| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Laboratoire Interactions Cellulaires Neuroendocriniennes, Unité Mixte de Recherche 6544, Centre National de la Recherche Scientifique-Université de la Méditerrannée (I.P.-B., C.M., G.G., A.J.Z., P.J., A.E.), and Laboratoire de Neuroendocrinologie Expérimentale, INSERM U-501 (M.G.), Institut Fédératif Jean Roche, Faculté de Médecine Nord, 13916 Marseille; and Laboratoire d’Anatomie Pathologique et de Neuropathologie (D.F.-B.) and Service de Neurochirurgie (F.G.) and Service d’Endocrinologie (P.J.), Centre Hospitalo-Universitaire Timone, 13385 Marseille, France
Address all correspondence and requests for reprints to: Dr. Isabelle Pellegrini-Bouiller, Laboratoire Interactions Cellulaires Neuroendocriniennes, UMR 6544, Centre National de la Recherche Scientifique-Université de la Méditerrannée, Institut Fédératif Jean Roche, Faculté de Médecine Nord, boulevard P. Dramard, 13916 Marseille Cedex 20, France. E-mail: pellegrini.i{at}jean-roche.univ-mrs.fr
 |
Abstract |
|---|
 Top Abstract IntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Gsu, LHß, or FSHß, could be evidenced.
Finally, Ptx2 was also expressed in pure lactotroph adenomas and not in
somatotroph adenomas. Ptx2 is, therefore, the first paired homeodomain
pituitary transcription factor differentially expressed in these two
lineages, which derive from a common precursor. These results support a
role for Ptx2 in the terminal differentiation of somatotroph and
lactotroph cell phenotypes. |
Introduction |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Recently, a new family of transcription factors, the Ptx subfamily within the paired-like class of homeodomain proteins, has been identified (9, 10, 11, 12, 13, 14, 15, 16, 17). Among the three members of the Ptx family characterized to date, Ptx1 and Ptx2 are expressed in the anterior pituitary and in a number of pituitary cell lines (12, 13), whereas Ptx3 is not (17). The human homologs of the Ptx transcription factors have been cloned (15, 18, 19). Each of them has been related to distinct human disorders, and the nature of the tissues and the functions affected in each case are consistent with the pattern of expression of the respective genes during development (11, 14, 16). At a genomic level, the Ptx1 gene maps close to the locus for Treacher Collins Franceschetti syndrome, characterized by craniofacial malformations (20), whereas Ptx2/Rieg was shown to be the causative gene for Rieger’s syndrome, in which eye anomalies and dental hypoplasia are occasionally associated with deficient pituitary functions (15). Mutations in Ptx3 have been reported in patients with congenital lens malformations (19). These data underline the importance of Ptx family members in multiple tissues during development and support a putative role in cytodifferentiation of the human pituitary. The expression of these factors, however, has not been yet investigated in the human pituitary.
To approach pituitary development in human, we analyzed the expression of the Ptx1, Ptx2, and Ptx3 genes in the normal human pituitary and in different types of human pituitary adenomas. This study, apart from investigating a potential role for Ptx1 and Ptx2 in neoplasic transformation of human anterior pituitary cells, provides insight concerning their cell-specific expression in the human anterior pituitary.
|
Subjects and Methods |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Nontumorous human pituitaries were collected at the time of postmortem examination from three adult patients with no evidence of endocrine abnormality. Fetal pituitary and mesencephalon tissues were obtained at the time of therapeutic abortion (20–32 weeks gestation).
Pituitary adenomas were obtained by transsphenoidal adenomectomies performed on patients who had undergone endocrine preoperative evaluation. Fresh tumor was divided as previously described into two parts for routine histopathogical examination and molecular analysis (21). The question of an eventual contamination of the surgical specimen with a significant number of normal pituitary cells was assessed in two ways: first by examining the pattern of expression of all the anterior pituitary hormones in the different tumors by Northern blot (see below), and second by analyzing by RT-PCR (see below) the expression of genes known to be expressed in specific tumor types. Expression of the transcription factor Pit-1 is, for example, characteristic of tumors of the somatotroph, lactotroph, and thyrotroph lineages (21), and in the present study Pit-1 messenger ribonucleic acid (mRNA) could indeed be evidenced by Northern blot analysis in such tumors (see below and data not shown). On the contrary, RT-PCR amplification of Pit-1 mRNA in corticotroph or gonadotroph tumors indicated contamination by nontumorous tissues, as these tumors are known to not express this transcription factor. In this cases, the tumors were not included in the study. Similarly, RT-PCR amplification of the POMC gene in somatotroph, lactotroph, and thyrotroph tumors led to exclusion of the samples from the study.
Based on these criteria, a total of 60 tumors (obtained from 32 men and
28 women) were collected for the present study. They consisted of 50
macroadenomas, with suprasellar extension in 29 cases, and 10
microadenomas, classified on the basis of clinical data,
immunocytochemistry (ICC) analysis, and analysis of hormone gene
expression (Table 1
). They were 14
prolactinomas (P1–P14), 9 somatotroph adenomas (A1–A9) including 3
tumors positive by ICC for both GH and Gsu, and 11 mixed
GH/PRL-secreting adenomas (AP1–AP11) including 2 tumors positive by
ICC for GH, PRL, and Gsu. Expression of the Gsu gene was also
evidenced by Northern blot in 1 additional somatotroph adenoma and 1
additional mixed somato-lactotroph adenoma (Table 1). Three thyrotroph
tumors (T1–T3), 7 corticotroph adenomas (C1–C7; including 1 case
positive by ICC for both ACTH and Gsu), and 16 clinically
nonfunctioning adenomas were also examined. The 16 nonfunctioning
adenomas included 8 tumors positive by ICC for 1 or more of the
glycoprotein hormones subunits (G1–G8) and 8 adenomas negative by ICC
(G9–G16). Northern blot analysis of hormone gene expression evidenced
in all 16 nonfunctioning tumors expression of at least 1 of the genes
encoding the glycoprotein hormone subunits (i.e. Gsu,
LHß, or FSHß; Table 1). Consequently, these tumors are hereafter
referred to as gonadotroph adenomas.
|
ICC
For microscopic examination, tumoral tissue were placed in
Boin’s fixative and embedded in paraffin. Serial 5-mm
paraffin-embedded sections were performed for routine histochemical
techniques (Herlant’s tetrachrome and Periodic acid schiff staining
and ICC). ICC was carried out using an avidin-biotin-peroxidase method
(ABC kit, Vector Laboratories, Inc., Institut Pasteur,
Paris, France), as previously described (21), and specific monoclonal
and polyclonal antibodies. Monoclonal antibodies directed against human
PRL (1:200 dilution), -subunit (1:1000), LHß (1:1000),
FSHß (1:1000), and TSHß (1:1000) were from Immunotech,
monoclonal anti-GH antibody (prediluted) from Amersham
(Les Ulis, France) and polyclonal anti-ACTH antibody from Dakopatts
(Versailles, France). Controls included omission of primary antibody
and irrelevant Igs.
In situ hybridization and microscopic analysis
Double in situ hybridization was performed in
gonadotroph adenomas. The riboprobes used for hybridizing both Ptx2 and
Gsu mRNAs were the same as those employed in the Northern blot
analysis. They were subcloned into pCRscript (Stratagene,
La Jolla, CA), and both were linearized with BamHI
(antisense probe) or NotI (sense probe). Riboprobes were
conjugated to biotin-UTP for detection of Gsu mRNA, and to
[35S]UTP for Ptx2 mRNA according to Grino and Zamora
(22). Briefly, tumor cryosections (6-µm thick) were performed and
aldehyde fixed. After permeabilization, the sections were incubated in
a medium containing streptavidin. The streptavidin-biotin-UTP complex
was then conjugated to horseradish peroxidase and incubated in a medium
containing tetra-rhodamine-isothiocyanate (TRITC)-tyramide to visualize
Gsu mRNA. The Ptx2-[35S]UTP riboprobe was detected by
conventional autoradiography: slide dipping in nuclear emulsion (Ilford
K5, Ilford Anitec, Saint-Priest, France), exposition for 2 months at 4
C, and chemical development. Sections hybridized with the sense
riboprobes were used as controls. Random fields of the specimens were
viewed through a 63X/1.4 planapochromatic objective installed on a
Leica Corp. TCS laser scanning confocal microscope
(Heidelberg, Germany). Fluorescent TRITC signals were generated by a
568-nm excitation laser band and recovered through a photomultiplier
equipped with a high order band-pass filter centered at 600 nm.
Autoradiographic silver grains were detected under interference
contrast optics through a second photomultiplier. Sequential single
channel scannings were performed on the same microscopic field, making
optical sections about 2 µm thick, focused successively on the
fluorescent plan emitting the highest light intensity and on the
autoradiographic focal plane. Both digitized images were transferred to
a microcomputer and overlaid using the Photoshop software (Adobe
System, Inc., Mountain View, CA). To optimize visualization, the
autoradiography plane was inverted to white and contrast enhanced.
RNA purification and Northern blot analysis
Total RNA was extracted and purified from normal and tumoral
pituitary samples using the guanidium isothiocyanate/phenol method (23)
followed by ribonuclease-free deoxyribonuclease I treatment
(Promega Corp., Lyon, France). Twenty micrograms of total
RNA prepared from each specimen were run on a 1% agarose/formaldehyde
gel, transferred by capillarity to nylon membrane, and hybridized with
specific probes (see below). Prehybridization was performed at 42 C in
50% formamide, 6 x SSC (standard saline citrate), 5 x
Denhardt’s solution, 0.5% SDS, and 100 µg/mL denatured salmon sperm
DNA. Hybridization with the deoxy (d)-CTP--32P-labeled
complementary DNA (cDNA) probes (T7 quick-prime kit, Pharmacia Biotech, St. Quentin en Yvelines, France) was performed in the
same buffer (2 x 106 cpm/mL) for 16 h at 42 C.
Blots were washed under stringent conditions with 0.1 x SSC-0.1%
SDS at 60 C. The blots were placed on a phosphor screen (Molecular
Imager, Bio-Rad Laboratories, Inc., Richmond, CA) and
subsequently quantified with the Molecular Analyst program
(Bio-Rad Laboratories, Inc.). An 18S cDNA probe was used
as a control to normalize results for variations in sample
concentrations. The blots were striped (30 min in boiling 0.1 x
SSC-0.1% SDS) and successively hybridized with several probes specific
for anterior pituitary hormones: Pit-1, Ptx1, and Ptx2. DNA probes were
cDNA fragments generated by RT-PCR (see below) specific for PRL (amino
acids 4–199), GH (amino acids 19–203), POMC (amino acids 41–257),
LHß (amino acids 27–145), FSHß (amino acids 75 to 3'-untranslated
region (UTR)), Gsu (amino acids 3–86), and TSHß (amino acids
2–126). Pit-1 gene expression was analyzed using a full-length coding
region cDNA as previously described (21). Full-length human (h)
Ptx1/hBKF cDNA was obtained from Dr. D. A. Clayton, Stanford
University (Stanfrod, CA). A 146-bp specific segment, corresponding to
a region of low homology with Ptx2 located in the C-terminus domain,
was subsequently derived from this cDNA by
ApaI/XhoI digestion (Fig. 1). Ptx2 expression was
analyzed using a 540-bp cDNA fragment located in Ptx2 3'-UTR (Fig. 1).
|
One microgram of total RNA prepared from normal or tumoral pituitary tissues was used for cDNA synthesis with 200 U Superscript II reverse transcriptase (Life Technologies, Cergy-Pontoise, France) primed with 300 ng random primer in 20 µL 50 mmol/L Tris-HCl (pH 8.3), 75 mmol/L KCl, 3 mmol/L MgCl2, 0.5 mmol/L of each dNTP, and 40 U RNasin (Promega Corp.). The reaction mix was incubated for 10 min at 25 C followed by 50 min at 42 C. A negative control was performed for the first strand synthesis, which contained the above reagents but no RT.
cDNA prepared from normal tissue was used to generate cDNA probes to be
used in Northern blot experiments. The following primer sets were
designed from published sequences to amplify specific cDNA fragments:
5'-ttccagaggaaccgctacccc-3' and 5'-aaacgacgagtgctgtttgg-3' for
Ptx1 (564 bp), 5'-caactccgcccttaaagactg-3' and
5'-tcagaacatcattgcatccacc-3' for Ptx2 (536 bp),
5'ttcaactcggtcaacgtggg3' and 5'-tactggcacggactaaggttgg-3' for Ptx3 (368
bp), 5'-cctggcttcaagagggcagt-3' and 5'-cgcaggaatgtctcgaccttg-3' for hGH
(556 bp), 5'-tgtcccggcggggctgcccga-tgccag-3' and
5'-gcagttgttgttgtggatgattcggca-3' for hPRL (575 bp),
5'-aagcaacctgctggagtgcatc-3' and 5'-tggcgtttttgaacagcgtc-3' for POMC
(653 bp), 5'-tcaccgtcaacaccaccatctg-3' and
5'-ggattgagaagcctttattgtggg-3' for hLHß (371 bp),
5'-tatatgaaacagtgagagtgcccg-3' and 5'-cgctacaatgctgaagatgctgac-3' for
hFSHß (599 bp), and 5'-tactacagaaaatatgcagct-3' and
5'-gtgataataacatgaactgc-3' for Gsu (335 bp) respectively.
Amplification of Ptx2 5'-isoforms was carried out using
5'-gcgagaccgagcgagaaagc-3' as an upstream primer and
5'-gcccacgtcctcattcttccc-3' as a downstream primer (Fig. 1
). For each reaction, 1 µL of the
first strand synthesis reaction was amplified for 30 cycles in 10
mmol/L KCl, 20 mmol/L Tris-HCl (pH 8.2), 200 µmol/L dNTPs, 1.5 mmol/L
MgCl2, 50 pmol of each forward and reverse primer, and 2.5
U plaque-forming units DNA polymerase (Stratagene). The
amplification conditions were as follows: denaturation at 94 C for 1
min, annealing at 56 C for 1.5 min, and extension at 72 C for 2 min.
Negative controls were run in parallel with the test tissues using the
negative control of the RT reaction as a template for
amplification.
After purification (Qiaquick gel extraction kit, QIAGEN, Chatsworth, CA), the PCR products corresponding to Ptx2 N-terminus isoforms were subcloned in the plasmid vector pCRscript (Stratagene), according to manufacturer’s instructions. The full-length nucleotide sequence of three individual clones was determined by the dideoxy chain reaction method (24) with the T7 sequencing kit (Pharmacia Biotech).
Statistical analysis
Statistical significance were determined by Mann-Whitney test. Significance was declared at P < 0.05.
|
Results |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
The expression of Ptx1 and Ptx2 in the normal human pituitary was
investigated by Northern blot. Using a Ptx1-specific cDNA probe located
in a region of low homology with Ptx2 (Fig. 1), a single band at about
2.5 kb was evidenced in both fetal (middle and late gestation) and
adult normal tissue (Fig. 2A). The
membrane was subsequently striped and rehybridized with a Ptx2-specific
probe located in the 3'-UTR. Again, a band at about 2.5 kb was revealed
in both fetal and adult tissues (Fig. 1A). For both Ptx1 and Ptx2, the
signal was slightly more intense in the fetal samples than in the adult
tissues when normalized against the 18S band (Fig. 2). The specificity
of the two cDNA probes was controlled in preliminary experiments (data
not shown and see below).
|
), two bands, differing by
about 150 bp, were amplified from human normal fetal and adult
pituitary cDNA and were designated Ptx2a and Ptx2b (Fig. 2B). Sequence
analysis confirmed that the smaller fragment (330 bp; Ptx2a)
corresponded to the Ptx2/Rieg cDNA sequence previously reported in
human. The longer fragment (468 bp; Ptx2b) contained a 138-bp insertion
at the position reported for the alternative spliced form of Ptx2 in
mouse. The predicted amino acid sequence indicated a 46-amino acid
in-frame insertion at amino acid 16 of the N-terminal region of Ptx2
(Fig. 2B) and a resulting Ptx2b isoform 317 amino acids in length.
Ptx3 gene expression was investigated by RT-PCR using specific primers.
No expression could be detected in any of the fetal or adult human
pituitary samples, whereas a specific band was readily amplified from
fetal mesencephalon (Fig. 2C), a tissue known to express this gene
(17).
Ptx1 gene is ubiquitously expressed in the human pituitary adenomas
Figure 3 shows a Northern blot
analysis of Ptx1 gene expression performed in a representative series
of human pituitary adenomas of different types. Examination of this
blot and similar analysis performed on a larger panel of 60 tumors
representative of all anterior pituitary cell lineages evidenced Ptx1
mRNA in all tumors tested (Fig. 4A). This
results indicated that in human, as in murine, Ptx1 is expressed in all
pituitary cell types. Furthermore, quantification of the signals
against the 18S band did not show any significant variation among the
different groups of tumors, except for the gonadotroph adenomas, which
presented with slightly higher Ptx1 mRNA levels (Fig. 4A). Among these
tumors, however, Ptx1 gene expression was variable and did not show any
specific association with expression of the - or ß-subunit of
the gonadotropins (data not shown and Fig. 5).
|
|
|
The pattern of expression of the Ptx2 gene among the
different subsets of pituitary adenomas was more varied, as illustrated
by the representative blot in Fig. 3. Among a total of 60 pituitary
adenomas examined, all corticotroph and somatotroph adenomas were
negative. A moderate signal was detected in the thyrotroph and
lactotroph adenomas, whereas intense signal were observed in the
gonadotroph adenomas (Fig. 4B). The differential expression of Ptx2
among the different types of tumors did not relate to the tumor mass
characteristics (micro- vs. macroadenomas; Table 1), and the
lack of expression of Ptx2 in the corticotroph and somatotroph
confirmed the specificity of the cDNA probes, as Ptx1 is expressed in
these tumors. Finally, the 60 adenoma specimens were also examined by
RT-PCR for the expression of the Ptx2a and -b isoforms. The 330- and
468-bp products specific for mRNA isoforms a and b were detected in
each tumor where Ptx2 was expressed (data not shown).
Ptx2 is preferentially expressed in tumors of the gonadotroph lineage
Quantification of the blots showed very high levels of Ptx2
mRNA in tumors of the gonadotroph lineage (mean value 
4 times those
obtained in normal tissue; Fig. 4B). To further characterize the
phenotypic expression of Ptx2 in these tumors, the expression of
Gsu, LHß, and FSHß genes was determined in all of the
nonfunctioning adenomas (Table 1 and Fig. 5). No correlation was found
between Ptx2 mRNA levels and the presence, absence, or levels of LHß,
FSHß, or Gsu mRNA. This result was further confirmed by double
in situ hybridization analysis of Gsu and Ptx2 mRNAs in
tumors of the gonadotroph lineage. As illustrated in Fig. 6, antisense riboprobes for both
messengers revealed that the gonadotroph adenomas are composed of a
complex cell population. Even when no cell quantitation was performed,
microscopic fields showed a great majority of cells emitting red
fluorescence with variable intensity, indicating the differential
expression of Gsu mRNA. A large proportion of the TRITC-labeled
cells was also covered with clusters of silver grains, revealing the
coexpression of both Gsu and Ptx2 mRNAs (Fig. 6, A and B). A
minority of cells monolabeled for either Ptx2 mRNA or Gsu mRNA as
well as a minority of completely unlabeled cells were consistently
observed in all specimens (Fig. 6A). Sections hybridized with sense
riboprobe were completely unlabeled (Fig. 6C).
|
Gsu gene expression was
also supported by the presence in our series of one corticotroph
adenoma and three adenomas of the somatotroph lineage expressing
Gsu, but not Ptx2 (data not shown and Fig. 7).
|
Thirty-four tumors of the somato-lactotroph phenotype were
analyzed. Among these tumors, the presence of Ptx2 mRNA appeared
strictly correlated to that of PRL mRNA (Fig. 4B). Indeed, all of the
prolactinomas displayed Ptx2 gene expression, whereas among the 20
somatotroph adenomas analyzed, only the tumors presenting with a mixed
somato-lactotroph phenotype (n = 11) were positive for Ptx2. The
pure somatotroph adenomas (n = 9), including those expressing both
GH and Gsu, were negative, even when the presence of Ptx2 mRNA was
examined by PCR (data not shown). A blot representative of these
results is presented in Fig. 7. Although mRNA encoding the pituitary
transcription factor Pit-1 are observed in all samples, Ptx2 mRNAs are
only detected in those tumors that express the PRL gene. At a
quantitative level, Ptx2 mRNA levels measured in the PRL- and mixed
PRL/GH-secreting adenomas were low compared to those in normal tissue,
varying from a barely detectable signal to about one fifth of the
values measured in normal tissue (Fig. 4B).
|
Discussion |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
The present study reports on the pattern of expression of these related transcription factors in the human anterior pituitary. In agreement with studies in rodents, no Ptx3 gene expression could be detected in this tissue, whereas high levels of Ptx1 and Ptx2 mRNA were evidenced in both fetal and adult human anterior pituitary glands. Distinct patterns of expression were observed for Ptx1 and Ptx2 in the different subsets of human pituitary adenomas. However, when normalized for the amount of RNA, the overall mean Ptx1 and Ptx2 mRNA levels in the different types of tumors were not very different from those measured in the normal tissues. Furthermore, the cell-specific pattern of distribution of the two factors among the different types of tumors is consistent with the data obtained with murine cell lines (12, 13). Altogether, these data did not favor the hypothesis of a major involvement of Ptx1 and Ptx2 in the pathogenesis of human pituitary adenomas.
Most pituitary adenomas are monoclonal in origin (25), present as relatively monomorphous tissues with specific patterns of differentiation, and are indeed quite representative of the different pituitary cell lineages. Examination of the expression of other transcription factors, such as Pit-1 or SF-1 in human pituitary tumors, has previously shown to be informative on the roles of these factors in pituitary cytodifferentiation (26, 27). We therefore determined the pattern of expression of Ptx1 and Ptx2 in different types of human pituitary adenomas to further characterize the cell-specific expression of these genes in human.
Similar to what was described in murine, Ptx1 presented with a
ubiquitous pattern of distribution in human, being expressed at
constant levels in all pituitary cell types. Ptx1 mRNA levels measured
in the gonadotroph tumors were, however, slightly higher than those
measured in the other subtypes, which is reminiscent of the high levels
of Ptx1 mRNA reported in the gonadotroph precursor cell line T3
(12). In this cell line, the expression of Gsu was shown to be
highly dependent on Ptx1. In our study, however, Ptx1 gene expression
did not correlate to Gsu expression.
The pattern of expression of Ptx2 among the various subsets of tumors
was more contrasted. The main feature was the high levels of Ptx2 mRNA
detected in the gonadotroph tumors compared to those in the other types
of tumors. In agreement with previous reports (28), most of the
clinically nonfunctioning tumors analyzed in the present study,
whatever the immunostaining characteristics (gonadotropin positive or
negative), expressed at least one of the subunits of the gonadotropin
hormones. Ptx2 was expressed in all of these tumors, although no
specific association with one of the subunits of the gonadotropin
hormones could be evidenced. A common lineage for gonadotrophs and
thyrotrophs is also expected, as they both synthesize the Gsu shared
by the glycoprotein hormones. The Gsu is the first hormone gene
expressed in development (1, 2), and Ptx2 is also expressed in the
thyrotroph cells. A correlation between the expression of these two
genes could therefore be expected. This conclusion, however, was not
reached in our study, as detailed analysis by Northern blot and
in situ hybridization of various human pituitary adenomas
expressing Gsu did not show constant coexpression of the Ptx2 genes
in these tumors.
Another striking feature of Ptx2 gene expression was that in tumors of the somato-lactotroph lineage. Among a panel of 34 tumors expressing GH, PRL, or both, expression of Ptx2 was strictly correlated to that of PRL. During the embryonic development of the anterior pituitary gland, the five endocrine cell types arise in a specific spatial and temporal pattern (1, 2). The somatotropes arising on embryonic day 15 in the mouse, and the lactotropes arising postnatally are thought to be derived by a common precursor the mammosomatotroph (29). A common embryologic stem cell has been also suggested in human for the PRL- and GH-secreting cells (30). Well differentiated sommatotrophs are first identified at 8 weeks gestation in human, whereas mammosomatotrophs and characteristic lactotrophs are detected in the human fetal gland at 12 and 24 weeks gestation, respectively (3). The expression of both PRL and GH genes is dependent on the presence of the pituitary-specific transcription factor Pit-1 (31). However, because expression of the PRL and GH genes is ultimately confined to distinct lactotroph and somatotroph populations despite the presence of Pit-1 protein in both cell types, there must be additional factors involved in the cell-specific pattern of GH and PRL genes activation. Activation of the PRL and GH genes indeed involves a complex of nuclear proteins, and cooperative interactions between Pit-1 and other classes of transcription factors were shown to be important for full activities and regulation of the PRL and GH promoters (for review, see Ref. 32). For example, Pit-1 was shown to cooperate with thyroid hormone and retinoic acid receptors to stimulate rat GH gene expression (33), and transcriptional synergism between estrogen receptor and Pit-1 in PRL gene activation has been well characterized (34). In a recent study (12), Tremblay et al. analyzed the functional role of Ptx1 in trans-activation of the pituitary hormone genes. Most pituitary hormone genes were trans-activated by Ptx1, and interestingly, Ptx1 exhibited synergistic activation with Pit-1 on the PRL gene promoter and less so on the GH promoter. More recently, researchers suggested that the action of Ptx2 on these promoters was very similar to that of Ptx1 (35), but synergism of Ptx2 with Pit-1 has not yet been clearly established. These results together with the report in the present paper of a differential expression of Ptx2 gene within lactotroph and somatotroph cells support the idea of a potential role for Ptx2 in the cell-specific expression of the PRL and GH genes. An analysis of Ptx1 and Ptx2 protein levels in the normal somatotroph and lactotroph cell types would be required, however, to confirm this hypothesis.
In summary, Ptx1 presents a ubiquitous pattern of expression in the
different pituitary cell types in humans. In contrast, Ptx2 is not
expressed in corticotroph cells, whereas high Ptx2 mRNA levels are
present in the gonadotroph cells. In these tumors, however, Ptx2 gene
expression is not correlated to other markers of the gonadotroph
lineage differentiation, such as Gsu, LHß, or FSHß. Finally,
Ptx2 is also expressed in pure lactotroph adenomas and not in
somatotroph adenomas. Ptx2 is, therefore, the first paired homeodomain
pituitary transcription factor differentially expressed in these two
lineages, which derive from a common precursor. These results support a
role for Ptx2 in terminal differentiation of somatotroph and
lactotroph cell phenotypes.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received November 30, 1998.
Revised February 24, 1999.
Accepted March 4, 1999.
|
References |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  N. Harbeck, I. Nimmrich, A. Hartmann, J. S. Ross, T. Cufer, R. Grutzmann, G. Kristiansen, A. Paradiso, O. Hartmann, A. Margossian, et al. Multicenter Study Using Paraffin-Embedded Tumor Tissue Testing PITX2 DNA Methylation As a Marker for Outcome Prediction in Tamoxifen-Treated, Node-Negative Breast Cancer Patients J. Clin. Oncol., November 1, 2008; 26(31): 5036 - 5042. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Lamba, V. Khivansara, A. C. D'Alessio, M. M. Santos, and D. J. Bernard Paired-Like Homeodomain Transcription Factors 1 and 2 Regulate Follicle-Stimulating Hormone {beta}-Subunit Transcription through a Conserved cis-Element Endocrinology, June 1, 2008; 149(6): 3095 - 3108. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A Fratticci, F A Grieco, C Spilioti, F Giangaspero, L Ventura, V Esposito, M Piccirilli, A Santoro, A Gulino, G Cantore, et al. Differential expression of neurogenins and NeuroD1 in human pituitary tumours J. Endocrinol., September 1, 2007; 194(3): 475 - 484. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. S. Moreno, C.-O. Evans, X. Zhan, M. Okor, D. M. Desiderio, and N. M. Oyesiku Novel Molecular Signaling and Classification of Human Clinically Nonfunctional Pituitary Adenomas Identified by Gene Expression Profiling and Proteomic Analyses Cancer Res., November 15, 2005; 65(22): 10214 - 10222. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Machinis and S. Amselem Functional Relationship between LHX4 and POU1F1 in Light of the LHX4 Mutation Identified in Patients with Pituitary Defects J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5456 - 5462. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Dutta, J.-E. Dietrich, G. Aspock, R. D. Burdine, A. Schier, M. Westerfield, and Z. M. Varga pitx3 defines an equivalence domain for lens and anterior pituitary placode Development, April 1, 2005; 132(7): 1579 - 1590. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Romano, K. Magalon, A. Ciampini, C. Talet, A. Enjalbert, and C. Gerard Differential Involvement of the Ras and Rap1 Small GTPases in Vasoactive Intestinal and Pituitary Adenylyl Cyclase Activating Polypeptides Control of the Prolactin Gene J. Biol. Chem., December 19, 2003; 278(51): 51386 - 51394. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Gariboldi, M. Spinola, S. Milani, C. Pignatiello, K. Kadota, H. Bono, Y. Hayashizaki, T. A. Dragani, and Y. Okazaki Gene expression profile of normal lungs predicts genetic predisposition to lung cancer in mice Carcinogenesis, November 1, 2003; 24(11): 1819 - 1826. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Vallette-Kasic, D. Figarella-Branger, M. Grino, A.-M. Pulichino, H. Dufour, F. Grisoli, A. Enjalbert, J. Drouin, and T. Brue Differential Regulation of Proopiomelanocortin and Pituitary-Restricted Transcription Factor (TPIT), a New Marker of Normal and Adenomatous Human Corticotrophs J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 3050 - 3056. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-H. Quentien, I. Manfroid, D. Moncet, G. Gunz, M. Muller, M. Grino, A. Enjalbert, and I. Pellegrini Pitx Factors Are Involved in Basal and Hormone-regulated Activity of the Human Prolactin Promoter J. Biol. Chem., November 8, 2002; 277(46): 44408 - 44416. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Kimura, S. Tomizawa, K. N. Arai, R. Y. Osamura, and N. Kimura Characterization of 5'-Flanking Region of Rat Somatostatin Receptor sst2 Gene: Transcriptional Regulatory Elements and Activation by Pitx1 and Estrogen Endocrinology, April 1, 2001; 142(4): 1427 - 1441. [Abstract] [Full Text]
|
|
|
|
|
|
R. H. Skelly, M. Korbonits, A. Grossman, G. M. Besser, J. P. Monson, J. F. Geddes, and J. M. Burrin Expression of the Pituitary Transcription Factor Ptx-1, But Not That of the Trans-Activating Factor Prop-1, Is Reduced in Human Corticotroph Adenomas and Is Associated with Decreased {alpha}-Subunit Secretion J. Clin. Endocrinol. Metab., July 1, 2000; 85(7): 2537 - 2542. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
