help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nakamura, J.
Right arrow Articles by Brodie, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakamura, J.
Right arrow Articles by Brodie, A.
The Journal of Clinical Endocrinology & Metabolism Vol. 84, No. 4 1432-1437
Copyright © 1999 by The Endocrine Society


Original Studies

The Effect of Estrogen on Aromatase and Vascular Endothelial Growth Factor Messenger Ribonucleic Acid in the Normal Nonhuman Primate Mammary Gland1

J. Nakamura2, Q. Lu, G. Aberdeen, E. Albrecht and A. Brodie

Departments of Pharmacology and Experimental Therapeutics and Obstetrics and Gynecology (G.A., E.A.), University of Maryland School of Medicine, Baltimore, Maryland 21201

Address all correspondence and requests for reprints to: Dr. A. Brodie, Department of Pharmacology and Experimental Therapeutics, University of Maryland School of Medicine, Baltimore, Maryland 21201.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, the baboon was used as a model to investigate the effects of steroid hormones on vascular endothelial growth factor (VEG/PF) and aromatase expression and on proliferation of the normal mammary gland. Immunocytochemistry revealed that both aromatase and VEG/PF were expressed in the epithelial cells of the terminal ductal lobular units. Mammary tissue biopsies were obtained from female baboons during the follicular and luteal phases of the menstrual cycle, 4 weeks after ovariectomy (OVX), and after 2 weeks of treatment with estradiol benzoate (E2B; 500 µg/day, im). Although there was little apparent difference in aromatase messenger ribonucleic acid (mRNA) in tissue from follicular and luteal phases or after ovariectomy, aromatase mRNA was decreased in tissue from ovariectomized (OVX) animals treated for 2 weeks with E2B. Furthermore, aromatase activity in tissue from these animals was markedly reduced compared to activity in tissue from the OVX animals before treatment (P < 0.001). In one animal in which mammary aromatase activity was measured sequentially during the follicular and luteal phases, aromatase activity was increased significantly after OVX and was reduced to the level in the intact animal by subsequent treatment with E2B. This effect on both aromatase activity and mRNA occurred rapidly 2 and 4 h after injection with E2B. In contrast to its effect on aromatase, E2B treatment of OVX animals stimulated VEG/PF mRNA 2 and 4 h after injection. In histoculture of mammary biopsies from these animals in the follicular and luteal phases of the menstrual cycle or after OVX, [3H]thymidine incorporation was increased significantly by incubation with testosterone (T) as well as estrogen (P < 0.01). The effect of T was blocked by aromatase inhibitor, 4-hydroxyandrostenedione, suggesting that the tissue is responsive to E produced by aromatization of T in the tissue. When mammary tissue from OVX animals was cultured with T, there was a significantly greater increase in [3H]thymidine incorporation than in histocultures of tissue from intact animals (P < 0.01). However, in histocultures of tissue from the OVX animals treated with E2B (500 µg) for 2 weeks, [3H]thymidine incorporation was similar to the level in tissue of intact animals incubated with T. No significant changes occurred in [3H]thymidine incorporation with the nonaromatizable androgen dihydrotestosterone or progesterone alone. These findings suggest that estrogens produced locally by aromatization of T have a functional role in mammary tissue. Aromatase expressed in the mammary gland could be important in maintaining local estrogen concentrations, particularly after menopause. Estrogen appears to regulate transcription of both aromatase and VEG/PF in the mammary gland, suggesting a regulatory loop by which local estrogens could stimulate VEG/PF production. Thus, paracrine/autocrine mechanisms that can enhance the proliferation of malignant cells and their metastatic spread already exist before transformation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ESTROGEN has a number of significant effects on the normal breast and in breast cancer (1, 2). These include enhancing proliferation and increasing production of several growth factors (3). Proliferative activity in the normal breast is regulated by ovarian hormones. Recent studies in our laboratory identified expression of aromatase in the epithelial cells and the surrounding stroma of tumors from breast cancer patients and showed that local production of estrogen via aromatization may have functional significance in stimulating tumor proliferation (4). Vascular endothelial growth factor (VEG/PF) is an important growth factor known to stimulate angiogenesis and permeability, processes involved in tissue remodeling, and to enable tumors to proliferate and metastasize to other sites. We observed that messenger ribonucleic acid (mRNA) of VEG/PF is expressed in carcinogen (DMBA)-induced rat mammary tumors, and that estrogens stimulate both mRNA and production of VEG/PF (5). Although VEG/PF (6, 7) and estrogen are recognized as having important angiogenic and growth-promoting effects on mammary tumors, it is not known whether they are produced in the normal mammary gland and have significant local actions in its function via autocrine/paracrine actions.

Steroids are important in the growth and differentiation of the mammary gland (8) and the hormonal environment is integrally related to risk factors associated with the development of breast cancer (9). For example, the incidence of cancer is low in women who have had ovariectomies. Therefore, the effects of steroids on the growth of the mammary gland and whether they are produced in the normal tissue or are a consequence of transformation to the malignant state require investigation. In this study we have determined the effects of steroids on aromatase activity, the mRNA for P-450 aromatase and VEG/PF, and proliferation by measuring the incorporation of [3H]thymidine into DNA in the normal mammary gland.

As the reproductive system of the baboon is similar to that of the human, we used baboon mammary tissue as a model for the normal human breast for these studies (10). The length of the cycle, the pattern of serum estrogen, progesterone (P), and gonadotropin concentrations during the baboon menstrual cycle, and the morphology of the mammary gland are similar to those in humans (11).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Aromatase substrate [1ß-3H]-androstenedione (27.5 Ci/mmol) and [3H]thymidine were purchased from New England Nuclear (Boston, MA). The oligonucleotide primers were synthesized in the Biopolymer Laboratory, Department of Microbiology and Immunology, using an PE Applied Biosystems (Foster City, CA) model 380B DNA synthesizer. Eagle’s MEM and heat-inactivated FBS were purchased from JRH Sciences (Lenexa, KS). Trypsin-ethylenediamine tetraacetate (0.05% for trypsin and 0.53 mmol/L for ethylenediamine tetraacetate) and MEM nonessential amino acids solution (100-fold concentrated) were purchased from Life Technologies (Gaithersburg, MD). All other chemicals were purchased from Sigma Chemical Co. (St. Louis, MO). The hydrated gelatin sponges used for histoculture were obtained from Upjohn (Kalamazoo, MI). Flasks and plates for cell culture (Nunc, Naperville, IL) were purchased from Thomas Scientific (Swedesboro, NJ). 4-Hydroxyandrostenedione (4-OHA) was synthesized in our laboratory as described previously (12).

Animals

Female baboons (Papio anubis), weighing 13–18 kg, were housed individually in stainless steel squeeze cages in air-conditioned rooms with a 12-h lighting schedule as previously described (10, 11). The animals received high protein pellets (Ralston Purina Co., St. Louis, MO) twice daily, fresh fruit daily, and water ad libitum. All animals exhibited regular menstrual cycles, as determined by the pattern of perineal turgescence and menstrual cycle history. The animals were sedated with 100 mg ketamine hydrochloride (Ketalar, Parke-Davis, Detroit, MI), then anesthetized with halothane-nitrous oxide. Baboon mammary tissue biopsies (~1 cm2) were obtained by surgical excision from different areas of the two glands and collected sequentially during the follicular and luteal phases of the menstrual cycle, 4 weeks after ovariectomy (OVX) and after 2 weeks of treatment with estradiol benzoate (E2B; 500 µg/day, im; OVX+E2). There was a minimal resting interval of 30 days between each tissue biopsy. Mammary tissue was also obtained from a baboon 2 weeks after OVX and again 2 and 4 h after injection of E2B (500 µg, iv). All procedures were approved by the institutional animal care and use committee and were in accordance with the NIH Guide for the Care and Use of Laboratory Animals.

Immunocytochemistry

Five-micrometer thick paraffin sections were processed in a microwave oven for three periods of 5 min each as described previously (4). The sections were covered with antiaromatase mouse monoclonal (8 µg/mg) prepared against human placental P-450 aromatase (provided by Dr. E. Simpson, University of Texas Southwestern Medical Center, Dallas, TX) (13) or anti-VEG/PF rabbit polyclonal antibody (Santa Cruz Biotechnologies, Inc., Santa Cruz, CA) in a 1:500 dilution (5). The samples were incubated overnight in a humid chamber at 4 C. After further washing in 0.05 mol/L Tris-HCl buffer, the slides were incubated for 30 min with biotinylated secondary IgG (Dako Corp., Carpinteria, CA) at room temperature. Sections were washed again and incubated with streptavidin peroxidase (Dako Corp.) for 30 min at room temperature. After three washes, the sections were incubated with 3-amino-9-ethylcarbazole-0.016% hydrogen peroxide in buffer for 9 min, washed again, then counterstained with Mayer’s hematoxylin and coverslipped. Control sections were incubated with 0.01 mol/L PBS and normal mouse IgG instead of primary antibodies.

Aromatase activity

Frozen sections (n = 40–50) of each tissue sample were cut 10 µm thick and pooled into a chilled vial for measurement of aromatase activity as described previously (4). The cryosections were either assayed immediately or stored at -70 C for not more than 2 days before assay. The pooled cryosections were vortexed in 0.6 mL 0.1 mol/L phosphate buffer, then 0.5 mL was removed and mixed with 1 µCi [1ß-3H]androstenedione (24.56 Ci/mmol) and incubated with 0.1 mL of a NADPH-generating system (5 mg NADPH, 20 mg glucose-6-phosphate, and 25 IU glucose-6-phosphate dehydrogenase in 0.9 mL phosphate buffer) for 2 h at 37 C. Omission of the cofactor from the incubate was used as a negative control. Incubations were terminated by placing the tube in an ice-water bath and adding 2 mL chloroform to extract the steroids. The aqueous phase was separated, treated with 2.5% charcoal suspension to eliminate residual steroids, and centrifuged. An aliquot was removed, and tritium released to form 3H2O during aromatization of [1ß-3H]androstenedione to estrogens was measured in a liquid scintillation counter. Aromatase activity was expressed as femtomoles of estrogen produced per mg protein/h. The protein concentration of the homogenate was measured by the method of Lowry et al. (14).

Aromatase and VEG/PF mRNA by RT-PCR

Total RNA was extracted using the method of Chomczynski and Sacchi (15). Tissues were homogenized with a Polytron (Brinkmann Instruments, Westbury, NY) in ice-cold solution D [4 mol/L guanidine thiocyanate, 25 mmol/L sodium citrate (pH 7), 0.5% sodium sarcosyl, 0.1 mol/L 2-mercaptoethanol, and 1 mL/100 mg tissue]. To each sample, the following reagents were added sequentially: 1) 0.1 vol 2 mol/L sodium acetate (pH 4), 2) 1 vol phenol (water saturated), and 3) 0.2 vol chloroform-isoamyl alcohol (49:1). The samples were vortexed after each addition, then cooled on ice for 15 min, and centrifuged at 10,000 x g for 20 min at 4 C. RNA was precipitated from the aqueous phase by adding isopropanol (1:1) and incubating at -20 C for 1 h. After centrifugation (10,000 x g for 20 min at 4 C), the RNA pellet was dissolved in 0.3 mL solution D (RNA extraction buffer) and then precipitated a second time with isopropanol. After centrifugation, the RNA pellet was washed with 75% ethanol, dried, and dissolved in water. The concentration of RNA was determined by absorbance at 260 nm.

PCR was carried out according to the GeneAmp RNA PCR kit (Perkin-Elmer, Branchberg, NJ) and as used previously (4). The primers for aromatase bracketed bases 1215–1507 (293-bp PCR product) of the human sequence (4). The primer sequences were 5'-1215GAATATTGGAAGGATGCACAGACT1228-3' and 5'-1507GGGTAAAGATCATTTCCAGCATGT1484-3'. The 5'-VEG/PF primer (5'-68GCTCTCTTGGGTGCACTGGA85-3') and the 3'-VEG/PF primer (5'-576CACCGCCTTG-GCTTGTCACA627-3') were the same as those for the rat VEG/PF sequence (5). Primers for cytoplasmic ß-actin have been described previously (16). To determine the relative concentrations of target mRNA in tissue from animals under different conditions, such as during the menstrual cycle and after ovariectomy, we used a semiquantitative method previously described (5, 16). Equal aliquots of the RT products for the samples to be compared were serially diluted and then amplified for a fixed number of cycles. In the exponential range of amplification, the amount of PCR product derived from a given amount of total RNA in a sample is directly proportional to the concentration of target mRNA in the sample (17). A steady decline observed in product yield at each dilution step confirmed that the reaction had not entered the plateau phase and, therefore, that the comparison of the two samples was made in the exponential portion of the amplification curve. A sample of the PCR mixture (5 µL) was fractionated by electrophoresis in a constant 100-volt field in 0.75-mm thick, nondenaturing, 8% polyacrylamide gels. Gels were stained for 5 min in ethidium bromide (0.5 µg/mL) and photographed on a 312-nm UV transilluminator. The results were expressed as the X-fold difference in the concentration of input RNA at which product was undetectable in samples from the groups being compared (5, 16).

Histoculture of breast tissue and [3H]thymidine incorporation assay

Histocultures were performed as described previously (4, 18, 19, 20). Fresh tissue was washed with HBSS buffer and divided into 1- to 2-mm cubes. Four to five pieces were placed on the top of each hydrated gelatin sponge and incubated in a 24-well microplate in 1 mL Eagle’s MEM/well without phenol red with 5% charcoal-dextran-treated calf serum alone and containing 1) vehicle, 2) estradiol (E; 100 pmol/L), 3) P (10 nmol/L), 4) E plus P, 5) testosterone (T; 10 nmol/L), 6) dihydrotestosterone (DHT; 10 nmol/L), 7) an aromatase inhibitor (4-OHA; 1 µmol/L), and 8) T and 4-OHA. Cultures were maintained at 37 C in an incubator with 5% CO2. After 7 days, the tissue blocks were transferred to new sponges and incubated with [3H]thymidine labeling medium (23 Ci/mL·well) for 3 days as previously. The tissue blocks were then transferred to a 1.5-mL microtube, and 0.5 mL collagenase solution (0.1 mg/mL in 10 mmol/L Tris-EDTA buffer) was added to each and incubated at 37 C overnight. The collagenase solution was discarded, and 0.1 mL proteinase K solution (0.05 mg/mL of 10 mmol/L TE-0.5% SDS) was added to the tube and incubated at 37 C for 2 h. Then, DNA was extracted and dissolved in 0.05 mL TE (pH 7.8). The amount of DNA was quantitated by spectrophotometry (optical density, 260 nm), and the radioactivity of [3H]thymidine incorporated into newly synthesized DNA was measured in a liquid scintillation counter.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Aromatase expression detected by immunocytochemistry was observed mainly in the terminal ductal lobular units (TDLU) of the mammary gland and in the surrounding stroma to some extent (Fig. 1AGo). VEG/PF also appeared to be expressed in the epithelial cells of the TDLU as aromatase in addition to endothelial cells of blood vessels (Fig. 1BGo).



View larger version (137K):
[in this window]
[in a new window]
 
Figure 1. Aromatase and VEG/PF expression in the normal mammary gland of an adult female baboon. A, Aromatase was detected by immunocytochemistry with antihuman aromatase antibody in fixed paraffin-embedded sections. B, VEG/PF was detected by immunocytochemistry with antihuman VEG/PF antibody in fixed paraffin-embedded sections.

 
Aromatase activity was measured in tissue biopsies collected sequentially from baboon 1 during the cycle, after OVX, and after treatment with E2B for 2 and 4 h (Fig. 2Go). Aromatase activity was 220 ± 13.2 fmol/mg·h during the follicular phase and 208.7 ± 12.7 fmol/mg·h during the luteal phase. After ovariectomy, aromatase activity increased to 299.3 ± 8.6 fmol/mg·h (P < 0.05), but was significantly reduced in tissue 2 h (76.5 ± 4.5 fmol/mg·h) and 4 h (41.0 ± 1.9 fmol/mg·h) after E2B injection (Fig. 2Go). Aromatase mRNA was also studied in tissue from two other baboons (no. 2 and 3) during the follicular and luteal phases. There appeared to be no marked difference in the level of aromatase mRNA between samples removed during the follicular and luteal phases, whereas a slight increase could be discerned in the mRNA level after OVX (Fig. 3Go). However, when the OVX animals were injected with E2B, aromatase mRNA levels appeared to be reduced. Aromatase activity in these animals was also greatly reduced by E2B treatment from 407.7 and 284 fmol E/mg protein·h to 29.9 and 38.3 fmol E/mg protein·h, respectively, only 10% of the activity of tissue from ovariectomized (OVX) animals before treatment. This result was confirmed in tissue from additional baboons. Aromatase mRNA in samples from baboon 1 after ovariectomy was quantitated using the dilution method previously described (5, 16). Using a semiquantitative method involving sample dilution, there was a 2-fold reduction in aromatase mRNA in tissue removed 2 and 4 h after the injection of E2B compared with tissue from the ovariectomized animal before treatment (Fig. 4Go).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 2. Aromatase activity during the cycle and after ovariectomy in mammary tissue of a baboon. Tissue biopsies were taken sequentially from baboon 1 for measurement of aromatase activity during the follicular and luteal phases and after ovariectomy. Two weeks later, the animal was injected with E2B, and mammary tissue was removed after 2 and 4 h.

 


View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. Aromatase mRNA in the baboon mammary gland. Aromatase mRNA was measured in tissue removed from two baboons during the luteal and follicular phases of the menstrual cycle, after ovariectomy, and 2 weeks after E2B treatment. Baboon 2, lanes 1–4: 1) follicular phase; 2) luteal phase; 3) OVX; 4) OVX and E2B. Baboon 3, lanes 5–8: 5) follicular phase; 6) luteal phase; 7) OVX; 8) OVX and E2B.

 


View larger version (30K):
[in this window]
[in a new window]
 
Figure 4. The effect of estrogen treatment on aromatase mRNA in mammary tissue of an OVX baboon. A, Aromatase mRNA in tissue of the same baboon shown in Fig. 2Go. Lane 1, Two weeks after OVX; lane 2, 2 h after E2B injection; lane 3, 4 h after E2B injection. ß-Actin mRNA, lane 4, 2 weeks after OVX; lane 5, 2 h after E2B; lane 6, 4 h after E2B. B, Semiquantitative determination was made by serial dilution (1:1, 1:3) of the RNA samples, then amplified by PCR for a fixed number of cycles.

 
In histocultures, incorporation of [3H]thymidine into DNA was increased during incubation with E2 compared with that during incubation with vehicle only in mammary tissue biopsied sequentially from baboons 2 and 3 during the cycle, after ovariectomy, and after OVX and E2B treatment (Fig. 5AGo). Testosterone also stimulated incorporation of [3H]thymidine in these histocultures, although to a lesser extent than E. The stimulation due to T was blocked by the aromatase inhibitor 4-OHA, suggesting that E2 produced locally via androgen aromatization contributes to enhancing proliferation of the normal baboon mammary gland. When tissue from OVX animals was incubated with T, there was a significantly greater increase in [3H]thymidine incorporation than in the tissue from the two animals biopsied during the follicular and luteal phases. However, when tissue from OVX animals treated with E2B (500 µg, sc) for 2 weeks was incubated with T, [3H]thymidine incorporation into new DNA was significantly less than that in the tissue of OVX animals (P < 0.001) and was comparable to the levels during the luteal phase (Fig. 5AGo). The nonaromatizable androgen, DHT, had no effect on [3H]thymidine incorporation, nor had the aromatase inhibitor alone. P was similarly ineffective in histocultures with tissue biopsied during the cycle and after OVX, although P reduced the response to E when tissue was cultured with both steroids (compare Fig. 5Go, A and B).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 5. The effects of steroids on proliferation of baboon mammary tissue in histoculture. A, Mammary tissue was removed from baboons 2 and 3 during the follicular and luteal phases of the menstrual cycle, after OVX, and after 2 weeks of treatment with E2B. Four or five pieces of tissue (1–2 mm) were incubated on a gelatin sponge as described in Materials and Methods for 7 days with medium containing E (100 pmol/L), T (10 nmol/L), DHT (10 nmol/L), and an aromatase inhibitor, 4-OHA (1 µmol/L). The tissue blocks were then transferred to fresh medium containing [3H]thymidine. After 3 days, [3H]thymidine incorporated into DNA was measured. B, Tissue pieces were incubated on a gelatin sponge in medium containing P (10 nmol/L) or P (10 nmol/L) plus E (100 pmol/L) for 7 days. The tissue blocks were then incubated with [3H]thymidine for 3 days, and the amount of radioactivity was measured (**, P < 0.01 vs. control). [3H]Thymidine was significantly increased by T in tissue from OVX animals compared to that from intact and OVX animals treated with E2B (**, P < 0.01).

 
Quantitation of VEG/PF mRNA was also carried out on mammary tissue obtained sequentially from three baboons and was found to be higher during the luteal phase than during the follicular phase. In contrast to aromatase, VEG/PF mRNA levels were decreased after OVX compared to levels in the intact animals. After an E2B injection, VEG/PF mRNA increased rapidly in 2 and 4 h, to the level observed during the luteal phase and was maintained at this level after 14 days of continuous treatment (Fig. 6Go).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 6. Quantitative RT-PCR determination of VEG/PF mRNA in baboon mammary tissue. Semiquantitative determination was made by serial dilution (1:32, 1:64, 1:128, 1:256, 1:512) of the VEG/PF mRNA samples, then amplified by PCR for a fixed number of cycles. Tissue biopsies were taken from three baboons during the follicular and luteal phases of the menstrual cycle, after OVX, and after treatment with E2B for 2 h, 4 h, or 14 days.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Our immunocytochemical studies in the human (4, 21) and in this study indicate that in the normal breast, aromatase is expressed in the epithelial cells of the TDLU and to a lesser extent in surrounding stromal cells. Not all studies of breast cancer tissue have confirmed positive immunocytochemical staining for aromatase in tumor epithelial cells and have found staining of stromal cells (22). Although these differences are not yet explained, they might be related to differences in antibodies or techniques. Our own studies have identified aromatase mainly in epithelial cells (4). In the normal human mammary gland, we have confirmed the immunocytochemical results by in situ hybridization (21) and in isolated cells (23). Epithelial cells are the cells that are transformed in breast cancer. We and others have reported that both epithelial and stromal cells are immunostained in breast cancer. In the normal breast, ductal epithelial cells appear to express aromatase, whereas stromal cells are less abundant within the area of the TDLU. Expression of aromatase in the TDLU suggests that local production can also be a source of estrogens acting on this tissue. Aromatase activity in mammary tissue was significantly increased after OVX compared to the levels during the follicular and luteal phases (P < 0.05). However, treatment with E2B caused a rapid decrease in activity 2 and 4 h after injection. Although there appeared to be little modulation of aromatase mRNA in breast tissue biopsies during the follicular and luteal phases of the cycle, a slight increase was observed after OVX. Treatment of the OVX animals with E2B for 2 weeks caused a marked decrease in aromatase mRNA, and on further study the reduction was evident within 2 h after E2B injection. Although further investigation is required, the rapid response to E2B suggests the possibility of a direct effect of estrogen on the cells of the mammary gland rather than via feedback regulation (8). However, we have previously reported that E, estrone, and estriol do not inhibit aromatase in human placental microsomes (24). In addition, we recently showed that E does not inhibit aromatase activity in human breast fibroblasts in cell culture (25).

The results of the histocultures were consistent with the above findings. We used [3H]thymidine incorporation into DNA as a measure of proliferation in response to hormones. As indicated in Fig. 5Go, mammary tissue in histoculture was responsive to both E and T. The proliferative effect of T was inhibited by coincubation with the aromatase inhibitor, 4-OHA, suggesting that T is aromatized to E in the tissue. This was confirmed by no increase in proliferation in response to the nonaromatizable androgen, DHT. P also had little effect on [3H]thymidine incorporation either alone or in the presence of E. When mammary tissues from OVX animals were cultured with T, proliferation was significantly increased compared to that in tissues from intact animals (P < 0.01). This finding is consistent with our observation that aromatase activity is increased after OVX. However, when tissue from OVX baboons treated with E2B was incubated with T in histoculture, [3H]thymidine incorporation was reduced to the level in the intact animal during the luteal phase.

Our results suggest that estrogens produced locally via androgen aromatization contribute to stimulating proliferation in the normal baboon mammary gland. Thus, the role of aromatase in the breast may be to maintain local estrogen levels through modulations in enzyme expression and activity during cyclic fluctuations in circulating ovarian hormone concentrations. Estrogen concentrations in breast tissue from postmenopausal women have been reported to be higher than those in the circulation (25, 26). The present findings suggest that after menopause, when circulating estrogen levels are low, aromatase expression in the breast may be increased. Thus, aromatase in breast tissue may play an important role in sustaining the local concentration of estrogen. The presence of locally high concentrations of estrogens would provide an environment that would enhance the proliferation of any malignant cells that may be present in the breast.

Estrogens have been shown to regulate the expression of a number of growth factors, such as insulin-like growth factors I and II, in the uterus and in mammary tumors (27). We have reported that VEG/PF mRNA and protein were increased in response to estrogen in rat mammary tumors after OVX (5). This is the first report of expression of VEG/PF in the normal primate mammary gland. Both VEG/PF and aromatase appear to be expressed in the epithelial cells of the TDLU. Furthermore, VEG/PF mRNA appears to be markedly stimulated by estrogen. Thus, when baboons were ovariectomized, VEG/PF mRNA levels were decreased compared to levels during the follicular and luteal phases. In contrast to aromatase, treatment of OVX baboons with E2B rapidly increased VEG/PF to the level in intact animals. These results extend observations that VEG/PF is regulated by estrogen in reproductive tissues such as the uterus (16) and our findings in the mammary tumors of the rat (5). We have also found that VEG/PF is stimulated by E in MCF-7 human breast cancer cells (28). The effect of estrogens on VEG/PF mRNA in the baboon mammary gland was rapid, was evident 2 and 4 h after the injection of E2B, and was sustained when E2B treatment was continued for 14 days. Although the role of VEG/PF in the normal gland is unclear, it is reasonable to speculate that the permeability properties of this growth factor, possibly relating to milk production, could be actions requiring its rapid induction. In addition, VEG/PF may have effects on new blood vessel formation during tissue remodeling during cyclic changes and pregnancy. However, it is evident that this growth factor is expressed by the normal mammary epithelial cells. Once transformed, breast epithelial cells can use estrogen not only to increase their proliferation, but also to enhance VEG/PF production to stimulate angiogenesis.

In conclusion, our findings show that aromatase and VEG/PF are expressed in the TDLU of the mammary gland of the nonhuman primate and suggest that both may have a role in the normal gland. Furthermore, aromatase expression and VEG/PF mRNA are regulated by estrogen. We have recently identified aromatase and VEG/PF in the normal breast and in breast cancers of women (4, 23). In addition, we have demonstrated that VEG/PF is enhanced by estrogen in hormone-responsive human breast cancer cells (MCF-7) (28). After menopause, when circulating estrogen levels are low, an increase in aromatase levels in the breast may maintain tissue concentrations of estrogen. Thus, aromatase may control the local production of estrogen through an autocrine loop. During the process of transformation to malignancy, locally produced estrogen may stimulate the proliferation of tumor cells (5) and VEG/PF production. These effects are also likely to enhance tumor progression, development of angiogenesis, and, ultimately, metastasis of the cancer.


    Footnotes
 
1 This work was supported by NIH Grant CA-6495. Back

2 Present address: Research Institute of Life Science, Snow Brand Milk Products Co. Ltd., 519 Shimo-Ishibashi, Ishibashi-Machi, Shimotsuga-Gun, Tochigi 329–05, Japan. Back

Received August 12, 1998.

Revised December 4, 1998.

Revised January 12, 1999.

Accepted January 19, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Dickson RB, Lippman ME. 1987 Estrogen regulation of growth and polypeptide growth factor secretion in human breast carcinoma. Endocr Rev. 8:29–43.[Abstract/Free Full Text]
  2. Imagawa W, Bandyopadhyay GK, Nandi S. 1990 Regulation of mammary epithelial cell growth in mice and rats. Endocr Rev. 11:494–523.[Abstract/Free Full Text]
  3. Dembinski TC, Shiu RPC. 1987 Growth factors in mammary gland development and function. In: Neville MC, Daniel CW, eds. The mammary gland: development, regulation, and function. New York: Academic Press; 355–381.
  4. Lu Q, Nakamura J, Savinov A, Yue W, Weisz J, Dabbs DJ, Wolz G, Brodie A. 1996 Expression of aromatase protein and messenger RNA in tumor epithelial cells and evidence of functional significance of locally produced estrogen in human breast cancers. Endocrinology. 137:3061–3068.[Abstract]
  5. Nakamura J, Savinov A, Lu Q, Brodie A. 1996 Estrogen regulates vascular endothelial growth/permeability factor expression in DMBA induced rat mammary tumors. Endocrinology. 137:5598–5596.
  6. Brown LF, Berse B, Jackman RW, et al. 1995 Expression of vascular permeability factor (vascular endothelial growth factor) and its receptors in breast cancer. Hum Pathol. 26:86–91.[CrossRef][Medline]
  7. Yoshiji H, Gomez DE, Shibuya M, Thorgeirsson UP. 1996 Expression of vascular endothelial growth factor, its receptor, and other angiogenic factors in human breast cancer. Cancer Res. 56:2013–2016.[Abstract/Free Full Text]
  8. Silberstein GB, van Horn K, Shyamala G, Daniel CW. 1994 Essential role of endogenous estrogen in directly stimulating mammary growth demonstrated by implants containing pure antiestrogens. Endocrinology. 134:84–90.[Abstract/Free Full Text]
  9. Henderson BE, Ross RK, Pike MC, Casagrande JT. 1982 Endogenous hormones as a major factor in human cancer. Cancer Res. 42:3232–3239.[Abstract/Free Full Text]
  10. Brodie AMH, Hammond JO, Ghosh M, Albrecht E. 1989 The effect of aromatase inhibitor 4-OHA in the primate menstrual cycle. Cancer Res. 49:4780–4784.[Abstract/Free Full Text]
  11. Albrecht ED, Haskins AL, Hodgen GD, Pepe GJ. 1981 Luteal function in baboons with administration of the antiestrogen ethamoxytriphetol (MER-25) throughout the luteal phase of the menstrual cycle. Biol Reprod. 25:451–457.[Abstract]
  12. Brodie AMH, Schwarzel WC, Shaikh AA, Brodie HJ. 1977 The effect of an aromatase inhibitor, 4-hydroxy-4-androstene-3,17-dione, on estrogen dependent processes in reproduction and breast cancer. Endocrinology. 100:1684–1694.[Abstract/Free Full Text]
  13. Mendelson CR, Wright EE, Porter JC, Evans CT, Simpson ER. 1985 Preparation and characterization of polyclonal and monoclonal antibodies against human aromatase cytochrome P-450 (P-450 arom) and their use in its purification. Arch Biochem Biophys. 243:480–491.[CrossRef][Medline]
  14. Lowry OH, Rosebrough NJ, Ferr AL, Randall RJ. 1951 protein measurement with the Folin phenol reagent. J Biol Chem. 193:265–275.[Free Full Text]
  15. Chomczynski P, Sacchi N. 1987 Single-step method of RNA isolation by scid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 162:156–159.[Medline]
  16. Cullinan-Bove K, Koos R. 1993 Vascular endothelial growth factor/vascular permeability factor expression in the rat uterus: rapid stimulation by estrogen correlates with estrogen-induced increases in uterine capillary permeability and growth. Endocrinology. 133:829–837.[Abstract/Free Full Text]
  17. Murphy LD, Herzog CE, Rudick JB, Fojo AT, Bates SE. 1990 Use of the polymerase chain reaction in the quantitation of mdr-1 gene expression. Biochemistry. 29:10351–10356.[CrossRef][Medline]
  18. Nakamura J, Imai E, Yoshihama M, Sasano H, Kubota T. 1998 Histoculture drug response assay, a possible examination system for predicting the antitumor effect of aromatase inhibitors in patients with breast cancer. Anticancer Res. 18:125–128.[Medline]
  19. Hoffman RM. 1991 Three-dimensional histoculture: origins and applications in cancer research. Cancer Cells. 3:86–92.[Medline]
  20. Hoffman RM. 1992 Histoculture and the immunodeficient mouse come to the cancer clinic: rational approaches to individualizing cancer therapy and new drug evaluation. Int J Oncol. 1:467–474.
  21. Brodie A, Lu Q, Nakamura J. 1997 Aromatase in the normal breast and breast cancer. J Steroid Biochem Mol Biol. 61:281–286.[CrossRef][Medline]
  22. Sasano H, Nagura H, Harada N, Goukon Y, Kimura M. 1994 Immunolocalization of aromatase and other steroidogenic enzymes in human breast disorders. Hum Pathol. 25:530–535.[CrossRef][Medline]
  23. Schwarzel WC, Kruggel W, Brodie HJ. 1973 Studies on the mechanism of estrogen biosynthesis. VII. The development of inhibitors of the enzyme system in human placenta. Endocrinology. 92:866–880.[Abstract/Free Full Text]
  24. Long B, Tilghman S, Yue W, Thiantanawat A, Grigoryev D, Brodie A. 1998 The steroidal antiestrogen ICI 182,780 is an inhibitor of cellular aromatase activity. J Steroid Biochem Mol Biol. 67:293–304.[CrossRef][Medline]
  25. van Landeghem AAJ, Portman J, Nabauurs M. 1985 Endogenous concentration and subcellular distribution of estrogens in normal and malignant human breast tissue. Cancer Res. 45:2900–2906.[Abstract/Free Full Text]
  26. Thorsen T, Tangen M, Stoa KF. 1982 Concentrations of endogenous estradiol as related to estradiol receptor sites in breast tumor cytosol. Eur J Cancer Clin Oncol. 18:333–337.[CrossRef][Medline]
  27. Katzenellenbogen BS, Norman MJ. 1990 Multihormonal regulation of the progesterone receptor in MCF-7 human breast cancer cells: interrelationships among insulin/insulin-like growth factor-I, serum and oestrogen. Endocrinology. 126:891–898.[Abstract/Free Full Text]
  28. Long BJ, Lu Q, Brodie A. Expression and regulation of vascular endothelial growth factor (VEGF) in human breast cancer cells. Proc of the 88th Annual Meet of the Am Assoc for Cancer Res. 1997.



This article has been cited by other articles:


Home page
Cancer Res.Home page
G. Sabnis, A. Schayowitz, O. Goloubeva, L. Macedo, and A. Brodie
Trastuzumab Reverses Letrozole Resistance and Amplifies the Sensitivity of Breast Cancer Cells to Estrogen
Cancer Res., February 15, 2009; 69(4): 1416 - 1428.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Behrens, H. Y. Lin, J. J. Lee, M. G. Raso, W. K. Hong, I. I. Wistuba, and R. Lotan
Immunohistochemical Expression of Basic Fibroblast Growth Factor and Fibroblast Growth Factor Receptors 1 and 2 in the Pathogenesis of Lung Cancer
Clin. Cancer Res., October 1, 2008; 14(19): 6014 - 6022.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
S M Hyder
Sex-steroid regulation of vascular endothelial growth factor in breast cancer.
Endocr. Relat. Cancer, September 1, 2006; 13(3): 667 - 687.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W. R. Harrington, S. Sengupta, and B. S. Katzenellenbogen
Estrogen Regulation of the Glucuronidation Enzyme UGT2B15 in Estrogen Receptor-Positive Breast Cancer Cells
Endocrinology, August 1, 2006; 147(8): 3843 - 3850.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Dabrosin
Positive Correlation between Estradiol and Vascular Endothelial Growth Factor but not Fibroblast Growth Factor-2 in Normal Human Breast Tissue In vivo
Clin. Cancer Res., November 15, 2005; 11(22): 8036 - 8041.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
S. E. Bulun, Z. Lin, G. Imir, S. Amin, M. Demura, B. Yilmaz, R. Martin, H. Utsunomiya, S. Thung, B. Gurates, et al.
Regulation of Aromatase Expression in Estrogen-Responsive Breast and Uterine Disease: From Bench to Treatment
Pharmacol. Rev., September 1, 2005; 57(3): 359 - 383.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
W. Somboonporn and S. R. Davis
Testosterone Effects on the Breast: Implications for Testosterone Therapy for Women
Endocr. Rev., June 1, 2004; 25(3): 374 - 388.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. Dabrosin
Variability of Vascular Endothelial Growth Factor in Normal Human Breast Tissue in Vivo during the Menstrual Cycle
J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2695 - 2698.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Buteau-Lozano, M. Ancelin, B. Lardeux, J. Milanini, and M. Perrot-Applanat
Transcriptional Regulation of Vascular Endothelial Growth Factor by Estradiol and Tamoxifen in Breast Cancer Cells: A Complex Interplay between Estrogen Receptors {alpha} and {beta}
Cancer Res., September 1, 2002; 62(17): 4977 - 4984.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. K. Mukherjee, H. Dinh, G. Chaudhuri, and L. Nathan
Testosterone attenuates expression of vascular cell adhesion molecule-1 by conversion to estradiol by aromatase in endothelial cells: Implications in atherosclerosis
PNAS, March 19, 2002; 99(6): 4055 - 4060.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Estrogen: Consequences and Implications of Human Mutations in Synthesis and Action
J. Clin. Endocrinol. Metab., December 1, 1999; 84(12): 4677 - 4694.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. D. Mueller, J.-L. Vigne, A. Minchenko, D. I. Lebovic, D. C. Leitman, and R. N. Taylor
Regulation of vascular endothelial growth factor (VEGF) gene transcription by estrogen receptors alpha and beta
PNAS, September 26, 2000; 97(20): 10972 - 10977.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nakamura, J.
Right arrow Articles by Brodie, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakamura, J.
Right arrow Articles by Brodie, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals