| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Departments of Pathology, Cell Biology and Anatomy, and Neurology (T.W.A., N.E.R.), University of Arizona College of Medicine, Tucson, Arizona 85724; and Department of Comparative Medicine (M.L.V.), Wake Forest School of Medicine, Winston-Salem, North Carolina 27157
Address all correspondence and requests for reprints to: Naomi E. Rance, M.D., Ph.D., Department of Pathology, University of Arizona College of Medicine, Tucson, Arizona 85724. E-mail: nrance{at}u.arizona.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-napthyl butyrate esterase histochemistry
was used to visualize microglial cells. Both estrogen and estrogen plus
progesterone treatments produced a marked suppression of the number of
infundibular neurons expressing NKB gene transcripts. In contrast, HRT
had no effect on the POMC system of neurons or the number of microglial
cells in the infundibular nucleus. These results provide strong support
for the hypothesis that the increased NKB gene expression in the
hypothalamus of postmenopausal women is secondary to estrogen
withdrawal. Conversely, these data suggest that the dramatic decline in
the numbers of neurons expressing POMC gene transcripts in older women
is caused by factors other than ovarian failure. Finally, we found no
evidence that HRT, in doses designed to mimic currently prescribed
regimens, produces signs of estrogen toxicity in the primate
infundibular nucleus. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Human menopause is associated with marked changes in hypothalamic neuronal morphology and neuropeptide gene expression (7, 8, 9, 10). There is somatic hypertrophy of neurons in the infundibular nucleus of postmenopausal women, which is characterized by enlarged nuclei and nucleoli and increased Nissl substance (rough endoplasmic reticulum) (7, 8). Postmenopausal neuronal hypertrophy occurs in a subpopulation of infundibular neurons expressing estrogen receptor, neurokinin B (NKB), and substance P gene transcripts (8, 9). There is a marked increase in the number of neurons expressing tachykinin gene transcripts (9), and gene expression also increases in a separate subpopulation of GnRH neurons within the medial basal hypothalamus (10). We have hypothesized that the dramatic increase in hypothalamic NKB gene expression in postmenopausal women is secondary to the ovarian failure of menopause.
More recently, we have described a decline in the number of neurons
expressing proopiomelanocortin (POMC) messenger RNA (mRNA) in
the infundibular nucleus of postmenopausal women (11). POMC is the
precursor for ß-endorphin, which has been implicated in a variety of
functions, including neuroendocrine and autonomic regulation, mood,
memory, locomotion, reinforcement, and nociception (12, 13, 14, 15, 16). Other
cleavage products of hypothalamic POMC include ACTH and -MSH (17).
These peptides have important physiological roles in the central
nervous system as modulators of the immune response (18) and in the
regulation of body weight (19, 20, 21). Thus, alterations in the function
of the hypothalamic POMC system may have a considerable impact on the
health of older women.
Because menopause is characterized by changes in both age and ovarian status, it is difficult to ascertain whether the changes in NKB and POMC gene expression in postmenopausal women are caused by hypothalamic aging or loss of ovarian hormones. To address this question, we used the young, ovariectomized cynomolgus monkey as a primate model of menopause to test the effects of hormone replacement on hypothalamic neuropeptide gene expression. If the changes observed in postmenopausal women are secondary to ovarian withdrawal, the replacement of ovarian hormones in ovariectomized monkeys should result in decreased numbers of NKB mRNA-expressing neurons, and conversely, increased numbers of POMC neurons in the monkey infundibular nucleus.
A second goal of the present study was to determine whether long-term HRT, in doses designed to mimic those currently prescribed to postmenopausal women, produces signs of estrogen toxicity in the primate hypothalamus. The toxic effects of long-term continuous estrogen treatment have been well described, and this toxicity produces a syndrome that resembles primary hypothalamic aging in the rat (22, 23). Although continuous HRT is currently prescribed to millions of women, it is not known whether a similar hypothalamic neuropathology occurs secondary to sustained estrogen exposure in primates. Therefore, we determined whether long-term HRT results in decreased numbers of POMC neurons and/or increased microglial activity in the primate infundibular nucleus. These two parameters were selected for study because they have been shown to be sensitive and specific markers of estrogen toxicity in the rat (23, 24).
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Hypothalami were donated from monkeys enrolled in a study of the effects of HRT on coronary atherosclerosis conducted by the Comparative Medicine Clinical Research Center and the Department of Comparative Medicine at the Wake Forest School of Medicine (25). Animal treatments were carried out in compliance with state and federal laws, standards of the Department of Health and Human Services, and the guidelines of the Institutional Animal Care and Use Committee at the Wake Forest School of Medicine. Twenty-four adult female cynomolgus macaques (Macaca fascicularis) ranging in age from 5–13 yr were imported from Indonesia (Charles River Primates, Port Washington, NY). The monkeys were housed in social groups of 4–8 with indoor/outdoor facilities. Perches and barrels were provided for playing and hiding. The monkeys were ovariectomized under ketamine and xylazine anesthesia. All animals received a moderately atherogenic diet consisting of 43% of calories from fat and 0.44 mg cholesterol per kilocalorie. After 2 yr they were switched to a lipid-lowering diet for the remainder of the study. For a detailed description of the diet as well as plasma lipid profiles see Ref. 25 .
Two years after ovariectomy, the animals were divided into three experimental groups: untreated ovariectomized controls (OVX), continuous estrogen treatment (OVX +E), and estrogen plus progesterone (OVX + EP). Conjugated equine estrogen (Premarin, Wyeth-Ayerst Laboratories, Inc., Radnor, PA) was used for an initial treatment period of 7.2 µg/day for 8 months and then increased to 0.17 mg/day (per 4 kg BW). Medroxyprogesterone acetate (Cycrin, ESI Lederle, Philadelphia, PA) was given at a dose of 650 µg/day (per 4 kg BW). Based on adjustments for body size and metabolic rate, the final dosages were calculated to be equivalent to a women’s daily dose of 0.625 mg Premarin or 2.5 mg medroxyprogesterone. The hormones were administered twice daily in the diet. The animals received either HRT or no hormone treatment for a total of 30 months before death.
Plasma concentrations of 17ß-estradiol were determined in these animals 4 h after feeding, using a commercially available kit (Diagnostic Products Corporation, Los Angeles, CA). This assay had a sensitivity of 5–7 pg/mL. The mean plasma estradiol level in the OVX group was at the lower limit of sensitivity (5.1 ± 1.3 pg/mL). This value was significantly elevated in both the OVX + E (163.9 ± 18.9 pg/mL) and OVX + EP (147.6 ± 8.7 pg/mL) groups. For information concerning plasma levels of medroxyprogesterone in cynomolgus monkeys receiving these dosages, see Ref. 26 .
Animals were killed between 0900 and 1300 h. At this time, the animals were restrained with ketamine (15 mg/kg, im), deeply anesthetized with sodium pentobarbital (35 mg/kg, iv), and perfused transcardially with cold, 0.1 mol/L PBS (pH 7.4). The brains were rapidly removed and sliced into 1-cm slabs with the aid of a monkey brain matrix. A slab containing the hypothalamus was dissected by rostral cuts at the level of the optic chiasm and caudal cuts through the mammillary bodies. The hypothalami were dissected out of the slabs by a horizontal cut at the level of the anterior commissure and a parasagittal cut 1 cm from the midline. The hypothalami were bisected and frozen in isopentane cooled to -30 C. A unilateral hypothalamus from each animal was packed in dry ice and shipped to the University of Arizona, where it was stored at -80 C. One OVX + E animal was excluded from the study because of damage to the infundibular nucleus during tissue preparation. The remaining hypothalami were serially sectioned in a cryostat (12-µm thickness), and sections were mounted on gelatin-coated slides. The slides were stored at -80 C until hybridization.
In situ hybridization
Every 10th section was hybridized with [35S]-labeled 48-base synthetic oligonucleotide probes complementary to either human NKB or POMC mRNAs. All slides were processed within the same hybridization procedure. The sequence of the NKB probe was: CTGGCTGGACGCTCATCTTGCCCATAAGTCCCACAAAGAAATCATGCA (Dr. T. Bonner, personal communication). The POMC probe was complementary to bases 7,106–7,153 of the pre-POMC gene (17). The probes were synthesized on an automated DNA synthesizer (PE Applied Biosystems Incorporated model 380A; Foster City CA) and purified by PAGE gels. The probes were end-labeled using terminal deoxynucleotidyl transferase (Boehringer Mannheim, Indianapolis, IN) and [35S]deoxy-ATP (>1000 Ci/mmol/L; New England Nuclear, Boston, MA).
On the day of hybridization, sections were thawed to room temperature, fixed in 4% formalin-PBS for 5 min, placed in 0.25% acetic anhydride in 0.1 mol/L triethanolamine (pH = 8) for 10 min, and then delipidized in increasing concentrations of ethanol to 100%, followed by chloroform. The slides were then sequentially dipped in 100% and 95% ethanol and allowed to dry. Sections were incubated in a humid chamber overnight at 37 C in 106 dpm [35S]-labeled probe per 60 µL hybridization buffer under paraffin coverslips. The buffer consisted of 50% formamide, 600 mmol/L NaCl, 80 mmol/L Tris-HCL (pH 7.5), 4 mmol/L EDTA, 0.1% sodium pyrophosphate, 0.2% SDS, 0.2 mg/mL heparin sulfate, 10% dextran sulfate, and 100 mmol/L dithiothreitol. The following day, slides were washed four times in 2 x SSC (1 x SSC = 150 mmol/L NaCl and 15 mmol/L Na citrate)/50% formamide at 40 C for 15 min each and then 2 washes in 1 x SSC at room temperature for 30 min each. Slides were dipped into water, then 70% ethanol, and were air-dried. The slides were then dipped into NTB-3 under safelight conditions, (diluted 1:1 with water, Eastman Kodak Co., Rochester, NY) and stored in the dark at 4 C. Test slides were developed to determine optimum length of exposure. The NKB slides were developed after 2 months of exposure, and the POMC slides after 1 week of exposure by sequential immersion for 2 min in Dektol Developer (17 C, diluted 1:1 with water), water, and Fixer (EDF/EDP photochemicals, Eastman Kodak Co.). After rinsing, the sections were counterstained with toluidine blue.
The specificities of the probes have been previously demonstrated in human hypothalamic tissues using Northern analysis at the same conditions of stringency (9). In addition, no signal was present when monkey hypothalamic sections were hybridized either to NKB or POMC sense probes or in buffer without probe. The distribution of the labeled cells in the infundibular nucleus was similar to previous descriptions of NKB or POMC mRNAs in human or monkey hypothalamus (27, 28, 29). Finally, immunocytochemical studies have shown similar distributions of ß-endorphin- (30, 31), POMC- (32), and tachykinin-immunoreactive neurons (33) in the monkey infundibular nucleus.
Histochemistry for microglial cells
Monocytes and tissue histiocytes express unique, sodium
fluoride-sensitive esterases such as -napthyl butyrate esterase
(34, 35, 36). Brain microglia are also identified by these enzymatic
markers, consistent with the hematopoetic origin of these cells (37, 38). Esterase activity in microglia has been demonstrated in a variety
of species, including mouse, rat, guinea pig, and human (37, 38, 39, 40). In
culture, increased microglial esterase activity is correlated with
increased phagocytic activity and the morphologic characteristics of
activated microglia (40, 41). Resting microglia in uninjured brain also
express esterase activity (38). An increase in the number of activated
microglia in adult animals is a sensitive and reliable marker of
neuropathology (42, 43) and a key feature of the estrogen-associated
toxicity in rodents (24).
In the present study, microglial cells were identified by staining for
-napthyl butyrate esterase according to the method of Li et
al. (34). Sections were fixed in cold 45% acetone, 10% buffered
formalin for 30 sec, followed by three rinses in distilled water. They
were air-dried and then incubated for 45 min in a substrate mixture
consisting of 0.64 mol/L ethylene glycol monomethyl ether, 0.063 mol/L
phosphate buffer (pH 6.3), 4.6 mmol/L -napthyl butyrate, and 0.3
mmol/L hexazotized pararosanilin. Sections were rinsed three times in
distilled water, counterstained in Weigert’s hematoxylin for 10 min,
rinsed in running tap water for 5 min, dried, and coverslipped. A
section from normal tonsil was used as a positive control for
macrophage staining. Incubation with sodium fluoride, a specific
inhibitor of esterase activity in monocytes, eliminated all specific
staining in both tonsil and brain.
Computer microscope analysis
Before all procedures, slides were coded to prevent experimenter bias. Because our previous studies of POMC neurons in the human hypothalamus revealed considerable regional heterogeneity (11), we decided to limit our analysis to matched sections at easily identified hypothalamic levels. For measurements of NKB mRNA-containing neurons and microglial cells, two matched sections per animal were selected in the infundibular nucleus corresponding to section 840 of a monkey hypothalamic atlas (44). For analysis of POMC neurons, one matched section was selected corresponding to sections 800, 840, and 884 of Bleier’s atlas (44), to include the retrochiasmatic region and the anterior and posterior levels of the infundibular nucleus, respectively. Slides with significant sectioning artifact in the representative regions were excluded from microscopic analysis.
All labeled neurons (defined as 5X background) within each matched
section were marked and counted and the perimeters digitized for
calculations of form factor and cell area. These data were obtained
using an image-combining computer microscope and Neurolucida Software
(Microbrightfield, Baltimore, MD). First, the perimeter of the
infundibular nucleus was manually digitized using a 4x Zeiss
objective. The infundibular nucleus section was then scanned using a
63x Zeiss planapochromatic oil-immersion objective, and every labeled
cell was counted and the somatic perimeter digitized. Neuronal profile
areas were calculated from these digitized perimeters. The shapes of
neuronal profiles were quantified using the form factor index, defined
as the area of the profile divided by the area of a circle having the
same perimeter [4
x area/perimeter2, (45, 46)]. Thus,
form factor index measures the degree to which the shape of a profile
deviates from a perfect circle. Form factor index has also been used in
the model of estradiol-valerate induced toxicity to assess degenerative
changes in ß-endorphin immunoreactive neurons (47).
Twenty POMC neurons were selected in each matched section, for analysis of autoradiographic grains using a systematic sampling strategy. In this strategy, the entire infundibular nucleus was systematically scanned, and every nth labeled neuron (n = total number of labeled neurons within a section divided by 20) was analyzed. These data were collected with a Bioquant Meg IV image-analysis microscope system (R & M Biometrics, Nashville, TN) and BioQuant MEG IV counting and microdensitometry software (R & M Biometrics). Images were captured with a DAGE-MTI Series 65 black and white video camera attached to a Zeiss standard microscope with a 100x Zeiss planapo oil-immersion objective (Carl Zeiss, Berlin, Germany). The light intensity was first standardized, and the Nissl counterstain was suppressed with gel filters (Kodak Wratten 72B and 50; Eastman Kodak Co.), so that only dark silver grains were observed in the video image. The threshold was then adjusted so that only the silver grains were measured, and all the grains associated with each cell were counted. For each slide, background grains (approximately 2–3 grains/neuron) were measured in an adjacent region of nonlabeled tissue, and this value was subtracted from the number of grains for each neuron.
Statistical analysis
For all statistical analyses, the mean values for each animal
were calculated. These values were then used to calculate the mean of
each experimental group. Because no NKB neurons were detected in either
the OVX + E or OVX + EP groups (see results below), the mean number of
NKB neurons in the OVX group was compared with a hypothesized value of
0, using a t test. Differences in POMC parameters and the
numbers of microglia between treatment groups were analyzed by one-way
ANOVA. Because there were no differences in any of the parameters of
POMC neurons among the various treatment groups, these data were pooled
for further analysis of differences among hypothalamic regions. The
differences among POMC neurons in the different hypothalamic regions
were analyzed by one-way ANOVA with repeated measures. Tukey’s
post tests were used, with = 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Neurons containing NKB mRNA were identified within the
infundibular nucleus of the OVX monkeys that did not receive HRT (Fig. 1
). These neurons were located
preferentially in the medial-ventral infundibular nucleus similar to
the distribution of NKB mRNA-containing neurons in human and rat
hypothalamus (29, 48). The NKB neurons in OVX animals exhibited
prominent central nucleoli and well-defined Nissl substance with a mean
profile area of 284.2 ± 18.2 µm2. These morphologic
features were similar to the hypertrophied NKB neurons identified in
the postmenopausal human hypothalamus (9).
|
). NKB neurons were identified in every
infundibular nucleus section in the OVX group (18.3 ± 5.3 NKB
neurons/section, mean ± SEM, n = 8). In
contrast, there were no NKB neurons detected in the infundibular
nucleus of any of the monkeys in either the OVX + E (n = 7) or OVX
+ EP (n = 5) groups (P < 0.004).
|
Neurons labeled with the POMC probe were identified throughout the
retrochiasmatic region and infundibular nucleus. A few POMC neurons
were also scattered dorsally in the ventromedial nucleus. HRT had no
significant effect on the POMC system of neurons in the medial basal
hypothalamus of ovariectomized, cynomolgus monkeys (Fig. 2
). The number
of neurons expressing POMC mRNA was not significantly altered by
treatment with either estrogen or estrogen plus progesterone at any
level of the hypothalamus. Furthermore, the sectional profile area and
the number of grains/POMC neuron was unaltered by hormone replacement.
Finally, analysis of form factor revealed no differences in the shape
of POMC neurons among the three treatment groups.
There were qualitative morphological differences between POMC neurons
in the retrochiasmatic area and infundibular nucleus. Similar to the
human (11, 28), POMC neurons in the retrochiasmatic area were oriented
parallel to the pituitary stalk, and appeared larger and more elongated
than POMC neurons at more posterior levels (Fig. 3). Significant regional differences in
POMC neurons were also revealed by the quantitative analysis (Table 1). In particular, POMC neurons in the
retrochiasmatic area had significantly larger mean profile areas, were
more elongated (decreased form factor index), and were more numerous
than in the anterior infundibular nucleus. The POMC neurons in the
anterior infundibular nucleus, in turn, had significantly larger mean
profile areas, decreased form factor index, and were more numerous than
in the posterior infundibular nucleus. All morphological differences
across hypothalamic regions were independent of treatment group.
|
|
-Napthyl butyrate esterase histochemistry revealed
intensely-stained microglial cell bodies and short microglial processes
in the hypothalamus and adjacent brain (Fig. 4). Many of the cell bodies of microglial
cells contained dark, granular inclusions. Consistent with previous
reports, microglial morphology showed considerable variation (49, 50).
Microglia in gray matter were round to oval, measuring about 9 µm in
diameter; whereas in white matter tracts, microglia were thin and
elongated. There were no positive cells in the cynomolgus monkey brains
exhibiting macrophage morphology (eccentric nuclei and round,
well-defined cytoplasmic contours). In contrast, in the control
sections from human tonsil, scattered macrophages were observed.
Addition of sodium fluoride to the incubation mixture eliminated the
specific staining in tonsil and in cynomolgus monkey brain.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Treatment of young ovariectomized monkeys with either conjugated estrogen or estrogen plus medroxyprogesterone caused a marked decrease in the number of infundibular neurons expressing NKB gene transcripts. The extent of suppression of NKB neurons was dramatic: no NKB neurons were detected in the infundibular nucleus of any of the animals receiving HRT. In contrast, in the ovariectomized, nontreated group, neurons containing NKB mRNA were observed in every animal. These data provide strong evidence that the increased NKB gene expression detected in the infundibular nucleus of postmenopausal women is secondary to ovarian failure and the loss of ovarian estrogen secretion.
Our findings are consistent with studies showing that continuous estrogen treatment results in decreased numbers of NKB-immunoreactive neurons in the rat arcuate nucleus, the homologue of the primate infundibular nucleus (62). Conversely, gonadectomy of both male and female rats increases the number of arcuate neurons expressing NKB gene transcripts (48, 63). Tachykinin-immunoreactive neurons in the rat arcuate nucleus contain androgen (64) and estrogen receptors (65), and NKB mRNA-containing neurons in the human infundibular nucleus express estrogen receptor gene transcripts (9). These data indicate that the inhibitory actions of gonadal steroids on NKB gene expression could be mediated via intranuclear estrogen receptors. It is not known whether the effect of estrogen on NKB gene expression is secondary to repression of gene transcription or decreased NKB mRNA stability. In the anterior pituitary gland, however, estradiol inhibits ovine FSH-ß mRNA synthesis by direct transcriptional repression (66).
Because previous studies have shown that levels of mRNA correlate with changes in neuronal activity (67, 68, 69, 70, 71), the present study suggests that estrogen decreases the activity of infundibular NKB neurons in ovariectomized monkeys. Electrophysiological studies have also provided evidence that activity of infundibular neurons is inhibited by estradiol in ovariectomized monkeys. In particular, the rhythmic bursts of multiunit activity that are associated with the pulsatile release of LH (the GnRH pulse generator) are dramatically suppressed by estrogen treatment (72, 73, 74). The neuropeptide and/or neurotransmitter phenotype of the pulse generator cells is presently unknown. There is considerable overlap, however, between the location of NKB neurons and the GnRH pulse generator in the monkey infundibular nucleus (75). These considerations, combined with the inhibitory effects of estrogen on both pulse generator activity and the cellular levels of NKB mRNA, raise the possibility that infundibular NKB neurons could contribute to the multiunit activity that is associated with GnRH pulses in the primate hypothalamus.
In contrast to the dramatic suppressive effect of HRT on the NKB system of neurons, no changes were detected in the POMC neurons in either the infundibular nucleus or retrochiasmatic area. These findings are in agreement with a previous study on the effects of castration and testosterone replacement on POMC gene expression in the infundibular nucleus of male macaques (27). In that study, hormone replacement of castrated animals did not produce significant changes in the number of autoradiographic grains per neuron at three comparable levels of the medial basal hypothalamus. Testosterone replacement did produce a significant increase in POMC autoradiographic grains in the rostral monkey hypothalamus superior to optic chiasm (27). This level, however, was not examined in the present study. Although we cannot exclude the possibility that different replacement or sampling regimens might have produced detectable changes in POMC neurons, clearly the present paradigm was very effective in demonstrating estrogen modulation of NKB gene expression. The failure of HRT to induce a change in POMC gene expression in the infundibular nucleus in young, ovariectomized monkeys suggests that factors other than ovarian steroid withdrawal, such as aging, may be responsible for the decline in POMC gene expression in postmenopausal women.
The morphology of POMC neurons in the monkey hypothalamus was regionally heterogeneous, with the neurons in the retrochiasmatic region appearing larger and more elongated than those in the infundibular nucleus. Because these observations were made solely from coronal sections, it is possible that the regional differences in form factor and cell size reflect differences in cell orientation. In our previous human studies, however, similar observations were made using both sagittal and coronal sections (11, 28). Corresponding shape and size differences of POMC neurons have not been reported in the rodent, but regional heterogeneity has been described in the regulation of POMC gene expression (76, 77, 78). In addition, there are differences in POMC axonal projections, depending on their rostral-caudal location within the medial basal hypothalamus of the rat (78, 79). These findings suggest that subpopulations of POMC neurons may be organized topographically in the hypothalamus and could provide an explanation for the diverse set of functions attributed to this neuropeptide system.
We found no evidence that continuous estrogen replacement produced hypothalamic toxicity in primates. The toxic effect of estradiol on the reproductive axis has been demonstrated by a variety of methods, including implantation of silastic capsules (24, 80), oral administration (81), and injections of estradiol valerate (82, 83). The best-characterized model of estrogen toxicity has been the estradiol-valerate treated rat. In these rats, a progressive arcuate lesion develops that is characterized by increased microglial and astrocytic markers (82, 83), degeneration of axons and dendrites (82), and reduction in the number of ß-endorphin immunoreactive neurons (47). In addition, the remaining ß-endorphin-immunoreactive neurons exhibited morphological features of degeneration, including a significant reduction in the form factor index (47).
In the present study, we evaluated two sensitive and specific indicators of estrogen toxicity based on the rodent model: POMC neurons and microglial cells. No change was detected in the number of infundibular neurons expressing POMC gene transcripts in monkeys receiving either estrogen or estrogen plus progesterone. In addition, no differences between treated and untreated groups were observed in the size or autoradiographic grain density of POMC neurons. Furthermore, no changes were detected in the shape (form factor index) of POMC neurons in the hormone-replaced animals. Finally, there were no alterations in the numbers of microglial cells in the infundibular nucleus of ovariectomized monkeys with or without HRT, and no evidence of activated microglia in these animals. Thus, we found no evidence for a neuropathological effect of sustained, unopposed estrogen in the primate hypothalamus.
In summary, the present data suggest that different mechanisms mediate two of the major changes observed in the hypothalamus of postmenopausal women. Clearly, NKB gene expression in the primate hypothalamus is exquisitely sensitive to alterations in circulating estrogen. These data strongly support the hypothesis that increased NKB gene expression in postmenopausal women is caused by estrogen withdrawal. In contrast to the dramatic changes in the NKB system, there were no effects of hormone replacement on several parameters of POMC neurons in the infundibular nucleus. Thus, the decrease in POMC neurons in postmenopausal women may be caused by factors other than ovarian steroid withdrawal, such as hypothalamic aging. Although loss of POMC neurons and reactive microglial changes have been linked to estrogen exposure in the rat, we found no evidence for estrogen toxicity in primates treated with continuous replacement therapy. These findings are of particular importance given the millions of women currently receiving HRT and the increasing popularity of the continuous replacement regimens.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Recipient of a Predoctoral Fellowship from the Robert S. Flinn
Biomedical Research Initiative.
Received November 9, 1998.
Revised February 1, 1999.
Accepted February 8, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  R. L. Goodman, M. N. Lehman, J. T. Smith, L. M. Coolen, C. V. R. de Oliveira, M. R. Jafarzadehshirazi, A. Pereira, J. Iqbal, A. Caraty, P. Ciofi, et al. Kisspeptin Neurons in the Arcuate Nucleus of the Ewe Express Both Dynorphin A and Neurokinin B Endocrinology, December 1, 2007; 148(12): 5752 - 5760. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Rometo, S. J. Krajewski, M. Lou Voytko, and N. E. Rance Hypertrophy and Increased Kisspeptin Gene Expression in the Hypothalamic Infundibular Nucleus of Postmenopausal Women and Ovariectomized Monkeys J. Clin. Endocrinol. Metab., July 1, 2007; 92(7): 2744 - 2750. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Escobar, S. J. Krajewski, T. Sandoval-Guzman, M. L. Voytko, and N. E. Rance Neuropeptide Y Gene Expression Is Increased in the Hypothalamus of Older Women J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2338 - 2343. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Hestiantoro and D. F. Swaab Changes in Estrogen Receptor-{alpha} and -{beta} in the Infundibular Nucleus of the Human Hypothalamus Are Related to the Occurrence of Alzheimer's Disease Neuropathology J. Clin. Endocrinol. Metab., April 1, 2004; 89(4): 1912 - 1925. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. L. Dellovade and I. Merchenthaler Estrogen Regulation of Neurokinin B Gene Expression in the Mouse Arcuate Nucleus Is Mediated by Estrogen Receptor {alpha} Endocrinology, February 1, 2004; 145(2): 736 - 742. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Krajewski, T. W. Abel, M. L. Voytko, and N. E. Rance Ovarian Steroids Differentially Modulate the Gene Expression of Gonadotropin-Releasing Hormone Neuronal Subtypes in the Ovariectomized Cynomolgus Monkey J. Clin. Endocrinol. Metab., February 1, 2003; 88(2): 655 - 662. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. L. Bellino and P. M. Wise Nonhuman Primate Models of Menopause Workshop Biol Reprod, January 1, 2003; 68(1): 10 - 18. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Gill, J. L. Sharpless, K. Rado, and J. E. Hall Evidence That GnRH Decreases with Gonadal Steroid Feedback but Increases with Age in Postmenopausal Women J. Clin. Endocrinol. Metab., May 1, 2002; 87(5): 2290 - 2296. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. V. Mobbs, G. A. Bray, R. L. Atkinson, A. Bartke, C. E. Finch, E. Maratos-Flier, J. N. Crawley, and J. F. Nelson Neuroendocrine and Pharmacological Manipulations to Assess How Caloric Restriction Increases Life Span J. Gerontol. A Biol. Sci. Med. Sci., March 1, 2001; 56(90001): 34 - 44. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-L. Goubillon, R. A. Forsdike, J. E. Robinson, P. Ciofi, A. Caraty, and A. E. Herbison Identification of Neurokinin B-Expressing Neurons as an Highly Estrogen-Receptive, Sexually Dimorphic Cell Group in the Ovine Arcuate Nucleus Endocrinology, November 1, 2000; 141(11): 4218 - 4225. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
