The Journal of Clinical Endocrinology & Metabolism Vol. 84, No. 4 1432-1437
Copyright © 1999 by The Endocrine Society
The Effect of Estrogen on Aromatase and Vascular Endothelial Growth Factor Messenger Ribonucleic Acid in the Normal Nonhuman Primate Mammary Gland1
J. Nakamura2,
Q. Lu,
G. Aberdeen,
E. Albrecht and
A. Brodie
Departments of Pharmacology and Experimental Therapeutics and
Obstetrics and Gynecology (G.A., E.A.), University of Maryland School
of Medicine, Baltimore, Maryland 21201
Address all correspondence and requests for reprints to: Dr. A. Brodie, Department of Pharmacology and Experimental Therapeutics, University of Maryland School of Medicine, Baltimore, Maryland 21201.
 |
Abstract
|
|---|
In the present study, the baboon was used as a model to investigate the
effects of steroid hormones on vascular endothelial growth factor
(VEG/PF) and aromatase expression and on proliferation of the normal
mammary gland. Immunocytochemistry revealed that both aromatase and
VEG/PF were expressed in the epithelial cells of the terminal ductal
lobular units. Mammary tissue biopsies were obtained from female
baboons during the follicular and luteal phases of the menstrual cycle,
4 weeks after ovariectomy (OVX), and after 2 weeks of treatment with
estradiol benzoate (E2B; 500 µg/day, im). Although there
was little apparent difference in aromatase messenger ribonucleic acid
(mRNA) in tissue from follicular and luteal phases or after
ovariectomy, aromatase mRNA was decreased in tissue from ovariectomized
(OVX) animals treated for 2 weeks with E2B. Furthermore,
aromatase activity in tissue from these animals was markedly reduced
compared to activity in tissue from the OVX animals before treatment
(P < 0.001). In one animal in which mammary
aromatase activity was measured sequentially during the follicular and
luteal phases, aromatase activity was increased significantly after OVX
and was reduced to the level in the intact animal by subsequent
treatment with E2B. This effect on both aromatase activity
and mRNA occurred rapidly 2 and 4 h after injection with
E2B. In contrast to its effect on aromatase,
E2B treatment of OVX animals stimulated VEG/PF mRNA 2 and
4 h after injection. In histoculture of mammary biopsies from
these animals in the follicular and luteal phases of the menstrual
cycle or after OVX, [3H]thymidine incorporation was
increased significantly by incubation with testosterone (T) as well as
estrogen (P < 0.01). The effect of T was blocked
by aromatase inhibitor, 4-hydroxyandrostenedione, suggesting that the
tissue is responsive to E produced by aromatization of T in the tissue.
When mammary tissue from OVX animals was cultured with T, there was a
significantly greater increase in [3H]thymidine
incorporation than in histocultures of tissue from intact animals
(P < 0.01). However, in histocultures of tissue
from the OVX animals treated with E2B (500 µg) for 2
weeks, [3H]thymidine incorporation was similar to the
level in tissue of intact animals incubated with T. No significant
changes occurred in [3H]thymidine incorporation with the
nonaromatizable androgen dihydrotestosterone or progesterone alone.
These findings suggest that estrogens produced locally by aromatization
of T have a functional role in mammary tissue. Aromatase expressed in
the mammary gland could be important in maintaining local estrogen
concentrations, particularly after menopause. Estrogen appears to
regulate transcription of both aromatase and VEG/PF in the mammary
gland, suggesting a regulatory loop by which local estrogens could
stimulate VEG/PF production. Thus, paracrine/autocrine mechanisms that
can enhance the proliferation of malignant cells and their metastatic
spread already exist before transformation.
 |
Introduction
|
|---|
ESTROGEN has a number of significant
effects on the normal breast and in breast cancer (1, 2). These include
enhancing proliferation and increasing production of several growth
factors (3). Proliferative activity in the normal breast is regulated
by ovarian hormones. Recent studies in our laboratory identified
expression of aromatase in the epithelial cells and the surrounding
stroma of tumors from breast cancer patients and showed that local
production of estrogen via aromatization may have functional
significance in stimulating tumor proliferation (4). Vascular
endothelial growth factor (VEG/PF) is an important growth factor known
to stimulate angiogenesis and permeability, processes involved in
tissue remodeling, and to enable tumors to proliferate and metastasize
to other sites. We observed that messenger ribonucleic acid (mRNA) of
VEG/PF is expressed in carcinogen (DMBA)-induced rat mammary
tumors, and that estrogens stimulate both mRNA and production of VEG/PF
(5). Although VEG/PF (6, 7) and estrogen are recognized as having
important angiogenic and growth-promoting effects on mammary
tumors, it is not known whether they are produced in the normal mammary
gland and have significant local actions in its function via
autocrine/paracrine actions.
Steroids are important in the growth and differentiation of the mammary
gland (8) and the hormonal environment is integrally related to risk
factors associated with the development of breast cancer (9). For
example, the incidence of cancer is low in women who have had
ovariectomies. Therefore, the effects of steroids on the growth of the
mammary gland and whether they are produced in the normal tissue or are
a consequence of transformation to the malignant state require
investigation. In this study we have determined the effects of steroids
on aromatase activity, the mRNA for P-450 aromatase and VEG/PF, and
proliferation by measuring the incorporation of
[3H]thymidine into DNA in the normal mammary gland.
As the reproductive system of the baboon is similar to that of the
human, we used baboon mammary tissue as a model for the normal human
breast for these studies (10). The length of the cycle, the pattern of
serum estrogen, progesterone (P), and gonadotropin concentrations
during the baboon menstrual cycle, and the morphology of the mammary
gland are similar to those in humans (11).
 |
Materials and Methods
|
|---|
Aromatase substrate [1ß-3H]-androstenedione
(27.5 Ci/mmol) and [3H]thymidine were purchased from New
England Nuclear (Boston, MA). The oligonucleotide primers were
synthesized in the Biopolymer Laboratory, Department of Microbiology
and Immunology, using an PE Applied Biosystems (Foster
City, CA) model 380B DNA synthesizer. Eagles MEM and heat-inactivated
FBS were purchased from JRH Sciences (Lenexa, KS).
Trypsin-ethylenediamine tetraacetate (0.05% for trypsin and 0.53
mmol/L for ethylenediamine tetraacetate) and MEM nonessential amino
acids solution (100-fold concentrated) were purchased from
Life Technologies (Gaithersburg, MD). All other chemicals
were purchased from Sigma Chemical Co. (St. Louis, MO).
The hydrated gelatin sponges used for histoculture were obtained from
Upjohn (Kalamazoo, MI). Flasks and plates for cell culture (Nunc,
Naperville, IL) were purchased from Thomas Scientific
(Swedesboro, NJ). 4-Hydroxyandrostenedione (4-OHA) was synthesized in
our laboratory as described previously (12).
Animals
Female baboons (Papio anubis), weighing 1318 kg,
were housed individually in stainless steel squeeze cages in
air-conditioned rooms with a 12-h lighting schedule as previously
described (10, 11). The animals received high protein pellets
(Ralston Purina Co., St. Louis, MO) twice daily, fresh
fruit daily, and water ad libitum. All animals exhibited
regular menstrual cycles, as determined by the pattern of perineal
turgescence and menstrual cycle history. The animals were sedated with
100 mg ketamine hydrochloride (Ketalar, Parke-Davis,
Detroit, MI), then anesthetized with halothane-nitrous oxide. Baboon
mammary tissue biopsies (
1 cm2) were obtained by
surgical excision from different areas of the two glands and collected
sequentially during the follicular and luteal phases of the menstrual
cycle, 4 weeks after ovariectomy (OVX) and after 2 weeks of treatment
with estradiol benzoate (E2B; 500 µg/day, im;
OVX+E2). There was a minimal resting interval of 30 days
between each tissue biopsy. Mammary tissue was also obtained from a
baboon 2 weeks after OVX and again 2 and 4 h after injection of
E2B (500 µg, iv). All procedures were approved by the
institutional animal care and use committee and were in accordance with
the NIH Guide for the Care and Use of Laboratory Animals.
Immunocytochemistry
Five-micrometer thick paraffin sections were processed in a
microwave oven for three periods of 5 min each as described previously
(4). The sections were covered with antiaromatase mouse monoclonal (8
µg/mg) prepared against human placental P-450 aromatase (provided by
Dr. E. Simpson, University of Texas Southwestern Medical Center,
Dallas, TX) (13) or anti-VEG/PF rabbit polyclonal antibody (Santa Cruz Biotechnologies, Inc., Santa Cruz, CA) in a 1:500 dilution
(5). The samples were incubated overnight in a humid chamber at 4 C.
After further washing in 0.05 mol/L Tris-HCl buffer, the slides were
incubated for 30 min with biotinylated secondary IgG (Dako Corp., Carpinteria, CA) at room temperature. Sections were
washed again and incubated with streptavidin peroxidase (Dako Corp.) for 30 min at room temperature. After three washes, the
sections were incubated with 3-amino-9-ethylcarbazole-0.016% hydrogen
peroxide in buffer for 9 min, washed again, then counterstained with
Mayers hematoxylin and coverslipped. Control sections were incubated
with 0.01 mol/L PBS and normal mouse IgG instead of primary
antibodies.
Aromatase activity
Frozen sections (n = 4050) of each tissue sample were cut
10 µm thick and pooled into a chilled vial for measurement of
aromatase activity as described previously (4). The cryosections were
either assayed immediately or stored at -70 C for not more than 2 days
before assay. The pooled cryosections were vortexed in 0.6 mL 0.1 mol/L
phosphate buffer, then 0.5 mL was removed and mixed with 1 µCi
[1ß-3H]androstenedione (24.56 Ci/mmol) and incubated
with 0.1 mL of a NADPH-generating system (5 mg NADPH, 20 mg
glucose-6-phosphate, and 25 IU glucose-6-phosphate dehydrogenase in 0.9
mL phosphate buffer) for 2 h at 37 C. Omission of the cofactor
from the incubate was used as a negative control. Incubations were
terminated by placing the tube in an ice-water bath and adding 2 mL
chloroform to extract the steroids. The aqueous phase was separated,
treated with 2.5% charcoal suspension to eliminate residual steroids,
and centrifuged. An aliquot was removed, and tritium released to form
3H2O during aromatization of
[1ß-3H]androstenedione to estrogens was measured in a
liquid scintillation counter. Aromatase activity was expressed as
femtomoles of estrogen produced per mg protein/h. The protein
concentration of the homogenate was measured by the method of Lowry
et al. (14).
Aromatase and VEG/PF mRNA by RT-PCR
Total RNA was extracted using the method of Chomczynski and
Sacchi (15). Tissues were homogenized with a Polytron (Brinkmann
Instruments, Westbury, NY) in ice-cold solution D [4 mol/L guanidine
thiocyanate, 25 mmol/L sodium citrate (pH 7), 0.5% sodium sarcosyl,
0.1 mol/L 2-mercaptoethanol, and 1 mL/100 mg tissue]. To each sample,
the following reagents were added sequentially: 1) 0.1 vol 2 mol/L
sodium acetate (pH 4), 2) 1 vol phenol (water saturated), and 3) 0.2
vol chloroform-isoamyl alcohol (49:1). The samples were vortexed after
each addition, then cooled on ice for 15 min, and centrifuged at
10,000 x g for 20 min at 4 C. RNA was precipitated
from the aqueous phase by adding isopropanol (1:1) and incubating at
-20 C for 1 h. After centrifugation (10,000 x g
for 20 min at 4 C), the RNA pellet was dissolved in 0.3 mL solution D
(RNA extraction buffer) and then precipitated a second time with
isopropanol. After centrifugation, the RNA pellet was washed with 75%
ethanol, dried, and dissolved in water. The concentration of RNA was
determined by absorbance at 260 nm.
PCR was carried out according to the GeneAmp RNA PCR kit
(Perkin-Elmer, Branchberg, NJ) and as used previously (4).
The primers for aromatase bracketed bases 12151507 (293-bp PCR
product) of the human sequence (4). The primer sequences were
5'-1215GAATATTGGAAGGATGCACAGACT1228-3' and
5'-1507GGGTAAAGATCATTTCCAGCATGT1484-3'. The
5'-VEG/PF primer
(5'-68GCTCTCTTGGGTGCACTGGA85-3') and the
3'-VEG/PF primer
(5'-576CACCGCCTTG-GCTTGTCACA627-3') were
the same as those for the rat VEG/PF sequence (5). Primers for
cytoplasmic ß-actin have been described previously (16). To determine
the relative concentrations of target mRNA in tissue from animals under
different conditions, such as during the menstrual cycle and after
ovariectomy, we used a semiquantitative method previously described (5, 16). Equal aliquots of the RT products for the samples to be compared
were serially diluted and then amplified for a fixed number of cycles.
In the exponential range of amplification, the amount of PCR product
derived from a given amount of total RNA in a sample is directly
proportional to the concentration of target mRNA in the sample (17). A
steady decline observed in product yield at each dilution step
confirmed that the reaction had not entered the plateau phase and,
therefore, that the comparison of the two samples was made in the
exponential portion of the amplification curve. A sample of the PCR
mixture (5 µL) was fractionated by electrophoresis in a constant
100-volt field in 0.75-mm thick, nondenaturing, 8%
polyacrylamide gels. Gels were stained for 5 min in ethidium bromide
(0.5 µg/mL) and photographed on a 312-nm UV transilluminator. The
results were expressed as the X-fold difference in the concentration of
input RNA at which product was undetectable in samples from the groups
being compared (5, 16).
Histoculture of breast tissue and
[3H]thymidine incorporation assay
Histocultures were performed as described previously (4, 18, 19, 20). Fresh tissue was washed with HBSS buffer and divided into 1-
to 2-mm cubes. Four to five pieces were placed on the top of each
hydrated gelatin sponge and incubated in a 24-well microplate in 1 mL
Eagles MEM/well without phenol red with 5% charcoal-dextran-treated
calf serum alone and containing 1) vehicle, 2) estradiol (E; 100
pmol/L), 3) P (10 nmol/L), 4) E plus P, 5) testosterone (T; 10 nmol/L),
6) dihydrotestosterone (DHT; 10 nmol/L), 7) an aromatase inhibitor
(4-OHA; 1 µmol/L), and 8) T and 4-OHA. Cultures were maintained at 37
C in an incubator with 5% CO2. After 7 days, the tissue
blocks were transferred to new sponges and incubated with
[3H]thymidine labeling medium (23 Ci/mL·well) for 3
days as previously. The tissue blocks were then transferred to a 1.5-mL
microtube, and 0.5 mL collagenase solution (0.1 mg/mL in 10 mmol/L
Tris-EDTA buffer) was added to each and incubated at 37 C
overnight. The collagenase solution was discarded, and 0.1 mL
proteinase K solution (0.05 mg/mL of 10 mmol/L TE-0.5% SDS) was added
to the tube and incubated at 37 C for 2 h. Then, DNA was extracted
and dissolved in 0.05 mL TE (pH 7.8). The amount of DNA was quantitated
by spectrophotometry (optical density, 260 nm), and the radioactivity
of [3H]thymidine incorporated into newly synthesized DNA
was measured in a liquid scintillation counter.
 |
Results
|
|---|
Aromatase expression detected by immunocytochemistry was observed
mainly in the terminal ductal lobular units (TDLU) of the mammary gland
and in the surrounding stroma to some extent (Fig. 1A
). VEG/PF also appeared to be
expressed in the epithelial cells of the TDLU as aromatase in addition
to endothelial cells of blood vessels (Fig. 1B
).

View larger version (137K):
[in this window]
[in a new window]
|
Figure 1. Aromatase and VEG/PF expression in the
normal mammary gland of an adult female baboon. A, Aromatase was
detected by immunocytochemistry with antihuman aromatase antibody in
fixed paraffin-embedded sections. B, VEG/PF was detected by
immunocytochemistry with antihuman VEG/PF antibody in fixed
paraffin-embedded sections.
|
|
Aromatase activity was measured in tissue biopsies collected
sequentially from baboon 1 during the cycle, after OVX, and after
treatment with E2B for 2 and 4 h (Fig. 2
). Aromatase activity was 220 ±
13.2 fmol/mg·h during the follicular phase and 208.7 ± 12.7
fmol/mg·h during the luteal phase. After ovariectomy, aromatase
activity increased to 299.3 ± 8.6 fmol/mg·h (P
< 0.05), but was significantly reduced in tissue 2 h (76.5
± 4.5 fmol/mg·h) and 4 h (41.0 ± 1.9 fmol/mg·h) after
E2B injection (Fig. 2
). Aromatase mRNA was also studied in
tissue from two other baboons (no. 2 and 3) during the follicular and
luteal phases. There appeared to be no marked difference in the level
of aromatase mRNA between samples removed during the follicular and
luteal phases, whereas a slight increase could be discerned in the mRNA
level after OVX (Fig. 3
). However, when
the OVX animals were injected with E2B, aromatase mRNA
levels appeared to be reduced. Aromatase activity in these animals was
also greatly reduced by E2B treatment from 407.7 and 284
fmol E/mg protein·h to 29.9 and 38.3 fmol E/mg protein·h,
respectively, only 10% of the activity of tissue from ovariectomized
(OVX) animals before treatment. This result was confirmed in tissue
from additional baboons. Aromatase mRNA in samples from baboon 1 after
ovariectomy was quantitated using the dilution method previously
described (5, 16). Using a semiquantitative method involving sample
dilution, there was a 2-fold reduction in aromatase mRNA in tissue
removed 2 and 4 h after the injection of E2B compared
with tissue from the ovariectomized animal before treatment (Fig. 4
).

View larger version (37K):
[in this window]
[in a new window]
|
Figure 2. Aromatase activity during the cycle and
after ovariectomy in mammary tissue of a baboon. Tissue biopsies were
taken sequentially from baboon 1 for measurement of aromatase activity
during the follicular and luteal phases and after ovariectomy. Two
weeks later, the animal was injected with E2B, and mammary
tissue was removed after 2 and 4 h.
|
|

View larger version (26K):
[in this window]
[in a new window]
|
Figure 3. Aromatase mRNA in the baboon mammary gland.
Aromatase mRNA was measured in tissue removed from two baboons during
the luteal and follicular phases of the menstrual cycle, after
ovariectomy, and 2 weeks after E2B treatment. Baboon 2,
lanes 14: 1) follicular phase; 2) luteal phase; 3) OVX; 4) OVX and
E2B. Baboon 3, lanes 58: 5) follicular phase; 6) luteal
phase; 7) OVX; 8) OVX and E2B.
|
|

View larger version (30K):
[in this window]
[in a new window]
|
Figure 4. The effect of estrogen treatment on
aromatase mRNA in mammary tissue of an OVX baboon. A, Aromatase mRNA in
tissue of the same baboon shown in Fig. 2 . Lane 1, Two weeks after OVX;
lane 2, 2 h after E2B injection; lane 3, 4 h
after E2B injection. ß-Actin mRNA, lane 4, 2 weeks after
OVX; lane 5, 2 h after E2B; lane 6, 4 h after
E2B. B, Semiquantitative determination was made by serial
dilution (1:1, 1:3) of the RNA samples, then amplified by PCR for a
fixed number of cycles.
|
|
In histocultures, incorporation of [3H]thymidine into DNA
was increased during incubation with E2 compared with that
during incubation with vehicle only in mammary tissue biopsied
sequentially from baboons 2 and 3 during the cycle, after ovariectomy,
and after OVX and E2B treatment (Fig. 5A
). Testosterone also stimulated
incorporation of [3H]thymidine in these histocultures,
although to a lesser extent than E. The stimulation due to T was
blocked by the aromatase inhibitor 4-OHA, suggesting that
E2 produced locally via androgen aromatization contributes
to enhancing proliferation of the normal baboon mammary gland. When
tissue from OVX animals was incubated with T, there was a significantly
greater increase in [3H]thymidine incorporation than in
the tissue from the two animals biopsied during the follicular and
luteal phases. However, when tissue from OVX animals treated with
E2B (500 µg, sc) for 2 weeks was incubated with T,
[3H]thymidine incorporation into new DNA was
significantly less than that in the tissue of OVX animals
(P < 0.001) and was comparable to the levels during
the luteal phase (Fig. 5A
). The nonaromatizable androgen, DHT, had no
effect on [3H]thymidine incorporation, nor had the
aromatase inhibitor alone. P was similarly ineffective in histocultures
with tissue biopsied during the cycle and after OVX, although P reduced
the response to E when tissue was cultured with both steroids (compare
Fig. 5
, A and B).

View larger version (31K):
[in this window]
[in a new window]
|
Figure 5. The effects of steroids on proliferation of
baboon mammary tissue in histoculture. A, Mammary tissue was removed
from baboons 2 and 3 during the follicular and luteal phases of the
menstrual cycle, after OVX, and after 2 weeks of treatment with
E2B. Four or five pieces of tissue (12 mm) were incubated
on a gelatin sponge as described in Materials and
Methods for 7 days with medium containing E (100 pmol/L), T (10
nmol/L), DHT (10 nmol/L), and an aromatase inhibitor, 4-OHA (1
µmol/L). The tissue blocks were then transferred to fresh medium
containing [3H]thymidine. After 3 days,
[3H]thymidine incorporated into DNA was measured. B,
Tissue pieces were incubated on a gelatin sponge in medium containing P
(10 nmol/L) or P (10 nmol/L) plus E (100 pmol/L) for 7 days. The tissue
blocks were then incubated with [3H]thymidine for 3 days,
and the amount of radioactivity was measured (**, P
< 0.01 vs. control). [3H]Thymidine was
significantly increased by T in tissue from OVX animals compared to
that from intact and OVX animals treated with E2B (**,
P < 0.01).
|
|
Quantitation of VEG/PF mRNA was also carried out on mammary tissue
obtained sequentially from three baboons and was found to be higher
during the luteal phase than during the follicular phase. In contrast
to aromatase, VEG/PF mRNA levels were decreased after OVX compared to
levels in the intact animals. After an E2B injection,
VEG/PF mRNA increased rapidly in 2 and 4 h, to the level observed
during the luteal phase and was maintained at this level after 14 days
of continuous treatment (Fig. 6
).

View larger version (31K):
[in this window]
[in a new window]
|
Figure 6. Quantitative RT-PCR determination of VEG/PF
mRNA in baboon mammary tissue. Semiquantitative determination was made
by serial dilution (1:32, 1:64, 1:128, 1:256, 1:512) of the VEG/PF mRNA
samples, then amplified by PCR for a fixed number of cycles. Tissue
biopsies were taken from three baboons during the follicular and luteal
phases of the menstrual cycle, after OVX, and after treatment with
E2B for 2 h, 4 h, or 14 days.
|
|
 |
Discussion
|
|---|
Our immunocytochemical studies in the human (4, 21) and in this
study indicate that in the normal breast, aromatase is expressed in the
epithelial cells of the TDLU and to a lesser extent in surrounding
stromal cells. Not all studies of breast cancer tissue have confirmed
positive immunocytochemical staining for aromatase in tumor epithelial
cells and have found staining of stromal cells (22). Although these
differences are not yet explained, they might be related to differences
in antibodies or techniques. Our own studies have identified aromatase
mainly in epithelial cells (4). In the normal human mammary gland, we
have confirmed the immunocytochemical results by in situ
hybridization (21) and in isolated cells (23). Epithelial cells are the
cells that are transformed in breast cancer. We and others have
reported that both epithelial and stromal cells are immunostained in
breast cancer. In the normal breast, ductal epithelial cells appear to
express aromatase, whereas stromal cells are less abundant within the
area of the TDLU. Expression of aromatase in the TDLU suggests that
local production can also be a source of estrogens acting on this
tissue. Aromatase activity in mammary tissue was significantly
increased after OVX compared to the levels during the follicular and
luteal phases (P < 0.05). However, treatment with
E2B caused a rapid decrease in activity 2 and 4 h
after injection. Although there appeared to be little modulation of
aromatase mRNA in breast tissue biopsies during the follicular and
luteal phases of the cycle, a slight increase was observed after OVX.
Treatment of the OVX animals with E2B for 2 weeks caused a
marked decrease in aromatase mRNA, and on further study the reduction
was evident within 2 h after E2B injection. Although
further investigation is required, the rapid response to
E2B suggests the possibility of a direct effect of estrogen
on the cells of the mammary gland rather than via feedback regulation
(8). However, we have previously reported that E, estrone, and estriol
do not inhibit aromatase in human placental microsomes (24). In
addition, we recently showed that E does not inhibit aromatase activity
in human breast fibroblasts in cell culture (25).
The results of the histocultures were consistent with the above
findings. We used [3H]thymidine incorporation into DNA as
a measure of proliferation in response to hormones. As indicated in
Fig. 5
, mammary tissue in histoculture was responsive to both E and T.
The proliferative effect of T was inhibited by coincubation with the
aromatase inhibitor, 4-OHA, suggesting that T is aromatized to E in the
tissue. This was confirmed by no increase in proliferation in response
to the nonaromatizable androgen, DHT. P also had little effect on
[3H]thymidine incorporation either alone or in the
presence of E. When mammary tissues from OVX animals were cultured with
T, proliferation was significantly increased compared to that in
tissues from intact animals (P < 0.01). This finding
is consistent with our observation that aromatase activity is increased
after OVX. However, when tissue from OVX baboons treated with
E2B was incubated with T in histoculture,
[3H]thymidine incorporation was reduced to the level in
the intact animal during the luteal phase.
Our results suggest that estrogens produced locally via androgen
aromatization contribute to stimulating proliferation in the normal
baboon mammary gland. Thus, the role of aromatase in the breast may be
to maintain local estrogen levels through modulations in enzyme
expression and activity during cyclic fluctuations in circulating
ovarian hormone concentrations. Estrogen concentrations in breast
tissue from postmenopausal women have been reported to be higher than
those in the circulation (25, 26). The present findings suggest that
after menopause, when circulating estrogen levels are low, aromatase
expression in the breast may be increased. Thus, aromatase in breast
tissue may play an important role in sustaining the local concentration
of estrogen. The presence of locally high concentrations of estrogens
would provide an environment that would enhance the proliferation of
any malignant cells that may be present in the breast.
Estrogens have been shown to regulate the expression of a number of
growth factors, such as insulin-like growth factors I and II, in the
uterus and in mammary tumors (27). We have reported that VEG/PF mRNA
and protein were increased in response to estrogen in rat mammary
tumors after OVX (5). This is the first report of expression of VEG/PF
in the normal primate mammary gland. Both VEG/PF and aromatase appear
to be expressed in the epithelial cells of the TDLU. Furthermore,
VEG/PF mRNA appears to be markedly stimulated by estrogen. Thus, when
baboons were ovariectomized, VEG/PF mRNA levels were decreased compared
to levels during the follicular and luteal phases. In contrast to
aromatase, treatment of OVX baboons with E2B rapidly
increased VEG/PF to the level in intact animals. These results extend
observations that VEG/PF is regulated by estrogen in reproductive
tissues such as the uterus (16) and our findings in the mammary tumors
of the rat (5). We have also found that VEG/PF is stimulated by E in
MCF-7 human breast cancer cells (28). The effect of estrogens on VEG/PF
mRNA in the baboon mammary gland was rapid, was evident 2 and 4 h
after the injection of E2B, and was sustained when
E2B treatment was continued for 14 days. Although the role
of VEG/PF in the normal gland is unclear, it is reasonable to speculate
that the permeability properties of this growth factor, possibly
relating to milk production, could be actions requiring its rapid
induction. In addition, VEG/PF may have effects on new blood vessel
formation during tissue remodeling during cyclic changes and pregnancy.
However, it is evident that this growth factor is expressed by the
normal mammary epithelial cells. Once transformed, breast epithelial
cells can use estrogen not only to increase their proliferation, but
also to enhance VEG/PF production to stimulate angiogenesis.
In conclusion, our findings show that aromatase and VEG/PF are
expressed in the TDLU of the mammary gland of the nonhuman primate and
suggest that both may have a role in the normal gland. Furthermore,
aromatase expression and VEG/PF mRNA are regulated by estrogen. We have
recently identified aromatase and VEG/PF in the normal breast and in
breast cancers of women (4, 23). In addition, we have demonstrated that
VEG/PF is enhanced by estrogen in hormone-responsive human breast
cancer cells (MCF-7) (28). After menopause, when circulating estrogen
levels are low, an increase in aromatase levels in the breast may
maintain tissue concentrations of estrogen. Thus, aromatase may control
the local production of estrogen through an autocrine loop. During the
process of transformation to malignancy, locally produced estrogen may
stimulate the proliferation of tumor cells (5) and VEG/PF production.
These effects are also likely to enhance tumor progression, development
of angiogenesis, and, ultimately, metastasis of the cancer.
 |
Footnotes
|
|---|
1 This work was supported by NIH Grant CA-6495. 
2 Present address: Research Institute of Life Science, Snow Brand
Milk Products Co. Ltd., 519 Shimo-Ishibashi, Ishibashi-Machi,
Shimotsuga-Gun, Tochigi 32905, Japan. 
Received August 12, 1998.
Revised December 4, 1998.
Revised January 12, 1999.
Accepted January 19, 1999.
 |
References
|
|---|
-
Dickson RB, Lippman ME. 1987 Estrogen
regulation of growth and polypeptide growth factor secretion in human
breast carcinoma. Endocr Rev. 8:2943.[Medline]
-
Imagawa W, Bandyopadhyay GK, Nandi S. 1990 Regulation of mammary epithelial cell growth in mice and rats. Endocr
Rev. 11:494523.[Medline]
-
Dembinski TC, Shiu RPC. 1987 Growth factors in
mammary gland development and function. In: Neville MC, Daniel CW, eds.
The mammary gland: development, regulation, and function. New York:
Academic Press; 355381.
-
Lu Q, Nakamura J, Savinov A, Yue W, Weisz J, Dabbs DJ,
Wolz G, Brodie A. 1996 Expression of aromatase protein and
messenger RNA in tumor epithelial cells and evidence of functional
significance of locally produced estrogen in human breast cancers. Endocrinology. 137:30613068.[Abstract]
-
Nakamura J, Savinov A, Lu Q, Brodie A. 1996 Estrogen regulates vascular endothelial growth/permeability factor
expression in DMBA induced rat mammary tumors. Endocrinology. 137:55985596.
-
Brown LF, Berse B, Jackman RW, et al. 1995 Expression of vascular permeability factor (vascular endothelial growth
factor) and its receptors in breast cancer. Hum Pathol. 26:8691.[CrossRef][Medline]
-
Yoshiji H, Gomez DE, Shibuya M, Thorgeirsson UP. 1996 Expression of vascular endothelial growth factor, its receptor,
and other angiogenic factors in human breast cancer. Cancer Res. 56:20132016.[Abstract/Free Full Text]
-
Silberstein GB, van Horn K, Shyamala G, Daniel CW. 1994 Essential role of endogenous estrogen in directly stimulating
mammary growth demonstrated by implants containing pure antiestrogens. Endocrinology. 134:8490.[Abstract]
-
Henderson BE, Ross RK, Pike MC, Casagrande JT. 1982 Endogenous hormones as a major factor in human cancer. Cancer Res. 42:32323239.[Abstract/Free Full Text]
-
Brodie AMH, Hammond JO, Ghosh M, Albrecht E. 1989 The effect of aromatase inhibitor 4-OHA in the primate menstrual cycle. Cancer Res. 49:47804784.[Abstract/Free Full Text]
-
Albrecht ED, Haskins AL, Hodgen GD, Pepe GJ. 1981 Luteal function in baboons with administration of the antiestrogen
ethamoxytriphetol (MER-25) throughout the luteal phase of the menstrual
cycle. Biol Reprod. 25:451457.[Abstract]
-
Brodie AMH, Schwarzel WC, Shaikh AA, Brodie HJ. 1977 The effect of an aromatase inhibitor,
4-hydroxy-4-androstene-3,17-dione, on estrogen dependent processes in
reproduction and breast cancer. Endocrinology. 100:16841694.[Abstract]
-
Mendelson CR, Wright EE, Porter JC, Evans CT, Simpson
ER. 1985 Preparation and characterization of polyclonal and
monoclonal antibodies against human aromatase cytochrome P-450 (P-450
arom) and their use in its purification. Arch Biochem Biophys. 243:480491.[CrossRef][Medline]
-
Lowry OH, Rosebrough NJ, Ferr AL, Randall RJ. 1951 protein measurement with the Folin phenol reagent. J Biol Chem. 193:265275.[Free Full Text]
-
Chomczynski P, Sacchi N. 1987 Single-step method of
RNA isolation by scid guanidinium thiocyanate-phenol-chloroform
extraction. Anal Biochem. 162:156159.[Medline]
-
Cullinan-Bove K, Koos R. 1993 Vascular endothelial
growth factor/vascular permeability factor expression in the rat
uterus: rapid stimulation by estrogen correlates with estrogen-induced
increases in uterine capillary permeability and growth. Endocrinology. 133:829837.[Abstract]
-
Murphy LD, Herzog CE, Rudick JB, Fojo AT, Bates SE. 1990 Use of the polymerase chain reaction in the quantitation of
mdr-1 gene expression. Biochemistry. 29:1035110356.[CrossRef][Medline]
-
Nakamura J, Imai E, Yoshihama M, Sasano H, Kubota
T. 1998 Histoculture drug response assay, a possible examination
system for predicting the antitumor effect of aromatase inhibitors in
patients with breast cancer. Anticancer Res. 18:125128.[Medline]
-
Hoffman RM. 1991 Three-dimensional histoculture:
origins and applications in cancer research. Cancer Cells. 3:8692.[Medline]
-
Hoffman RM. 1992 Histoculture and the
immunodeficient mouse come to the cancer clinic: rational approaches to
individualizing cancer therapy and new drug evaluation. Int J Oncol. 1:467474.
-
Brodie A, Lu Q, Nakamura J. 1997 Aromatase in the
normal breast and breast cancer. J Steroid Biochem Mol Biol. 61:281286.[CrossRef][Medline]
-
Sasano H, Nagura H, Harada N, Goukon Y, Kimura M. 1994 Immunolocalization of aromatase and other steroidogenic enzymes in
human breast disorders. Hum Pathol. 25:530535.[CrossRef][Medline]
-
Schwarzel WC, Kruggel W, Brodie HJ. 1973 Studies on
the mechanism of estrogen biosynthesis. VII. The development of
inhibitors of the enzyme system in human placenta. Endocrinology. 92:866880.[Medline]
-
Long B, Tilghman S, Yue W, Thiantanawat A, Grigoryev D,
Brodie A. 1998 The steroidal antiestrogen ICI 182,780 is an
inhibitor of cellular aromatase activity. J Steroid Biochem Mol Biol. 67:293304.[CrossRef][Medline]
-
van Landeghem AAJ, Portman J, Nabauurs M. 1985 Endogenous concentration and subcellular distribution of estrogens in
normal and malignant human breast tissue. Cancer Res. 45:29002906.[Abstract/Free Full Text]
-
Thorsen T, Tangen M, Stoa KF. 1982 Concentrations
of endogenous estradiol as related to estradiol receptor sites in
breast tumor cytosol. Eur J Cancer Clin Oncol. 18:333337.[CrossRef][Medline]
-
Katzenellenbogen BS, Norman MJ. 1990 Multihormonal
regulation of the progesterone receptor in MCF-7 human breast cancer
cells: interrelationships among insulin/insulin-like growth factor-I,
serum and oestrogen. Endocrinology. 126:891898.[Abstract]
-
Long BJ, Lu Q, Brodie A. Expression and regulation
of vascular endothelial growth factor (VEGF) in human breast cancer
cells. Proc of the 88th Annual Meet of the Am Assoc for Cancer Res.
1997.
This article has been cited by other articles:

|
 |

|
 |
 
S M Hyder
Sex-steroid regulation of vascular endothelial growth factor in breast cancer.
Endocr. Relat. Cancer,
September 1, 2006;
13(3):
667 - 687.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. R. Harrington, S. Sengupta, and B. S. Katzenellenbogen
Estrogen Regulation of the Glucuronidation Enzyme UGT2B15 in Estrogen Receptor-Positive Breast Cancer Cells
Endocrinology,
August 1, 2006;
147(8):
3843 - 3850.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Dabrosin
Positive Correlation between Estradiol and Vascular Endothelial Growth Factor but not Fibroblast Growth Factor-2 in Normal Human Breast Tissue In vivo
Clin. Cancer Res.,
November 15, 2005;
11(22):
8036 - 8041.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Bulun, Z. Lin, G. Imir, S. Amin, M. Demura, B. Yilmaz, R. Martin, H. Utsunomiya, S. Thung, B. Gurates, et al.
Regulation of Aromatase Expression in Estrogen-Responsive Breast and Uterine Disease: From Bench to Treatment
Pharmacol. Rev.,
September 1, 2005;
57(3):
359 - 383.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Somboonporn and S. R. Davis
Testosterone Effects on the Breast: Implications for Testosterone Therapy for Women
Endocr. Rev.,
June 1, 2004;
25(3):
374 - 388.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Dabrosin
Variability of Vascular Endothelial Growth Factor in Normal Human Breast Tissue in Vivo during the Menstrual Cycle
J. Clin. Endocrinol. Metab.,
June 1, 2003;
88(6):
2695 - 2698.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Buteau-Lozano, M. Ancelin, B. Lardeux, J. Milanini, and M. Perrot-Applanat
Transcriptional Regulation of Vascular Endothelial Growth Factor by Estradiol and Tamoxifen in Breast Cancer Cells: A Complex Interplay between Estrogen Receptors {alpha} and {beta}
Cancer Res.,
September 1, 2002;
62(17):
4977 - 4984.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. K. Mukherjee, H. Dinh, G. Chaudhuri, and L. Nathan
Testosterone attenuates expression of vascular cell adhesion molecule-1 by conversion to estradiol by aromatase in endothelial cells: Implications in atherosclerosis
PNAS,
March 19, 2002;
99(6):
4055 - 4060.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Estrogen: Consequences and Implications of Human Mutations in Synthesis and Action
J. Clin. Endocrinol. Metab.,
December 1, 1999;
84(12):
4677 - 4694.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. D. Mueller, J.-L. Vigne, A. Minchenko, D. I. Lebovic, D. C. Leitman, and R. N. Taylor
Regulation of vascular endothelial growth factor (VEGF) gene transcription by estrogen receptors alpha and beta
PNAS,
September 26, 2000;
97(20):
10972 - 10977.
[Abstract]
[Full Text]
[PDF]
|
 |
|