| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Third Division Department of Medicine, Kobe University School of Medicine (K.I., Y.T., H.K., M.O.T., Y.O., H.A., K.C.), 75-1 Kusunoki-cho, Chuo-ku, Kobe; and Nose Clinic (O.N.), Osaka, Japan
Address all correspondence and requests for reprints to: Dr. K. Iida, Third Division, Department of Medicine, Kobe University School of Medicine, 75-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017, Japan.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
This study aimed at characterizing the function of this GHR-277 to elucidate clinical characteristics of our patients, that is their high serum GHBP levels and short stature despite the heterozygous mutation, and also to clarify the physiological role of GHR-277 in GH signal transduction and GHBP production.
| Subjects and Methods |
|---|
|
|
|---|
The profiles of the patients were reported previously (6). Briefly, patients 1 and 2 were siblings, a 13.3-yr-old boy and a 9.2-yr-old girl, both of whom showed the mild clinical phenotypes associated with a lack of GH action. Their parents were not related. The clinical and biochemical characteristics of patients 1 and 2 and their mother are shown inTable 1. Their father was 172 cm tall (within normal range) without the clinical phenotype of GH insensitivity.
Construction of wild-type full-length GHR (GHR-fl) and GHR-277 expression vectors
The pUC119 vector containing the full-length GHR
complementary (c) DNA (pUC119-GHR) (10), provided by Genentech, Inc. (South San Francisco, CA), was subcloned into the
expression vector pcDNAI (Invitrogen Corp., Leek,
Netherlands) using the BamHI and SphI restriction
sites. The amplification fragment, including from exon 7 to exon 10 of
the GHR cDNA from the patients lymphocytes by RT-PCR (Fig. 1
), was subcloned into the pT7 Blue
T-vector (Novagen, Inc., Madison, WI) and digested with restriction
enzymes NcoI and EcoRI, then inserted into the
pUC119-GHR using NcoI-EcoRI restriction sites and
subcloned into the pcDNAI vector using the BamHI and
SphI sites to produce GHR-277 (primer sets for RT-PCR are as
follows: sense primer, ACACTTCCTCAGATGAGC; antisense primer,
CACTGTGGAATTCGGGTTTA). The accuracy of construction of GHR-277 cDNA was
confirmed by sequencing. The cDNA fragment from exon 7 to exon 10
coding for GHR-277 and the deduced amino acid structure of GHR-277 are
shown in Fig. 1
.
|
COS-7 cells were grown in DMEM (Life Technologies, Inc., Grand Island, NY) containing 10% FBS (BioWhittaker, Walkersville, MD), penicillin, and kanamycin at 37 C in 5% CO2. CHO cells were grown in DMEM/Hams F-12 (Life Technologies) containing 10% FBS, penicillin, and kanamycin at 37 C in 5% CO2. Transfections were performed at 70% confluence using LipofectAce reagent (Life Technologies, Inc., Gaithersburg, MD) with 3.0 µg plasmid containing GHR-fl or GHR-277 cDNAs and 2.0 µg pSV-ß-control vector (Promega Corp., Madison, WI). The ß-galactosidase activities were measured as an internal control of transfections using an enzyme assay system kit (Promega Corp.) according to the manufacturers instructions.
Scatchard plots of [125I]human (h) GH binding to GHR-fl and GHR-277
Forty-eight hours after transfection, COS-7 cells expressing
GHR-fl and GHR-277 were starved for serum for 2 h,
[125I]hGH (0.4 µCi/mL; NEX-100, DuPont, Wilmington, DE)
was added to the serum-free culture medium containing 0.1% BSA with
increasing concentrations of unlabeled hGH and incubated for 90 min.
The cells were washed three times with phosphate-buffered saline and
solubilized with 0.1 N NaOH. The cell-associated
radioactivity was counted using a
-counter (Pharmacia Biotech, Piscataway, NJ) and corrected for ß-galactosidase
activities. All experiments were performed in triplicate.
Measurement of GHBP in the medium
Twenty-four hours after transfection, the media of COS-7 cells expressing GHR-fl and GHR-277 were exchanged, and the cells were incubated for another 24 h. The media were collected, and aliquots of the media were incubated at 4 C for 16 h in a total volume of 250 µL containing [125I]hGH (0.8 µCi/mL) and anti-GHR mouse monoclonal antibody (mAb263, Agen, Brisbane, Australia). Twenty-five microliters of 10% antimouse IgG, 25 µL 1% normal mouse serum, and 300 µL 5% polyethylene glycol were then added. The reaction mixture was incubated for an additional 4 h at 4 C and centrifuged. The radioactivity of the pellets was counted and corrected for ß-galactosidase activities. All experiments were performed in triplicate.
GH-induced internalization of GHR
The COS-7 cells expressing GHR-fl and GHR-277 were incubated in serum-free DMEM; the media were collected 0, 15, 30, and 60 min after the addition of [125I]hGH (0.8 µCi/mL), then the cells were washed with cold phosphate-buffered saline and treated at 4 C for 5 min with 0.2 mol/L acetic acid and 0.5 mol/L NaCl, pH 2.5. The radioactivity extracted by this acid-salt solution was considered to be [125I]hGH still bound on the cell surface, whereas the radioactivity remaining in the cells after acid-salt washing was considered to be internalized (11). Nonspecific binding was determined in parallel cultures containing more than a 100-fold excess of unlabeled hGH, and the rate of internalization was calculated as the ratio of the percentage of the specific internalized radioactivity to the specific total bound radioactivity.
GH-dependent tyrosine phosphorylation of signal transducer and activator of transcription-5b (STAT5b) in GHR-expressing CHO cells
CHO cells were cotransfected with 3.0 µg expression vectors containing GHR-fl cDNA (pcDNA1/GHR-fl) and increasing amounts of those containing GHR-277 cDNA (pcDNA1/GHR-277; 0, 0.3, 1.5, and 3.0 µg) or were transfected with 3.0 µg pcDNA1/GHR-277 alone. The transfected cells were stimulated by 100 ng/mL hGH for 15 min and lysed. GH-induced tyrosine phosphorylation of STAT5b in the cells coexpressed with both GHR-fl and GHR-277 was determined by Western blotting as described previously (12). Specific antibody for STAT5b (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and antiphosphotyrosine antibody (RC20H, Transduction Laboratories, Inc., Lexington, KY) were used for immunoprecipitation and immunoblotting, respectively. Antibody binding was detected using an enhanced chemiluminescence kit (Amersham Corp., Arlington Heights, IL).
Statistical analysis
Statistical significance between the different values was determined using Students t test.
| Results |
|---|
|
|
|---|
Scatchard analysis revealed that GHR-277 possessed a
slightly higher binding affinity to hGH than GHR-fl. The representative
data are shown in Fig. 2
. The association
constant (Ka) for GHR-fl is 0.49 x
109 mol/L-1, and that for GHR-277 is 0.61
x 109 mol/L-1 (Fig. 2
). Triplicate
experiments revealed that GHR-277 demonstrated 1.5 ± 0.4 times
higher binding affinity to hGH than GHR-fl. The binding sites of cells
expressing GHR-fl and GHR-277 were 70 ± 15 and 147 ± 26
fmol/106 cells, respectively, indicating that
GHR-277-expressing cells possessed approximately twice as many binding
sites as GHR-fl-expressing cells.
|
Table 2
showed the relative GHBP
levels in the culture medium of the COS-7 cells transfected with either
pcDNA1/GHR-fl or pcDNA1/GHR-277. The radioactivity was 1079 ± 70
vs. 3299 ± 131 cpm (GHR-fl vs. GHR-277),
indicating that the amount of GHBP cleaved from GHR-277-expressing
cells was approximately 3 times higher than that from GHR-fl expressing
cells.
|
Critical amino acid residues for internalization of the GHR are
located within box 2 in the cytoplasmic domain (9), which is absent in
GHR-277. As a result of impaired internalization, a large amount of
truncated GHR-277 might be sustained at the cell surface and become the
source of GHBP. To clarify this hypothesis, we have examined the time
course of ligand-induced internalization of GHR-277 compared with that
of GHR-fl. In GHR-fl-expressing COS-7 cells, added
[125I]hGH was time dependently internalized; the rates of
internalized ligand to the total specific binding were 24.4 ±
1.5%, 53.7 ± 0.1%, and 75.6 ± 4.2% at 15, 30, and 60 min
after addition, respectively. In contrast, in GHR-277-expressing cells,
only 20% of the total specific binding was internalized 15 min after
the addition of GH, and this was sustained throughout the study
(17.5 ± 2.0%, 14.1 ± 0.5%, and 16.6 ± 1.4% at 15,
30, and 60 min after addition, respectively), as shown in Fig. 3
.
|
GH-induced tyrosine phosphorylation of STAT5b was compared in CHO
cells coexpressing GHR-277 and GHR-fl. When increasing amounts of
pcDNA1/GHR-277 (from 0.33.0 µg) were cotransfected with 3.0 µg
pcDNA1/GHR-fl, GH-induced tyrosine phosphorylation of STAT5b was dose
dependently inhibited (Fig. 4
). When the
vectors of both pcDNA1/GHR-fl and pcDNA1/GHR-277 were cotransfected in
equal amounts, GH-induced tyrosine phosphorylation of STAT5b was
significantly reduced compared with that transfected with pcDNA1/GHR-fl
alone, indicating a dominant negative effect of GHR-277 on GH signal
transduction.
|
| Discussion |
|---|
|
|
|---|
The clinical features of the patients were similar to those of the
patient reported by Woods et al. (4) and Silbergeld et al.
(4A ), who showed GH resistance and high serum GHBP levels. In their
patient, truncated GHR lacking both transmembrane and intracellular
domains is produced by a splice site mutation of exon 8 of the GHR gene
and complete deletion of exon 8. This truncated GHR is presumed to be
unanchored in the cell membrane and released into the serum as mutated
GHBP. In contrast, in our patients, the extracellular and transmembrane
domains of GHR-277 are identical to those of wild-type full-length GHR,
but the intracellular domain of GHR-277 consists of only seven amino
acids, lacking both boxes 1 and 2. One of the clinical characteristics
shared by patient reported by Woods et al. and our patients
is a high serum GHBP level. The present in vitro studies
revealed that GHBP levels in the medium from GHR-277-expressing cells
were approximately 3 times higher than those from GHR-fl-expressing
cells, in good agreement with clinical findings observed in our
patients. Since GHR-277 could be anchored on the cell surface, the
mechanism for increased production of GHBP seemed to be different from
that in the case reported by Woods et al. (4) and Silbergeld
et al. (4A ). Scatchard analysis confirmed that GHR-277 was apparently
expressed on the cell surface of COS-7 cells transfected with
pcDNA1/GHR-277. There were twice as many GH-binding sites on
GHR-277-expressing cells as on GHR-fl-expressing cells, which is
consistent with previous reports (15, 16, 17). Furthermore, GHR-277
possessed 1.5 ± 0.4 times greater binding affinity to hGH than
GHR-fl. There are conflicting data regarding the binding affinity of
truncated GHR to GH. Ross et al. showed that the truncated
GHR consisting of 279 amino acids (GHR-279) have about half the binding
affinity to hGH as GHR-fl (8), whereas Dastot et al.
reported that GHR-279 possesses about 2 times higher affinity than
GHR-fl (18). Our data using GHR-277 are consistent with the findings by
Dastot et al. Although the reasons why the truncated GHR
including GHR-277 showed higher binding affinity than GHR-fl were
unclear, the conformational change due to the lack of an intracellular
domain might influence binding with the ligand. Increased binding sites
in GHR-277-expressing cells might be explained by impaired
internalization of GHR-277. The GH-induced internalization of GHR-277
was significantly reduced compared with that of GHR-fl (Fig. 3
),
probably because GHR-277 lacked critical amino acid residues for
ligand-mediated internalization of the GHR (9). As a result of reduced
internalization, increased amounts of GHR-277 would be sustained at the
cell surface and become the source of soluble GHBP in serum/medium
through the proteolytic cleavage of the membrane-anchored GHR. The
possibility of an increased number of GHR-277 in the cell membrane was
proved by an actual increase in binding sites for the GH ligand in
GHR-277-expressing COS-7 cells. Interestingly, despite a 2-fold
increase in the number of GH-binding sites on the cell surface of
GHR-277-expressing cells, the GHBP levels in culture media were
approximately 3 times higher than those in GHR-fl-expressing cells,
suggesting the necessity of considering additional factors, such as the
change in the turnover rate of GHR, the sensitivity of GHR to enzymatic
cleavage, etc.
Another interesting characteristic of our patients was the development of the partial insensitivity to GH despite the heterozygous mutation. In GH signal transduction, the dimerization of GHR causes tyrosyl phosphorylation of both GHR and Janus kinase-2 (JAK2) (19), in the process of which the box 1 motif of GHR is required for association with JAK2 (20). As the mutations of GHR in our patients were heterozygous, three different types of GHR dimerization are theoretically proposed: namely, the homodimers of two GHR-fl, the heterodimers of GHR-fl and GHR-277, and the homodimers of two GHR-277. It was recently demonstrated that GHR-277 could form the heterodimer with GHR-fl (7). The homodimers of two GHR-fl could transduce the GH signal. However, as GHR-277 lacks box 1 motif, the homodimers of two GHR-277 and probably the heterodimers of GHR-277 and GHR-fl could not transduce the GH signal. As demonstrated in this study, the number of GHR-277 receptors at the cell surface and the binding affinity of GHR-277 to GH were both greater than those of GHR-fl. Therefore, GHR-277 would bind many more GH molecules than GHR-fl even if equal amounts of receptor proteins are produced from each allele of the GHR gene. In consequence, normal GH signaling would attenuate when GHR-277 and GHR-fl are coexpressed, indicating the new type of mechanism exerting a dominant negative action. The dominant negative effect of GHR-277 on GH signal transduction was clearly verified in in vitro experiments showing that tyrosine phosphorylation of STAT5b was obviously reduced when the same amounts of cDNAs of GHR-277 and GHR-fl were cotransfected.
It is of interest that GHR-279 and GHR-277 are both physiologically produced isoforms of GHR by alternative splicing of the common transcript of GHR gene (8, 18). GHR-279 possesses not only an increased capability to produce GHBP, but also shows impaired internalization and down-regulation (21). These truncated isoforms of GHR may play a role as a negative regulator of GH signal transduction and a source of GHBP production in the tissues or cells expressing the truncated GHR isoforms. However, the physiological significance of these truncated GHR isoforms remains unclear, as there are little data regarding regional distribution and amounts of the truncated GHR in normal tissues.
In conclusion, we have characterized the function of GHR-277 in vitro that was generated in a family with partial GH insensitivity and high serum GHBP levels. The biological characteristics of GHR-277 in vitro could well explain the clinical features of the patients.
|
| Acknowledgments |
|---|
| Footnotes |
|---|
Received August 14, 1998.
Revised November 24, 1998.
Accepted December 11, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
G. Kenth, J. A M. Mergelas, and C. G. Goodyer Developmental changes in the human GH receptor and its signal transduction pathways J. Endocrinol., July 1, 2008; 198(1): 71 - 82. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Hwa, B. Little, P. Adiyaman, E. M. Kofoed, K. L. Pratt, G. Ocal, M. Berberoglu, and R. G. Rosenfeld Severe Growth Hormone Insensitivity Resulting from Total Absence of Signal Transducer and Activator of Transcription 5b J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4260 - 4266. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. E Mullis Genetic control of growth Eur. J. Endocrinol., January 1, 2005; 152(1): 11 - 31. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Iida, J. P. del Rincon, D.-S. Kim, E. Itoh, K. T. Coschigano, J. J. Kopchick, and M. O. Thorner Regulation of full-length and truncated growth hormone (GH) receptor by GH in tissues of lit/lit or bovine GH transgenic mice Am J Physiol Endocrinol Metab, September 1, 2004; 287(3): E566 - E573. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Kofoed, V. Hwa, B. Little, K. A. Woods, C. K. Buckway, J. Tsubaki, K. L. Pratt, L. Bezrodnik, H. Jasper, A. Tepper, et al. Growth Hormone Insensitivity Associated with a STAT5b Mutation N. Engl. J. Med., September 18, 2003; 349(12): 1139 - 1147. [Full Text] [PDF] |
||||
![]() |
P. van Kerkhof, M. Smeets, and G. J. Strous The Ubiquitin-Proteasome Pathway Regulates the Availability of the GH Receptor Endocrinology, April 1, 2002; 143(4): 1243 - 1252. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Buckway, J. Guevara-Aguirre, K. L. Pratt, C. P. Burren, and R. G. Rosenfeld The IGF-I Generation Test Revisited: A Marker of GH Sensitivity J. Clin. Endocrinol. Metab., November 1, 2001; 86(11): 5176 - 5183. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sjoberg, T. Salazar, C. Espinosa, A. Dagnino, A. Avila, M. Eggers, F. Cassorla, P. Carvallo, and M. V. Mericq Study of GH Sensitivity in Chilean Patients with Idiopathic Short Stature J. Clin. Endocrinol. Metab., September 1, 2001; 86(9): 4375 - 4381. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Salerno, B. Balestrieri, E. Matrecano, A. Officioso, R. G. Rosenfeld, S. Di Maio, G. Fimiani, M. V. Ursini, and C. Pignata Abnormal GH Receptor Signaling in Children with Idiopathic Short Stature J. Clin. Endocrinol. Metab., August 1, 2001; 86(8): 3882 - 3888. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Iida, Y. Takahashi, H. Kaji, N. Onodera, M. O. Takahashi, Y. Okimura, H. Abe, and K. Chihara The C422F Mutation of the Growth Hormone Receptor Gene Is Not Responsible for Short Stature J. Clin. Endocrinol. Metab., November 1, 1999; 84(11): 4214 - 4219. [Abstract] [Full Text] |
||||
![]() |
R. BJARNASON and M. O SAVAGE Growth hormone insensitivity: a widening diagnosis Arch. Dis. Child., November 1, 1999; 81(5): 378 - 379. [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |