This Article Abstract Full Text (PDF) Submit a related Letter to the Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Iida, K. Articles by Chihara, K. Search for Related Content PubMed PubMed Citation Articles by Iida, K. Articles by Chihara, K.

Functional Characterization of Truncated Growth Hormone (GH) Receptor-(1–277) Causing Partial GH Insensitivity Syndrome with High GH-Binding Protein¹

Third Division Department of Medicine, Kobe University School of Medicine (K.I., Y.T., H.K., M.O.T., Y.O., H.A., K.C.), 7–5-1 Kusunoki-cho, Chuo-ku, Kobe; and Nose Clinic (O.N.), Osaka, Japan

Address all correspondence and requests for reprints to: Dr. K. Iida, Third Division, Department of Medicine, Kobe University School of Medicine, 7–5-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017, Japan.

	Abstract

Top Abstract Introduction Subjects and Methods Results Discussion References

 
We have previously reported a novel heterozygous donor splice site mutation in intron 9 of the GH receptor (GHR) gene in Japanese siblings who showed partial GH insensitivity and high serum GH-binding protein (GHBP) levels. This mutation caused the splicing abnormality and produced the truncated GHR consisting of 277 amino acids (GHR-277), which lacked most of the intracellular domain of GHR, including both boxes 1 and 2. In this study, we have characterized the function of GHR-277 expression in COS-7 and CHO cells in vitro. Scatchard analysis revealed that GHR-277 possessed approximately 1.5 times higher affinity to GH and twice the number of binding sites compared to wild-type full-length GHR (GHR-fl). The GHBP level in culture medium of GHR-277-expressing cells was approximately 3 times higher than that in GHR-fl-expressing cells. Interestingly, the ligand-induced internalization of GHR-277 was significantly reduced compared with that of GHR-fl. Moreover, in GH-induced tyrosine phosphorylation of signal transducer and activator of transcription-5 (STAT5), GHR-277 exerted a dominant negative effect when GHR-277 and GHR-fl were cotransfected. These in vitro data would well explain the clinical characteristics in our patients showing high serum GHBP levels and development of short stature despite a heterozygous mutation of the GHR gene.

	Introduction

Top Abstract Introduction Subjects and Methods Results Discussion References

 
GH INSENSITIVITY syndrome (GHIS) is an autosomal recessive disorder, first reported by Laron et al. in 1966 (1). Several genetic abnormalities in the GH receptor (GHR) gene in GHIS have been reported to date, most of which were located in the region coding for the extracellular domain of the GHR and were homozygous or compound heterozygous mutations (2). Serum GH-binding protein (GHBP) was not detected or was extremely low in most patients because of the GHR defect or the failure of ligand binding to the GHR (2), but some patients demonstrated normal to high levels of serum GHBP (3, 4 4A ). The missense mutation D152H caused a failure of receptor dimerization despite normal GH binding and normal serum GHBP levels (3). Splice site mutations resulting in complete skipping of exon 8, which codes for the transmembrane domain of the GHR, were reported in patients with GHIS and high serum GHBP levels (4 4A ). This truncated GHR is presumed to be unanchored in the cell membrane and to be measurable in serum as GHBP. In addition, Goddard et al. reported heterozygous mutations of the GHR gene in idiopathic short stature with partial GH insensitivity and low serum GHBP levels (5). These case reports suggest that the clinical characteristics of GHIS, that is the severity of GH insensitivity as well as the serum GHBP levels, are highly variable and more heterogeneous than we thought in classical Laron syndrome. Recently, we reported a novel heterozygous donor splice site mutation of intron 9 of the GHR gene in two Japanese siblings who showed partial GH insensitivity and high serum GHBP levels (6). This mutation resulted in complete skipping of exon 9 from one allele and production of the truncated GHR consisting of 277 amino acids (GHR-277), which was structurally identical to that of the case reported by Ayling et al. (7). Moreover, it is of interest that GHR-277 is one of the physiological GHR isoforms produced in a minute amount by alternative splicing of the common GHR transcript (8), suggesting that GHR-277 may play a role in physiological regulation of GH action.

This study aimed at characterizing the function of this GHR-277 to elucidate clinical characteristics of our patients, that is their high serum GHBP levels and short stature despite the heterozygous mutation, and also to clarify the physiological role of GHR-277 in GH signal transduction and GHBP production.

	Subjects and Methods

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Patients

The profiles of the patients were reported previously (6). Briefly, patients 1 and 2 were siblings, a 13.3-yr-old boy and a 9.2-yr-old girl, both of whom showed the mild clinical phenotypes associated with a lack of GH action. Their parents were not related. The clinical and biochemical characteristics of patients 1 and 2 and their mother are shown inTable 1. Their father was 172 cm tall (within normal range) without the clinical phenotype of GH insensitivity.

Construction of wild-type full-length GHR (GHR-fl) and GHR-277 expression vectors

The pUC119 vector containing the full-length GHR complementary (c) DNA (pUC119-GHR) (10), provided by Genentech, Inc. (South San Francisco, CA), was subcloned into the expression vector pcDNAI (Invitrogen Corp., Leek, Netherlands) using the BamHI and SphI restriction sites. The amplification fragment, including from exon 7 to exon 10 of the GHR cDNA from the patient’s lymphocytes by RT-PCR (Fig. 1), was subcloned into the pT7 Blue T-vector (Novagen, Inc., Madison, WI) and digested with restriction enzymes NcoI and EcoRI, then inserted into the pUC119-GHR using NcoI-EcoRI restriction sites and subcloned into the pcDNAI vector using the BamHI and SphI sites to produce GHR-277 (primer sets for RT-PCR are as follows: sense primer, ACACTTCCTCAGATGAGC; antisense primer, CACTGTGGAATTCGGGTTTA). The accuracy of construction of GHR-277 cDNA was confirmed by sequencing. The cDNA fragment from exon 7 to exon 10 coding for GHR-277 and the deduced amino acid structure of GHR-277 are shown in Fig. 1.

View larger version (37K): [in this window] [in a new window]   Figure 1. The structures of a part of the cDNA (a) and of deduced amino acids (b) found in our patients (6 ). The cDNAs of our patients, lacking exon 9, resulted in a frame shift, a premature stop codon in exon 10, and production of truncated GHR consisting of 277 amino acids. The arrows denote the positions of primers used for PCR. The asterisk denotes the mutation site.

COS-7 cells were grown in DMEM (Life Technologies, Inc., Grand Island, NY) containing 10% FBS (BioWhittaker, Walkersville, MD), penicillin, and kanamycin at 37 C in 5% CO₂. CHO cells were grown in DMEM/Ham’s F-12 (Life Technologies) containing 10% FBS, penicillin, and kanamycin at 37 C in 5% CO₂. Transfections were performed at 70% confluence using LipofectAce reagent (Life Technologies, Inc., Gaithersburg, MD) with 3.0 µg plasmid containing GHR-fl or GHR-277 cDNAs and 2.0 µg pSV-ß-control vector (Promega Corp., Madison, WI). The ß-galactosidase activities were measured as an internal control of transfections using an enzyme assay system kit (Promega Corp.) according to the manufacturer’s instructions.

Scatchard plots of [¹²⁵I]human (h) GH binding to GHR-fl and GHR-277

Forty-eight hours after transfection, COS-7 cells expressing GHR-fl and GHR-277 were starved for serum for 2 h, [¹²⁵I]hGH (0.4 µCi/mL; NEX-100, DuPont, Wilmington, DE) was added to the serum-free culture medium containing 0.1% BSA with increasing concentrations of unlabeled hGH and incubated for 90 min. The cells were washed three times with phosphate-buffered saline and solubilized with 0.1 N NaOH. The cell-associated radioactivity was counted using a -counter (Pharmacia Biotech, Piscataway, NJ) and corrected for ß-galactosidase activities. All experiments were performed in triplicate.

Measurement of GHBP in the medium

Twenty-four hours after transfection, the media of COS-7 cells expressing GHR-fl and GHR-277 were exchanged, and the cells were incubated for another 24 h. The media were collected, and aliquots of the media were incubated at 4 C for 16 h in a total volume of 250 µL containing [¹²⁵I]hGH (0.8 µCi/mL) and anti-GHR mouse monoclonal antibody (mAb263, Agen, Brisbane, Australia). Twenty-five microliters of 10% antimouse IgG, 25 µL 1% normal mouse serum, and 300 µL 5% polyethylene glycol were then added. The reaction mixture was incubated for an additional 4 h at 4 C and centrifuged. The radioactivity of the pellets was counted and corrected for ß-galactosidase activities. All experiments were performed in triplicate.

GH-induced internalization of GHR

The COS-7 cells expressing GHR-fl and GHR-277 were incubated in serum-free DMEM; the media were collected 0, 15, 30, and 60 min after the addition of [¹²⁵I]hGH (0.8 µCi/mL), then the cells were washed with cold phosphate-buffered saline and treated at 4 C for 5 min with 0.2 mol/L acetic acid and 0.5 mol/L NaCl, pH 2.5. The radioactivity extracted by this acid-salt solution was considered to be [¹²⁵I]hGH still bound on the cell surface, whereas the radioactivity remaining in the cells after acid-salt washing was considered to be internalized (11). Nonspecific binding was determined in parallel cultures containing more than a 100-fold excess of unlabeled hGH, and the rate of internalization was calculated as the ratio of the percentage of the specific internalized radioactivity to the specific total bound radioactivity.

GH-dependent tyrosine phosphorylation of signal transducer and activator of transcription-5b (STAT5b) in GHR-expressing CHO cells

CHO cells were cotransfected with 3.0 µg expression vectors containing GHR-fl cDNA (pcDNA1/GHR-fl) and increasing amounts of those containing GHR-277 cDNA (pcDNA1/GHR-277; 0, 0.3, 1.5, and 3.0 µg) or were transfected with 3.0 µg pcDNA1/GHR-277 alone. The transfected cells were stimulated by 100 ng/mL hGH for 15 min and lysed. GH-induced tyrosine phosphorylation of STAT5b in the cells coexpressed with both GHR-fl and GHR-277 was determined by Western blotting as described previously (12). Specific antibody for STAT5b (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and antiphosphotyrosine antibody (RC20H, Transduction Laboratories, Inc., Lexington, KY) were used for immunoprecipitation and immunoblotting, respectively. Antibody binding was detected using an enhanced chemiluminescence kit (Amersham Corp., Arlington Heights, IL).

Statistical analysis

Statistical significance between the different values was determined using Student’s t test.

	Results

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Analysis of hGH binding in COS-7 cells expressing either GHR-fl or GHR-277

Scatchard analysis revealed that GHR-277 possessed a slightly higher binding affinity to hGH than GHR-fl. The representative data are shown in Fig. 2. The association constant (K_a) for GHR-fl is 0.49 x 10⁹ mol/L^-1, and that for GHR-277 is 0.61 x 10⁹ mol/L^-1 (Fig. 2). Triplicate experiments revealed that GHR-277 demonstrated 1.5 ± 0.4 times higher binding affinity to hGH than GHR-fl. The binding sites of cells expressing GHR-fl and GHR-277 were 70 ± 15 and 147 ± 26 fmol/10⁶ cells, respectively, indicating that GHR-277-expressing cells possessed approximately twice as many binding sites as GHR-fl-expressing cells.

View larger version (14K): [in this window] [in a new window]   Figure 2. Scatchard plots of [125I]hGH binding to GHR-fl and GHR-277 in COS-7 cells. The representative data showed that GHR-277 demonstrated slightly higher binding affinity (Ka = 0.61 x 109 mol/L-1) to hGH than GHR-fl (Ka = 0.49 x 109 mol/L-1).

Table 2 showed the relative GHBP levels in the culture medium of the COS-7 cells transfected with either pcDNA1/GHR-fl or pcDNA1/GHR-277. The radioactivity was 1079 ± 70 vs. 3299 ± 131 cpm (GHR-fl vs. GHR-277), indicating that the amount of GHBP cleaved from GHR-277-expressing cells was approximately 3 times higher than that from GHR-fl expressing cells.

Critical amino acid residues for internalization of the GHR are located within box 2 in the cytoplasmic domain (9), which is absent in GHR-277. As a result of impaired internalization, a large amount of truncated GHR-277 might be sustained at the cell surface and become the source of GHBP. To clarify this hypothesis, we have examined the time course of ligand-induced internalization of GHR-277 compared with that of GHR-fl. In GHR-fl-expressing COS-7 cells, added [¹²⁵I]hGH was time dependently internalized; the rates of internalized ligand to the total specific binding were 24.4 ± 1.5%, 53.7 ± 0.1%, and 75.6 ± 4.2% at 15, 30, and 60 min after addition, respectively. In contrast, in GHR-277-expressing cells, only 20% of the total specific binding was internalized 15 min after the addition of GH, and this was sustained throughout the study (17.5 ± 2.0%, 14.1 ± 0.5%, and 16.6 ± 1.4% at 15, 30, and 60 min after addition, respectively), as shown in Fig. 3.

View larger version (14K): [in this window] [in a new window]   Figure 3. GH-induced internalization of GHR-fl and GHR-277. The internalization of GHR-277 was markedly reduced compared with that of GHR-fl. The asterisk denotes P < 0.05 vs. corresponding GHR-fl.

GH-induced tyrosine phosphorylation of STAT5b was compared in CHO cells coexpressing GHR-277 and GHR-fl. When increasing amounts of pcDNA1/GHR-277 (from 0.3–3.0 µg) were cotransfected with 3.0 µg pcDNA1/GHR-fl, GH-induced tyrosine phosphorylation of STAT5b was dose dependently inhibited (Fig. 4). When the vectors of both pcDNA1/GHR-fl and pcDNA1/GHR-277 were cotransfected in equal amounts, GH-induced tyrosine phosphorylation of STAT5b was significantly reduced compared with that transfected with pcDNA1/GHR-fl alone, indicating a dominant negative effect of GHR-277 on GH signal transduction.

View larger version (50K): [in this window] [in a new window]   Figure 4. GH-induced tyrosine phosphorylation of STAT5b in CHO cells coexpressing both GHR-fl and GHR-277. Transfected CHO cells were stimulated by 100 ng/mL hGH for 15 min and lysed. Cell lysates were immunoprecipitated with anti-STAT5b antibody and analyzed by Western blotting using antiphosphotyrosine antibody (upper panel). Tyrosine phosphorylation of STAT5b was reduced when the weight of transfected pcDNA1 containing GHR-277 cDNA was increased. In contrast (lower panel), when immunoprecipitated and blotted with anti-STAT5b antibody alone, the amount of STAT5b was equal in each lane, indicating that the difference in tyrosine phosphorylation of STAT5b was not due to the amount of STAT5b. These results showed the dominant negative effect of GHR-277 in GH signal transduction.

	Discussion

Top Abstract Introduction Subjects and Methods Results Discussion References

The clinical features of the patients were similar to those of the patient reported by Woods et al. (4) and Silbergeld et al. (4A ), who showed GH resistance and high serum GHBP levels. In their patient, truncated GHR lacking both transmembrane and intracellular domains is produced by a splice site mutation of exon 8 of the GHR gene and complete deletion of exon 8. This truncated GHR is presumed to be unanchored in the cell membrane and released into the serum as mutated GHBP. In contrast, in our patients, the extracellular and transmembrane domains of GHR-277 are identical to those of wild-type full-length GHR, but the intracellular domain of GHR-277 consists of only seven amino acids, lacking both boxes 1 and 2. One of the clinical characteristics shared by patient reported by Woods et al. and our patients is a high serum GHBP level. The present in vitro studies revealed that GHBP levels in the medium from GHR-277-expressing cells were approximately 3 times higher than those from GHR-fl-expressing cells, in good agreement with clinical findings observed in our patients. Since GHR-277 could be anchored on the cell surface, the mechanism for increased production of GHBP seemed to be different from that in the case reported by Woods et al. (4) and Silbergeld et al. (4A ). Scatchard analysis confirmed that GHR-277 was apparently expressed on the cell surface of COS-7 cells transfected with pcDNA1/GHR-277. There were twice as many GH-binding sites on GHR-277-expressing cells as on GHR-fl-expressing cells, which is consistent with previous reports (15, 16, 17). Furthermore, GHR-277 possessed 1.5 ± 0.4 times greater binding affinity to hGH than GHR-fl. There are conflicting data regarding the binding affinity of truncated GHR to GH. Ross et al. showed that the truncated GHR consisting of 279 amino acids (GHR-279) have about half the binding affinity to hGH as GHR-fl (8), whereas Dastot et al. reported that GHR-279 possesses about 2 times higher affinity than GHR-fl (18). Our data using GHR-277 are consistent with the findings by Dastot et al. Although the reasons why the truncated GHR including GHR-277 showed higher binding affinity than GHR-fl were unclear, the conformational change due to the lack of an intracellular domain might influence binding with the ligand. Increased binding sites in GHR-277-expressing cells might be explained by impaired internalization of GHR-277. The GH-induced internalization of GHR-277 was significantly reduced compared with that of GHR-fl (Fig. 3), probably because GHR-277 lacked critical amino acid residues for ligand-mediated internalization of the GHR (9). As a result of reduced internalization, increased amounts of GHR-277 would be sustained at the cell surface and become the source of soluble GHBP in serum/medium through the proteolytic cleavage of the membrane-anchored GHR. The possibility of an increased number of GHR-277 in the cell membrane was proved by an actual increase in binding sites for the GH ligand in GHR-277-expressing COS-7 cells. Interestingly, despite a 2-fold increase in the number of GH-binding sites on the cell surface of GHR-277-expressing cells, the GHBP levels in culture media were approximately 3 times higher than those in GHR-fl-expressing cells, suggesting the necessity of considering additional factors, such as the change in the turnover rate of GHR, the sensitivity of GHR to enzymatic cleavage, etc.

Another interesting characteristic of our patients was the development of the partial insensitivity to GH despite the heterozygous mutation. In GH signal transduction, the dimerization of GHR causes tyrosyl phosphorylation of both GHR and Janus kinase-2 (JAK2) (19), in the process of which the box 1 motif of GHR is required for association with JAK2 (20). As the mutations of GHR in our patients were heterozygous, three different types of GHR dimerization are theoretically proposed: namely, the homodimers of two GHR-fl, the heterodimers of GHR-fl and GHR-277, and the homodimers of two GHR-277. It was recently demonstrated that GHR-277 could form the heterodimer with GHR-fl (7). The homodimers of two GHR-fl could transduce the GH signal. However, as GHR-277 lacks box 1 motif, the homodimers of two GHR-277 and probably the heterodimers of GHR-277 and GHR-fl could not transduce the GH signal. As demonstrated in this study, the number of GHR-277 receptors at the cell surface and the binding affinity of GHR-277 to GH were both greater than those of GHR-fl. Therefore, GHR-277 would bind many more GH molecules than GHR-fl even if equal amounts of receptor proteins are produced from each allele of the GHR gene. In consequence, normal GH signaling would attenuate when GHR-277 and GHR-fl are coexpressed, indicating the new type of mechanism exerting a dominant negative action. The dominant negative effect of GHR-277 on GH signal transduction was clearly verified in in vitro experiments showing that tyrosine phosphorylation of STAT5b was obviously reduced when the same amounts of cDNAs of GHR-277 and GHR-fl were cotransfected.

It is of interest that GHR-279 and GHR-277 are both physiologically produced isoforms of GHR by alternative splicing of the common transcript of GHR gene (8, 18). GHR-279 possesses not only an increased capability to produce GHBP, but also shows impaired internalization and down-regulation (21). These truncated isoforms of GHR may play a role as a negative regulator of GH signal transduction and a source of GHBP production in the tissues or cells expressing the truncated GHR isoforms. However, the physiological significance of these truncated GHR isoforms remains unclear, as there are little data regarding regional distribution and amounts of the truncated GHR in normal tissues.

In conclusion, we have characterized the function of GHR-277 in vitro that was generated in a family with partial GH insensitivity and high serum GHBP levels. The biological characteristics of GHR-277 in vitro could well explain the clinical features of the patients.

	Acknowledgments

	Footnotes

 
¹ This work was supported in part by Grants-in-Aid for Scientific Research 06807082, 07671138, and 09470221 from the Japanese Ministry of Education, Science, Sports, and Culture and grants from the Japanese Ministry of Health and Welfare, Novo Nordisk A/S Growth, and Growth Science Foundation, 1996 and 1997.

Received August 14, 1998.

Revised November 24, 1998.

Accepted December 11, 1998.

	References

Top Abstract Introduction Subjects and Methods Results Discussion References

 

1. Laron Z, Pertzelan A, Mannheimer S. 1966 Genetic pituitary dwarfism with high serum concentration of growth hormone–a new inborn error of metabolism? Isr J Med Sci. 2:152–155.[Medline]
2. Rosenbloom AL, Rosenfeld RG, Guevara-Aguirre J. 1997 Growth hormone insensitivity. Pediatr Clin North Am. 44:423–442.[CrossRef][Medline]
3. Duquesnoy P, Sobrier M-L, Duriez B, et al. 1994 A single amino acid substitution in the exoplasmic domain of the human growth hormone (GH) receptor confers familial GH resistance (Laron syndrome) with positive GH-binding activity by abolishing receptor homodimerization. EMBO J. 13:1386–1395.[Medline]
4. Woods KA, Fraser NC, Postel-Vinay M-C, Savage MO, Clark AJL. 1996 A homozygous splice site mutation affecting the intracellular domain of the growth hormone (GH) receptor resulting in Laron syndrome with elevated GH-binding protein. J Clin Endocrinol Metab. 81:1686–1690.[Abstract]
4. Silbergeld A, Dastot F, Klinger B, et al. 1997 Intronic mutation in the growth hormone (GH) receptor gene from a girl with Laron syndrome and extremely high serum GH binding protein: extended phenotypic study in a very large pedigree. J Pediatr Endocrinol Metab. 10:265–274.
5. Goddard AD, Covello R, Luoh S, et al. 1995 Mutations of the growth hormone receptor in children with idiopathic short stature. N Engl J Med. 333:1093–1098.[Abstract/Free Full Text]
6. Iida K, Takahashi Y, Kaji H, et al. 1998 Growth hormone (GH) insensitivity syndrome with high serum GH-binding protein levels caused by a heterozygous splice site mutation of the GH receptor gene producing a lack of intracellular domain. J Clin Endocrinol Metab. 83:531–537.[Abstract/Free Full Text]
7. Ayling RM, Ross R, Towner P, et al. 1997 A dominant-negative mutation of the growth hormone receptor causes familial short stature. Nat Genet. 16:13–14.[CrossRef][Medline]
8. Ross RJM, Esposito N, Shen XY, et al. 1997 A short isoform of the human growth hormone receptor functions as a dominant negative inhibitor of the full-length receptor and generates large amounts of binding protein. Mol Endocrinol. 11:265–273.[Abstract/Free Full Text]
9. Allevato G, Billestrup N, Goujin L, et al. 1995 Identification of phenylalanine 346 in the rat growth hormone receptor as being critical for ligand-mediated internalization and down-regulation. J Biol Chem. 270:17210–17214.[Abstract/Free Full Text]
10. Wang Y, Wood WI. 1995 Amino acids of the human growth hormone receptor that are required for proliferation and Jak-STAT signaling. Mol Endocrinol. 9:303–311.[Abstract/Free Full Text]
11. Kaji H, Casnellie JE, Hinkle PM. 1988 Thyrotropin releasing hormone action in pituitary cells. J Biol Chem. 263:13588–13593.[Abstract/Free Full Text]
12. Takahashi Y, Shirono H, Arisaka O, et al. 1997 Biologically inactive growth hormone caused by an amino acid substitution. J Clin Invest. 100:1159–1165.[Medline]
13. Deleted in proof.
14. Deleted in proof.
15. Colosi P, Wong K, Leong SR, Wood WI. 1993 Mutational analysis of the intracellular domain of the human growth hormone receptor. J Biol Chem. 268:12617–12623.[Abstract/Free Full Text]
16. Sotiropoulos A, Perrot-Applanat M, Dinerstein H, et al. 1994 Distinct cytoplasmic regions of the growth hormone receptor are required for activation of JAK2, mitogen-activated protein kinase, and transcription. Endocrinology. 135:1292–1298.[Abstract]
17. Wang X, Souza SC, Kelder B, Cioffi JA, Kopchick JJ. 1995 A 40-amino acid segment of the growth hormone receptor cytoplasmic domain is essential for GH-induced tyrosine phosphorylated cytosolic proteins. J Biol Chem. 270:6261–6266.[Abstract/Free Full Text]
18. Dastot F, Sobrier ML, Duquesnoy P, Duriez B, Goossens M, Amselem S. 1996 Alternative spliced forms in the cytoplasmic domain of the human growth hormone (GH) receptor regulate its ability to generate a soluble GH-binding protein. Proc Natl Acad Sci USA. 93:10723–10728.[Abstract/Free Full Text]
19. Argetsinger LS, Campbell GS, Yang X, et al. 1993 Identification of JAK2 as a growth hormone receptor-associated tyrosine kinase. Cell. 74:237–244.[CrossRef][Medline]
20. Tanner JW, Chen W, Young RL, Longmore GD, Shaw AS. 1995 The conserved box 1 motif of cytokine receptors is required for association with JAK kinases. J Biol Chem. 270:6523–6530.[Abstract/Free Full Text]
21. Amit T, Bergman T, Dastot F, Youdim MBH, Amselem S, Hochberg Z. 1997 A membrane-fixed, truncated isoform of the human growth hormone receptor. J Clin Endocrinol Metab. 82:3813–3817.[Abstract/Free Full Text]

This article has been cited by other articles:

				G. Kenth, J. A M. Mergelas, and C. G. Goodyer Developmental changes in the human GH receptor and its signal transduction pathways J. Endocrinol., July 1, 2008; 198(1): 71 - 82. [Abstract] [Full Text] [PDF]

				V. Hwa, B. Little, P. Adiyaman, E. M. Kofoed, K. L. Pratt, G. Ocal, M. Berberoglu, and R. G. Rosenfeld Severe Growth Hormone Insensitivity Resulting from Total Absence of Signal Transducer and Activator of Transcription 5b J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4260 - 4266. [Abstract] [Full Text] [PDF]

				P. E Mullis Genetic control of growth Eur. J. Endocrinol., January 1, 2005; 152(1): 11 - 31. [Abstract] [Full Text] [PDF]

				K. Iida, J. P. del Rincon, D.-S. Kim, E. Itoh, K. T. Coschigano, J. J. Kopchick, and M. O. Thorner Regulation of full-length and truncated growth hormone (GH) receptor by GH in tissues of lit/lit or bovine GH transgenic mice Am J Physiol Endocrinol Metab, September 1, 2004; 287(3): E566 - E573. [Abstract] [Full Text] [PDF]

				E. M. Kofoed, V. Hwa, B. Little, K. A. Woods, C. K. Buckway, J. Tsubaki, K. L. Pratt, L. Bezrodnik, H. Jasper, A. Tepper, et al. Growth Hormone Insensitivity Associated with a STAT5b Mutation N. Engl. J. Med., September 18, 2003; 349(12): 1139 - 1147. [Full Text] [PDF]

				P. van Kerkhof, M. Smeets, and G. J. Strous The Ubiquitin-Proteasome Pathway Regulates the Availability of the GH Receptor Endocrinology, April 1, 2002; 143(4): 1243 - 1252. [Abstract] [Full Text] [PDF]

				C. K. Buckway, J. Guevara-Aguirre, K. L. Pratt, C. P. Burren, and R. G. Rosenfeld The IGF-I Generation Test Revisited: A Marker of GH Sensitivity J. Clin. Endocrinol. Metab., November 1, 2001; 86(11): 5176 - 5183. [Abstract] [Full Text] [PDF]

				M. Sjoberg, T. Salazar, C. Espinosa, A. Dagnino, A. Avila, M. Eggers, F. Cassorla, P. Carvallo, and M. V. Mericq Study of GH Sensitivity in Chilean Patients with Idiopathic Short Stature J. Clin. Endocrinol. Metab., September 1, 2001; 86(9): 4375 - 4381. [Abstract] [Full Text] [PDF]

				M. Salerno, B. Balestrieri, E. Matrecano, A. Officioso, R. G. Rosenfeld, S. Di Maio, G. Fimiani, M. V. Ursini, and C. Pignata Abnormal GH Receptor Signaling in Children with Idiopathic Short Stature J. Clin. Endocrinol. Metab., August 1, 2001; 86(8): 3882 - 3888. [Abstract] [Full Text] [PDF]

				K. Iida, Y. Takahashi, H. Kaji, N. Onodera, M. O. Takahashi, Y. Okimura, H. Abe, and K. Chihara The C422F Mutation of the Growth Hormone Receptor Gene Is Not Responsible for Short Stature J. Clin. Endocrinol. Metab., November 1, 1999; 84(11): 4214 - 4219. [Abstract] [Full Text]

				R. BJARNASON and M. O SAVAGE Growth hormone insensitivity: a widening diagnosis Arch. Dis. Child., November 1, 1999; 81(5): 378 - 379. [Full Text]

This Article Abstract Full Text (PDF) Submit a related Letter to the Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Iida, K. Articles by Chihara, K. Search for Related Content PubMed PubMed Citation Articles by Iida, K. Articles by Chihara, K.