| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Departments of Pharmacology and Experimental Therapeutics and Obstetrics and Gynecology (G.A., E.A.), University of Maryland School of Medicine, Baltimore, Maryland 21201
Address all correspondence and requests for reprints to: Dr. A. Brodie, Department of Pharmacology and Experimental Therapeutics, University of Maryland School of Medicine, Baltimore, Maryland 21201.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Steroids are important in the growth and differentiation of the mammary gland (8) and the hormonal environment is integrally related to risk factors associated with the development of breast cancer (9). For example, the incidence of cancer is low in women who have had ovariectomies. Therefore, the effects of steroids on the growth of the mammary gland and whether they are produced in the normal tissue or are a consequence of transformation to the malignant state require investigation. In this study we have determined the effects of steroids on aromatase activity, the mRNA for P-450 aromatase and VEG/PF, and proliferation by measuring the incorporation of [3H]thymidine into DNA in the normal mammary gland.
As the reproductive system of the baboon is similar to that of the human, we used baboon mammary tissue as a model for the normal human breast for these studies (10). The length of the cycle, the pattern of serum estrogen, progesterone (P), and gonadotropin concentrations during the baboon menstrual cycle, and the morphology of the mammary gland are similar to those in humans (11).
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Animals
Female baboons (Papio anubis), weighing 13–18 kg,
were housed individually in stainless steel squeeze cages in
air-conditioned rooms with a 12-h lighting schedule as previously
described (10, 11). The animals received high protein pellets
(Ralston Purina Co., St. Louis, MO) twice daily, fresh
fruit daily, and water ad libitum. All animals exhibited
regular menstrual cycles, as determined by the pattern of perineal
turgescence and menstrual cycle history. The animals were sedated with
100 mg ketamine hydrochloride (Ketalar, Parke-Davis,
Detroit, MI), then anesthetized with halothane-nitrous oxide. Baboon
mammary tissue biopsies (
1 cm2) were obtained by
surgical excision from different areas of the two glands and collected
sequentially during the follicular and luteal phases of the menstrual
cycle, 4 weeks after ovariectomy (OVX) and after 2 weeks of treatment
with estradiol benzoate (E2B; 500 µg/day, im;
OVX+E2). There was a minimal resting interval of 30 days
between each tissue biopsy. Mammary tissue was also obtained from a
baboon 2 weeks after OVX and again 2 and 4 h after injection of
E2B (500 µg, iv). All procedures were approved by the
institutional animal care and use committee and were in accordance with
the NIH Guide for the Care and Use of Laboratory Animals.
Immunocytochemistry
Five-micrometer thick paraffin sections were processed in a microwave oven for three periods of 5 min each as described previously (4). The sections were covered with antiaromatase mouse monoclonal (8 µg/mg) prepared against human placental P-450 aromatase (provided by Dr. E. Simpson, University of Texas Southwestern Medical Center, Dallas, TX) (13) or anti-VEG/PF rabbit polyclonal antibody (Santa Cruz Biotechnologies, Inc., Santa Cruz, CA) in a 1:500 dilution (5). The samples were incubated overnight in a humid chamber at 4 C. After further washing in 0.05 mol/L Tris-HCl buffer, the slides were incubated for 30 min with biotinylated secondary IgG (Dako Corp., Carpinteria, CA) at room temperature. Sections were washed again and incubated with streptavidin peroxidase (Dako Corp.) for 30 min at room temperature. After three washes, the sections were incubated with 3-amino-9-ethylcarbazole-0.016% hydrogen peroxide in buffer for 9 min, washed again, then counterstained with Mayer’s hematoxylin and coverslipped. Control sections were incubated with 0.01 mol/L PBS and normal mouse IgG instead of primary antibodies.
Aromatase activity
Frozen sections (n = 40–50) of each tissue sample were cut 10 µm thick and pooled into a chilled vial for measurement of aromatase activity as described previously (4). The cryosections were either assayed immediately or stored at -70 C for not more than 2 days before assay. The pooled cryosections were vortexed in 0.6 mL 0.1 mol/L phosphate buffer, then 0.5 mL was removed and mixed with 1 µCi [1ß-3H]androstenedione (24.56 Ci/mmol) and incubated with 0.1 mL of a NADPH-generating system (5 mg NADPH, 20 mg glucose-6-phosphate, and 25 IU glucose-6-phosphate dehydrogenase in 0.9 mL phosphate buffer) for 2 h at 37 C. Omission of the cofactor from the incubate was used as a negative control. Incubations were terminated by placing the tube in an ice-water bath and adding 2 mL chloroform to extract the steroids. The aqueous phase was separated, treated with 2.5% charcoal suspension to eliminate residual steroids, and centrifuged. An aliquot was removed, and tritium released to form 3H2O during aromatization of [1ß-3H]androstenedione to estrogens was measured in a liquid scintillation counter. Aromatase activity was expressed as femtomoles of estrogen produced per mg protein/h. The protein concentration of the homogenate was measured by the method of Lowry et al. (14).
Aromatase and VEG/PF mRNA by RT-PCR
Total RNA was extracted using the method of Chomczynski and Sacchi (15). Tissues were homogenized with a Polytron (Brinkmann Instruments, Westbury, NY) in ice-cold solution D [4 mol/L guanidine thiocyanate, 25 mmol/L sodium citrate (pH 7), 0.5% sodium sarcosyl, 0.1 mol/L 2-mercaptoethanol, and 1 mL/100 mg tissue]. To each sample, the following reagents were added sequentially: 1) 0.1 vol 2 mol/L sodium acetate (pH 4), 2) 1 vol phenol (water saturated), and 3) 0.2 vol chloroform-isoamyl alcohol (49:1). The samples were vortexed after each addition, then cooled on ice for 15 min, and centrifuged at 10,000 x g for 20 min at 4 C. RNA was precipitated from the aqueous phase by adding isopropanol (1:1) and incubating at -20 C for 1 h. After centrifugation (10,000 x g for 20 min at 4 C), the RNA pellet was dissolved in 0.3 mL solution D (RNA extraction buffer) and then precipitated a second time with isopropanol. After centrifugation, the RNA pellet was washed with 75% ethanol, dried, and dissolved in water. The concentration of RNA was determined by absorbance at 260 nm.
PCR was carried out according to the GeneAmp RNA PCR kit (Perkin-Elmer, Branchberg, NJ) and as used previously (4). The primers for aromatase bracketed bases 1215–1507 (293-bp PCR product) of the human sequence (4). The primer sequences were 5'-1215GAATATTGGAAGGATGCACAGACT1228-3' and 5'-1507GGGTAAAGATCATTTCCAGCATGT1484-3'. The 5'-VEG/PF primer (5'-68GCTCTCTTGGGTGCACTGGA85-3') and the 3'-VEG/PF primer (5'-576CACCGCCTTG-GCTTGTCACA627-3') were the same as those for the rat VEG/PF sequence (5). Primers for cytoplasmic ß-actin have been described previously (16). To determine the relative concentrations of target mRNA in tissue from animals under different conditions, such as during the menstrual cycle and after ovariectomy, we used a semiquantitative method previously described (5, 16). Equal aliquots of the RT products for the samples to be compared were serially diluted and then amplified for a fixed number of cycles. In the exponential range of amplification, the amount of PCR product derived from a given amount of total RNA in a sample is directly proportional to the concentration of target mRNA in the sample (17). A steady decline observed in product yield at each dilution step confirmed that the reaction had not entered the plateau phase and, therefore, that the comparison of the two samples was made in the exponential portion of the amplification curve. A sample of the PCR mixture (5 µL) was fractionated by electrophoresis in a constant 100-volt field in 0.75-mm thick, nondenaturing, 8% polyacrylamide gels. Gels were stained for 5 min in ethidium bromide (0.5 µg/mL) and photographed on a 312-nm UV transilluminator. The results were expressed as the X-fold difference in the concentration of input RNA at which product was undetectable in samples from the groups being compared (5, 16).
Histoculture of breast tissue and [3H]thymidine incorporation assay
Histocultures were performed as described previously (4, 18, 19, 20). Fresh tissue was washed with HBSS buffer and divided into 1- to 2-mm cubes. Four to five pieces were placed on the top of each hydrated gelatin sponge and incubated in a 24-well microplate in 1 mL Eagle’s MEM/well without phenol red with 5% charcoal-dextran-treated calf serum alone and containing 1) vehicle, 2) estradiol (E; 100 pmol/L), 3) P (10 nmol/L), 4) E plus P, 5) testosterone (T; 10 nmol/L), 6) dihydrotestosterone (DHT; 10 nmol/L), 7) an aromatase inhibitor (4-OHA; 1 µmol/L), and 8) T and 4-OHA. Cultures were maintained at 37 C in an incubator with 5% CO2. After 7 days, the tissue blocks were transferred to new sponges and incubated with [3H]thymidine labeling medium (23 Ci/mL·well) for 3 days as previously. The tissue blocks were then transferred to a 1.5-mL microtube, and 0.5 mL collagenase solution (0.1 mg/mL in 10 mmol/L Tris-EDTA buffer) was added to each and incubated at 37 C overnight. The collagenase solution was discarded, and 0.1 mL proteinase K solution (0.05 mg/mL of 10 mmol/L TE-0.5% SDS) was added to the tube and incubated at 37 C for 2 h. Then, DNA was extracted and dissolved in 0.05 mL TE (pH 7.8). The amount of DNA was quantitated by spectrophotometry (optical density, 260 nm), and the radioactivity of [3H]thymidine incorporated into newly synthesized DNA was measured in a liquid scintillation counter.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). VEG/PF also appeared to be
expressed in the epithelial cells of the TDLU as aromatase in addition
to endothelial cells of blood vessels (Fig. 1B).
|
). Aromatase activity was 220 ±
13.2 fmol/mg·h during the follicular phase and 208.7 ± 12.7
fmol/mg·h during the luteal phase. After ovariectomy, aromatase
activity increased to 299.3 ± 8.6 fmol/mg·h (P
< 0.05), but was significantly reduced in tissue 2 h (76.5
± 4.5 fmol/mg·h) and 4 h (41.0 ± 1.9 fmol/mg·h) after
E2B injection (Fig. 2). Aromatase mRNA was also studied in
tissue from two other baboons (no. 2 and 3) during the follicular and
luteal phases. There appeared to be no marked difference in the level
of aromatase mRNA between samples removed during the follicular and
luteal phases, whereas a slight increase could be discerned in the mRNA
level after OVX (Fig. 3). However, when
the OVX animals were injected with E2B, aromatase mRNA
levels appeared to be reduced. Aromatase activity in these animals was
also greatly reduced by E2B treatment from 407.7 and 284
fmol E/mg protein·h to 29.9 and 38.3 fmol E/mg protein·h,
respectively, only 10% of the activity of tissue from ovariectomized
(OVX) animals before treatment. This result was confirmed in tissue
from additional baboons. Aromatase mRNA in samples from baboon 1 after
ovariectomy was quantitated using the dilution method previously
described (5, 16). Using a semiquantitative method involving sample
dilution, there was a 2-fold reduction in aromatase mRNA in tissue
removed 2 and 4 h after the injection of E2B compared
with tissue from the ovariectomized animal before treatment (Fig. 4).
|
|
|
). Testosterone also stimulated
incorporation of [3H]thymidine in these histocultures,
although to a lesser extent than E. The stimulation due to T was
blocked by the aromatase inhibitor 4-OHA, suggesting that
E2 produced locally via androgen aromatization contributes
to enhancing proliferation of the normal baboon mammary gland. When
tissue from OVX animals was incubated with T, there was a significantly
greater increase in [3H]thymidine incorporation than in
the tissue from the two animals biopsied during the follicular and
luteal phases. However, when tissue from OVX animals treated with
E2B (500 µg, sc) for 2 weeks was incubated with T,
[3H]thymidine incorporation into new DNA was
significantly less than that in the tissue of OVX animals
(P < 0.001) and was comparable to the levels during
the luteal phase (Fig. 5A). The nonaromatizable androgen, DHT, had no
effect on [3H]thymidine incorporation, nor had the
aromatase inhibitor alone. P was similarly ineffective in histocultures
with tissue biopsied during the cycle and after OVX, although P reduced
the response to E when tissue was cultured with both steroids (compare
Fig. 5, A and B).
|
).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The results of the histocultures were consistent with the above
findings. We used [3H]thymidine incorporation into DNA as
a measure of proliferation in response to hormones. As indicated in
Fig. 5
, mammary tissue in histoculture was responsive to both E and T.
The proliferative effect of T was inhibited by coincubation with the
aromatase inhibitor, 4-OHA, suggesting that T is aromatized to E in the
tissue. This was confirmed by no increase in proliferation in response
to the nonaromatizable androgen, DHT. P also had little effect on
[3H]thymidine incorporation either alone or in the
presence of E. When mammary tissues from OVX animals were cultured with
T, proliferation was significantly increased compared to that in
tissues from intact animals (P < 0.01). This finding
is consistent with our observation that aromatase activity is increased
after OVX. However, when tissue from OVX baboons treated with
E2B was incubated with T in histoculture,
[3H]thymidine incorporation was reduced to the level in
the intact animal during the luteal phase.
Our results suggest that estrogens produced locally via androgen aromatization contribute to stimulating proliferation in the normal baboon mammary gland. Thus, the role of aromatase in the breast may be to maintain local estrogen levels through modulations in enzyme expression and activity during cyclic fluctuations in circulating ovarian hormone concentrations. Estrogen concentrations in breast tissue from postmenopausal women have been reported to be higher than those in the circulation (25, 26). The present findings suggest that after menopause, when circulating estrogen levels are low, aromatase expression in the breast may be increased. Thus, aromatase in breast tissue may play an important role in sustaining the local concentration of estrogen. The presence of locally high concentrations of estrogens would provide an environment that would enhance the proliferation of any malignant cells that may be present in the breast.
Estrogens have been shown to regulate the expression of a number of growth factors, such as insulin-like growth factors I and II, in the uterus and in mammary tumors (27). We have reported that VEG/PF mRNA and protein were increased in response to estrogen in rat mammary tumors after OVX (5). This is the first report of expression of VEG/PF in the normal primate mammary gland. Both VEG/PF and aromatase appear to be expressed in the epithelial cells of the TDLU. Furthermore, VEG/PF mRNA appears to be markedly stimulated by estrogen. Thus, when baboons were ovariectomized, VEG/PF mRNA levels were decreased compared to levels during the follicular and luteal phases. In contrast to aromatase, treatment of OVX baboons with E2B rapidly increased VEG/PF to the level in intact animals. These results extend observations that VEG/PF is regulated by estrogen in reproductive tissues such as the uterus (16) and our findings in the mammary tumors of the rat (5). We have also found that VEG/PF is stimulated by E in MCF-7 human breast cancer cells (28). The effect of estrogens on VEG/PF mRNA in the baboon mammary gland was rapid, was evident 2 and 4 h after the injection of E2B, and was sustained when E2B treatment was continued for 14 days. Although the role of VEG/PF in the normal gland is unclear, it is reasonable to speculate that the permeability properties of this growth factor, possibly relating to milk production, could be actions requiring its rapid induction. In addition, VEG/PF may have effects on new blood vessel formation during tissue remodeling during cyclic changes and pregnancy. However, it is evident that this growth factor is expressed by the normal mammary epithelial cells. Once transformed, breast epithelial cells can use estrogen not only to increase their proliferation, but also to enhance VEG/PF production to stimulate angiogenesis.
In conclusion, our findings show that aromatase and VEG/PF are expressed in the TDLU of the mammary gland of the nonhuman primate and suggest that both may have a role in the normal gland. Furthermore, aromatase expression and VEG/PF mRNA are regulated by estrogen. We have recently identified aromatase and VEG/PF in the normal breast and in breast cancers of women (4, 23). In addition, we have demonstrated that VEG/PF is enhanced by estrogen in hormone-responsive human breast cancer cells (MCF-7) (28). After menopause, when circulating estrogen levels are low, an increase in aromatase levels in the breast may maintain tissue concentrations of estrogen. Thus, aromatase may control the local production of estrogen through an autocrine loop. During the process of transformation to malignancy, locally produced estrogen may stimulate the proliferation of tumor cells (5) and VEG/PF production. These effects are also likely to enhance tumor progression, development of angiogenesis, and, ultimately, metastasis of the cancer.
|
Footnotes |
|---|
2 Present address: Research Institute of Life Science, Snow Brand
Milk Products Co. Ltd., 519 Shimo-Ishibashi, Ishibashi-Machi,
Shimotsuga-Gun, Tochigi 329–05, Japan.
Received August 12, 1998.
Revised December 4, 1998.
Revised January 12, 1999.
Accepted January 19, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  G. Sabnis, A. Schayowitz, O. Goloubeva, L. Macedo, and A. Brodie Trastuzumab Reverses Letrozole Resistance and Amplifies the Sensitivity of Breast Cancer Cells to Estrogen Cancer Res., February 15, 2009; 69(4): 1416 - 1428. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Behrens, H. Y. Lin, J. J. Lee, M. G. Raso, W. K. Hong, I. I. Wistuba, and R. Lotan Immunohistochemical Expression of Basic Fibroblast Growth Factor and Fibroblast Growth Factor Receptors 1 and 2 in the Pathogenesis of Lung Cancer Clin. Cancer Res., October 1, 2008; 14(19): 6014 - 6022. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S M Hyder Sex-steroid regulation of vascular endothelial growth factor in breast cancer. Endocr. Relat. Cancer, September 1, 2006; 13(3): 667 - 687. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. R. Harrington, S. Sengupta, and B. S. Katzenellenbogen Estrogen Regulation of the Glucuronidation Enzyme UGT2B15 in Estrogen Receptor-Positive Breast Cancer Cells Endocrinology, August 1, 2006; 147(8): 3843 - 3850. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Dabrosin Positive Correlation between Estradiol and Vascular Endothelial Growth Factor but not Fibroblast Growth Factor-2 in Normal Human Breast Tissue In vivo Clin. Cancer Res., November 15, 2005; 11(22): 8036 - 8041. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. E. Bulun, Z. Lin, G. Imir, S. Amin, M. Demura, B. Yilmaz, R. Martin, H. Utsunomiya, S. Thung, B. Gurates, et al. Regulation of Aromatase Expression in Estrogen-Responsive Breast and Uterine Disease: From Bench to Treatment Pharmacol. Rev., September 1, 2005; 57(3): 359 - 383. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Somboonporn and S. R. Davis Testosterone Effects on the Breast: Implications for Testosterone Therapy for Women Endocr. Rev., June 1, 2004; 25(3): 374 - 388. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Dabrosin Variability of Vascular Endothelial Growth Factor in Normal Human Breast Tissue in Vivo during the Menstrual Cycle J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2695 - 2698. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Buteau-Lozano, M. Ancelin, B. Lardeux, J. Milanini, and M. Perrot-Applanat Transcriptional Regulation of Vascular Endothelial Growth Factor by Estradiol and Tamoxifen in Breast Cancer Cells: A Complex Interplay between Estrogen Receptors {alpha} and {beta} Cancer Res., September 1, 2002; 62(17): 4977 - 4984. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. K. Mukherjee, H. Dinh, G. Chaudhuri, and L. Nathan Testosterone attenuates expression of vascular cell adhesion molecule-1 by conversion to estradiol by aromatase in endothelial cells: Implications in atherosclerosis PNAS, March 19, 2002; 99(6): 4055 - 4060. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Estrogen: Consequences and Implications of Human Mutations in Synthesis and Action J. Clin. Endocrinol. Metab., December 1, 1999; 84(12): 4677 - 4694. [Abstract] [Full Text]
|
|
|
|
|
|
M. D. Mueller, J.-L. Vigne, A. Minchenko, D. I. Lebovic, D. C. Leitman, and R. N. Taylor Regulation of vascular endothelial growth factor (VEGF) gene transcription by estrogen receptors alpha and beta PNAS, September 26, 2000; 97(20): 10972 - 10977. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
