particular correlation to hNIS mRNA expression.
However, of the 10 papillary thyroid tumors, there was no apparent
association of methylation, in regions P, L, or C, with loss of hNIS
mRNA expression. Likewise, although both follicular carcinomas
expressed hNIS mRNA, they each showed different methylation patterns
between the regions. All 3 cases of Hurthle cell carcinoma had
unmethylated hNIS promoter regions and variably methylated L and C
regions, but only 1 of them expressed hNIS mRNA.
|
Seven human thyroid neoplastic cell lines, devoid of hNIS mRNA
expression under basal monolayer conditions, were treated with putative
chemical demethylation agents in an attempt to restore hNIS expression.
These cell lines were derived from three papillary carcinomas (NPA87,
KAT-5, and KAT-10), two follicular carcinomas (WRO82 and MRO87), and
two benign follicular neoplasms (KAK-1 and KAT-10) (5). Three different
demethylation or redifferentiation agents (viz. sodium
butyrate, phenylacetate, and 5-azacytidine) were tested on each of
7 cell lines for their ability to induce reexpression of hNIS mRNA.
Reexpression of hNIS mRNA was achieved in all three of the papillary
cell lines and in one of the benign follicular adenomas under at least
one treatment condition (Table 2
). Figure 4
, a and b, demonstrates the hNIS mRNA
reexpression in cell lines KAK-1 and NPA87, respectively.
|
|
|
The cell lines KAK-1, KAT-5, KAT-10, and NPA87, in which hNIS
expression was restored, were grown under basal and reexpression
conditions, and the DNA were analyzed for their methylation status at
the same three gene regions as those studied in the tumors (Table 2
).
This analysis revealed that the P region was unmethylated under all
conditions, basal or otherwise. Methylation of the L and C regions
under basal conditions was clearly evident in all four cell lines (Fig. 6
). The PCR product specific for
unmethylated DNA in the L and C regions was undetectable or merely
faintly present in the same cell lines, suggesting that the cell
populations were homogeneously methylated in these regions. Treatment
with 5-azacytidine was associated with decreased methylation at the L
and C regions in all four cell lines, as evidenced by decreased
intensity of the methylation-specific PCR products and de
novo or increased expression of the corresponding unmethylated PCR
products to equal or greater intensity than the methylated product
bands. The susceptibility of KAT-5 and KAT-10 cells to the
demethylation effects of 5-azacytidine in the C region appeared less
than that in the L region. Although sodium butyrate treatment was
associated with reexpression of hNIS mRNA in both NPA87 and KAT-10,
with phenylacetate having a lesser effect in KAT-5, analysis of
methylation patterns of the NPA87 and KAT-10 responses to sodium
butyrate failed to demonstrate effects on altering baseline methylation
patterns in all three regions.
|
Comparison of hNIS reexpression to expression patterns of TTF-1 and PAX-8
To explore the possibility that reexpression of hNIS mRNA may be
consequent to reexpression of one or more transcription factor(s), we
performed RT-PCR analysis for thyroid-specific transcription factors,
TTF-1 and PAX-8 (Table 2
). PAX-8 mRNA was expressed under all
conditions tested in all of the four cell lines that were able to
reexpress hNIS mRNA, whereas TTF-1 mRNA expression was found even under
basal conditions in cell lines NPA87 and KAK-1 (data not shown).
Basal TTF-1 expression was undetectable in cell lines KAT-5 and KAT-10,
although TTF-1 mRNA expression was induced by 5-azacytidine treatment.
Likewise, phenylacetate treatment induced TTF-1 mRNA expression only in
the KAT-5 cell line; however, sodium butyrate did not have such an
effect in either of the cell lines.
| Discussion |
|---|
|
|
|---|
Some investigators have attempted to restore iodide uptake using
retinoids. A nominal increase in iodide uptake activity was reported in
a thyroid follicular carcinoma cell line, UCLA RO 82 W-1 (WRO82),
treated with 13-cis-retinoic acid (cRA) (27). Direct
evidence of the effects of cRA on reestablishing iodide uptake in
dedifferentiated follicular and papillary thyroid cancers was first
reported by Simon et al. (28). The latest details of their
study revealed that only 14 patients (of 20 study patients) did not
concentrate any radioiodine in metastatic tumors at baseline, with only
1 such patient reestablishing distinct iodide uptake after cRA
treatment (an additional 3 patients gained weak uptake) (29). A case
report suggests a positive response to similar treatment in a single
patient (30). Alternatively, a minimal enhancement of iodide uptake
with interferon-
was suggested in several human thyroid cancer cell
lines in vitro (31). The mechanism for effects on iodide
transport is unknown for both of those agents, although they suggest
that loss of hNIS activity may be a reversible phenomenon.
In view of the multiplicity of mechanisms causing loss of iodide transport, we chose to further evaluate the subset of tumors with apparent hNIS transcriptional failure and the relationship to CpG island methylation in the region of the hNIS promoter. This was of particular importance in tall cell variant papillary thyroid cancers, because nearly half of such patients lose clinical iodide transport (32, 33), and we show this to be a consequence of hNIS transcriptional failure. The ability of 5-azacytidine to induce hNIS mRNA as well as iodide uptake in thyroid carcinoma cell lines devoid of basal hNIS mRNA expression further implicated methylation as a likely mechanism. In these cell lines, reversal of basal methylation of the L and C regions appeared to be associated with de novo induction of hNIS expression. On the other hand, lack of expression of hNIS mRNA in tall cell variant papillary carcinoma tumors was not able to be assuredly explained by such methylation patterns. Part of the reason may relate to the heterogeneity of cell methylation patterns between cells in the same culture. This may relate to the heterogeneity of hNIS protein expression demonstrated in normal and malignant thyroid tissues (34, 35). A similar mechanism has been invoked for expression of p16INK4a in thyroid carcinoma cell lines and tumors (36). Likewise, tumor tissue samples are inherently heterogeneous as mixtures of tumor cells, fibroblasts, endothelial cells, smooth muscle cells, and infiltrating host immune cells. It is also possible that the specific sites of methylation responsible for loss of hNIS transcription, in or near the hNIS gene, may be different from the particular sites analyzed in this study.
Alternative explanations for the loss of hNIS mRNA expression may relate to methylation of thyroid-specific transcription factor genes causing loss of transcription factor expression with indirect loss of hNIS mRNA expression. This was suggested by the KAT-5 and KAT-10 responses to 5-azacytidine treatment with acquisition of parallel TTF-1 and hNIS mRNA expression. Failure to express sufficient TTF-1 and PAX-8 can result in decreased activity of the thyroglobulin gene promoter in human thyroid carcinoma cells (37), a likely feature of the hNIS gene. Much of this remains speculative, considering that additional thyroid-specific transcription factors, such as TTF-2 (38, 39) and other poorly characterized factors (40), have not been similarly analyzed. As additional, possibly complex, processes may affect posttranscriptional hNIS function, there are multiple opportunities for gene methylation to reduce iodide transport. In this way, a response to 5-azacytidine may suggest a role for methylation in the absence of demonstration of the specific methylation site.
There are several examples of DNA methylation altering expression of thyroid-specific genes. In transgenic mice carrying the chloramphenicol acetyltransferase (CAT) gene under control of a bovine thyroglobulin promoter, CAT expression was limited to the thyroid glands and was related to thyroid-specific demethylation of the bovine thyroglobulin promoter (41). In another example, the transformed rat thyroid cell line, FRT, is unable to express its native TSH receptor gene consequent to methylation of its promoter (42). Avvedimento et al. (43, 44) have shown that transformation of a rat thyroid cell line, which activated the ras oncogene, resulted in loss of activity of the thyroglobulin gene promoter as well as loss of expression of a thyroid-specific trans-acting factor (presumably TTF-1). Treatment with 5-azacytidine restored both TTF-1 expression and thyroglobulin promoter activity. Such cases provide evidence that thyroidal tissues use methylation as a regulatory mechanism for gene expression, particularly in transformed phenotypes.
The potential to restore iodide transport in dedifferentiated thyroid carcinomas with demethylation agents suggests clinical application. The degree of hNIS expression needed to deliver tumoricidal radioiodide is not clear. Normal thyroid tissue, stimulated by TSH, concentrates radioiodide at 1% of the administered dose per g tissue. Differentiated thyroid cancer metastases typically concentrate radioiodide at 0.060.3% of the administered radioiodide dose/g tumor (45). Calculations of the degree of radioiodide uptake and the biological residence time needed for sufficient therapy of thyroid cancer suggest that (employing an effective half-life of at least 4.5 days) tumor destruction can be achieved despite an uptake of only 0.1%, using administered activities of 300 mCi (46). The use of radioiodide dosimetric analysis to verify upper safety margins of administered doses may permit therapeutic doses exceeding 600 mCi (47), so that tumors with less than 0.05% uptake may respond to treatment. For this reason, restoration of hNIS activity sufficient to treat thyroid cancer does not require hNIS expression to the levels seen in normal human thyroid follicular cells.
Effective radioiodide therapy requires more than a functional hNIS gene. There should be sufficient expression of TSH receptors and downstream signal transduction machinery to amplify hNIS expression when TSH levels rise. In addition, failure to organify radioiodide compromises 131I residence time in thyroid carcinoma cells, permitting radioiodide efflux and insufficient radiation delivery. This was seen by Shimura et al. (48) when they transfected transformed rat thyroid cells, lacking endogenous NIS expression, with rat NIS cDNA and restored radioiodide uptake. Despite high levels of 131I uptake in xenografts of these cells, they were unable to obtain tumoricidal effects due to rapid radioiodide efflux from lack of effective organification. It is possible that demethylation therapy may be able to restore additional critical functions, such as organification, downstream from iodide transport. Further investigations should delineate which aspects of radioiodide therapeutics are responsive to this intervention.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received January 11, 1999.
Revised March 16, 1999.
Accepted March 22, 1999.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. Kogai, S. Sajid-Crockett, L. S Newmarch, Y.-Y. Liu, and G. A Brent Phosphoinositide-3-kinase inhibition induces sodium/iodide symporter expression in rat thyroid cells and human papillary thyroid cancer cells J. Endocrinol., November 1, 2008; 199(2): 243 - 252. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Schweppe, J. P. Klopper, C. Korch, U. Pugazhenthi, M. Benezra, J. A. Knauf, J. A. Fagin, L. A. Marlow, J. A. Copland, R. C. Smallridge, et al. Deoxyribonucleic Acid Profiling Analysis of 40 Human Thyroid Cancer Cell Lines Reveals Cross-Contamination Resulting in Cell Line Redundancy and Misidentification J. Clin. Endocrinol. Metab., November 1, 2008; 93(11): 4331 - 4341. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Riesco-Eizaguirre and P. Santisteban New insights in thyroid follicular cell biology and its impact in thyroid cancer therapy Endocr. Relat. Cancer, December 1, 2007; 14(4): 957 - 977. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Xing BRAF Mutation in Papillary Thyroid Cancer: Pathogenic Role, Molecular Bases, and Clinical Implications Endocr. Rev., December 1, 2007; 28(7): 742 - 762. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Smith, C.-Y. Fan, C. Zou, D. Bodenner, and M. S. Kokoska Methylation Status of Genes in Papillary Thyroid Carcinoma Arch Otolaryngol Head Neck Surg, October 1, 2007; 133(10): 1006 - 1011. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. C.G. van Staveren, D. W. Solis, L. Delys, L. Duprez, G. Andry, B. Franc, G. Thomas, F. Libert, J. E. Dumont, V. Detours, et al. Human Thyroid Tumor Cell Lines Derived from Different Tumor Types Present a Common Dedifferentiated Phenotype Cancer Res., September 1, 2007; 67(17): 8113 - 8120. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kondo, X. Zhu, S. L. Asa, and S. Ezzat The Cancer/Testis Antigen Melanoma-Associated Antigen-A3/A6 Is a Novel Target of Fibroblast Growth Factor Receptor 2-IIIb through Histone H3 Modifications in Thyroid Cancer Clin. Cancer Res., August 15, 2007; 13(16): 4713 - 4720. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Xing Gene Methylation in Thyroid Tumorigenesis Endocrinology, March 1, 2007; 148(3): 948 - 953. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Li, G. M. Venkataraman, and K. B. Ain Protein Synthesis Inhibitors, in Synergy with 5-Azacytidine, Restore Sodium/Iodide Symporter Gene Expression in Human Thyroid Adenoma Cell Line, KAK-1, Suggesting Trans-Active Transcriptional Repressor J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 1080 - 1087. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Riesco-Eizaguirre and P. Santisteban A perspective view of sodium iodide symporter research and its clinical implications. Eur. J. Endocrinol., October 1, 2006; 155(4): 495 - 512. [Abstract] [Full Text] [PDF] |
||||
![]() |
T Kogai, K Taki, and G A Brent Enhancement of sodium/iodide symporter expression in thyroid and breast cancer. Endocr. Relat. Cancer, September 1, 2006; 13(3): 797 - 826. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hu, M. Ewertz, R. P. Tufano, M. Brait, A. L. Carvalho, D. Liu, A. P. Tufaro, S. Basaria, D. S. Cooper, D. Sidransky, et al. Detection of Serum Deoxyribonucleic Acid Methylation Markers: A Novel Diagnostic Tool for Thyroid Cancer J. Clin. Endocrinol. Metab., January 1, 2006; 91(1): 98 - 104. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Xing BRAF mutation in thyroid cancer Endocr. Relat. Cancer, June 1, 2005; 12(2): 245 - 262. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Porra, C. Ferraro-Peyret, C. Durand, S. Selmi-Ruby, H. Giroud, N. Berger-Dutrieux, M. Decaussin, J.-L. Peix, C. Bournaud, J. Orgiazzi, et al. Silencing of the Tumor Suppressor Gene SLC5A8 Is Associated with BRAF Mutations in Classical Papillary Thyroid Carcinomas J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3028 - 3035. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Furuya, H. Shimura, A. Miyazaki, K. Taki, K. Ohta, K. Haraguchi, T. Onaya, T. Endo, and T. Kobayashi Adenovirus-Mediated Transfer of Thyroid Transcription Factor-1 Induces Radioiodide Organification and Retention in Thyroid Cancer Cells Endocrinology, November 1, 2004; 145(11): 5397 - 5405. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Furuya, H. Shimura, H. Suzuki, K. Taki, K. Ohta, K. Haraguchi, T. Onaya, T. Endo, and T. Kobayashi Histone Deacetylase Inhibitors Restore Radioiodide Uptake and Retention in Poorly Differentiated and Anaplastic Thyroid Cancer Cells by Expression of the Sodium/Iodide Symporter Thyroperoxidase and Thyroglobulin Endocrinology, June 1, 2004; 145(6): 2865 - 2875. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Puppin, F. Arturi, E. Ferretti, D. Russo, R. Sacco, G. Tell, G. Damante, and S. Filetti Transcriptional Regulation of Human Sodium/Iodide Symporter Gene: A Role for Redox Factor-1 Endocrinology, March 1, 2004; 145(3): 1290 - 1293. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Braga-Basaria and M. D. Ringel Beyond Radioiodine: A Review of Potential New Therapeutic Approaches for Thyroid Cancer J. Clin. Endocrinol. Metab., May 1, 2003; 88(5): 1947 - 1960. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Xing, Y. Tokumaru, G. Wu, W. B. Westra, P. W. Ladenson, and D. Sidransky Hypermethylation of the Pendred Syndrome Gene SLC26A4 Is an Early Event in Thyroid Tumorigenesis Cancer Res., May 1, 2003; 63(9): 2312 - 2315. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Xing, H. Usadel, Y. Cohen, Y. Tokumaru, Z. Guo, W. B. Westra, B. C. Tong, G. Tallini, R. Udelsman, J. A. Califano, et al. Methylation of the Thyroid-stimulating Hormone Receptor Gene in Epithelial Thyroid Tumors: A Marker of Malignancy and a Cause of Gene Silencing Cancer Res., May 1, 2003; 63(9): 2316 - 2321. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Dohan, A. De la Vieja, V. Paroder, C. Riedel, M. Artani, M. Reed, C. S. Ginter, and N. Carrasco The Sodium/Iodide Symporter (NIS): Characterization, Regulation, and Medical Significance Endocr. Rev., February 1, 2003; 24(1): 48 - 77. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-K. Chung Sodium Iodide Symporter: Its Role in Nuclear Medicine J. Nucl. Med., September 1, 2002; 43(9): 1188 - 1200. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. A. Smit, J. P. Schroder-van der Elst, M. Karperien, I. Que, M. Stokkel, D. van der Heide, and J. A. Romijn Iodide Kinetics and Experimental 131I Therapy in a Xenotransplanted Human Sodium-Iodide Symporter-Transfected Human Follicular Thyroid Carcinoma Cell Line J. Clin. Endocrinol. Metab., March 1, 2002; 87(3): 1247 - 1253. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Castro, E. R. Bergert, J. R. Goellner, I. D. Hay, and J. C. Morris Immunohistochemical Analysis of Sodium Iodide Symporter Expression in Metastatic Differentiated Thyroid Cancer: Correlation with Radioiodine Uptake J. Clin. Endocrinol. Metab., November 1, 2001; 86(11): 5627 - 5632. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Haberkorn and A. Altmann Imaging Techniques for Gene Therapy: SPECT, PET, and MRI Journal of Pharmacy Practice, October 1, 2001; 14(5): 383 - 396. [Abstract] [PDF] |
||||
![]() |
T. Kogai, J. M. Hershman, K. Motomura, T. Endo, T. Onaya, and G. A. Brent Differential Regulation of the Human Sodium/Iodide Symporter Gene Promoter in Papillary Thyroid Carcinoma Cell Lines and Normal Thyroid Cells Endocrinology, August 1, 2001; 142(8): 3369 - 3379. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Spitzweg, K. J. Harrington, L. A. Pinke, R. G. Vile, and J. C. Morris The Sodium Iodide Symporter and Its Potential Role in Cancer Therapy J. Clin. Endocrinol. Metab., July 1, 2001; 86(7): 3327 - 3335. [Full Text] [PDF] |
||||
![]() |
E. L. Mazzaferri and R. T. Kloos Current Approaches to Primary Therapy for Papillary and Follicular Thyroid Cancer J. Clin. Endocrinol. Metab., April 1, 2001; 86(4): 1447 - 1463. [Full Text] |
||||
![]() |
U. Haberkorn, M. Henze, A. Altmann, S. Jiang, I. Morr, M. Mahmut, P. Peschke, W. Kübler, J. Debus, and M. Eisenhut Transfer of the Human NaI Symporter Gene Enhances Iodide Uptake in Hepatoma Cells J. Nucl. Med., February 1, 2001; 42(2): 317 - 325. [Abstract] [Full Text] |
||||
![]() |
B. Gereben, D. Salvatore, J. W. Harney, H. M. Tu, and P. R. Larsen The Human, but Not Rat, dio2 Gene Is Stimulated by Thyroid Transcription Factor-1 (TTF-1) Mol. Endocrinol., January 1, 2001; 15(1): 112 - 124. [Abstract] [Full Text] |
||||
![]() |
C. Riedel, O. Levy, and N. Carrasco Post-transcriptional Regulation of the Sodium/Iodide Symporter by Thyrotropin J. Biol. Chem., June 8, 2001; 276(24): 21458 - 21463. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |