help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kauma, S. W.
Right arrow Articles by Walsh, S. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kauma, S. W.
Right arrow Articles by Walsh, S. W.
The Journal of Clinical Endocrinology & Metabolism Vol. 84, No. 11 4092-4096
Copyright © 1999 by The Endocrine Society


Original Studies

Hepatocyte Growth Factor Stimulates Trophoblast Invasion: A Potential Mechanism for Abnormal Placentation in Preeclampsia1

Scott W. Kauma, Vicki Bae-Jump and Scott W. Walsh

Departments of Obstetrics/Gynecology (S.W.K., V.B.-J., S.W.W.), Microbiology/Immunology (S.W.K.), and Physiology (S.W.W.), Virginia Commonwealth University/Medical College of Virginia, Richmond, Virginia 23298

Address all correspondence and requests for reprints to: Dr. Scott Kauma, Department of Obstetrics/Gynecology and Microbiology/Immunology, Virginia Commonwealth University/Medical College of Virginia, Box 980034, Richmond, Virginia 23298.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Hepatocyte growth factor (HGF) is a cytokine that is produced in the placental villous core and acts in a paracrine manner on trophoblasts that express the HGF receptor Met. Because HGF stimulates the invasion of many epithelial cell types, villous core HGF could regulate placental trophoblast invasion. As preeclampsia is characterized by inadequate trophoblast invasion, we investigated the hypothesis that decreased placental HGF production is a mechanism for inadequate trophoblast invasion in this disease. Placental villous explant HGF production over 24 h was 25% lower in patients with preeclampsia (n = 5; 7.29 ± 0.8 ng/mL) than in normal patients (n = 5; 9.76 ± 0.5 ng/mL; P < 0.05). The human first trimester trophoblast cell line (ED27) used in subsequent invasion studies was found to express c-met messenger ribonucleic acid by RT-PCR and Met protein by Western analysis, and underwent phosphorylation of tyrosine residues on Met with HGF exposure. A Boyden chamber invasion assay using collagen type I showed that HGF caused a specific dose-response increase in trophoblast invasion first seen at 10 ng/mL (2.2-fold increase; P < 0.05). The stimulation of trophoblast invasion by HGF may in part be due to the 2-fold induction of 92-kDa collagenase as determined by zymogram analysis of the trophoblast-conditioned medium. These studies suggest that HGF has an important role in placental trophoblast invasion through the activation of Met and the subsequent induction of 92-kDa collagenase in these cells. In addition, decreased placental production of HGF in preeclampsia provides a potential mechanism for the lack of trophoblast invasion that is seen in this pregnancy disorder.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PREECLAMPSIA is a significant health problem of pregnancy, affecting approximately 7–10% of women and resulting in significant maternal and fetal morbidity and mortality. The etiology of preeclampsia is poorly understood; however, one characteristic of this disease is a lack of trophoblast invasion into the maternal decidual arteries (1). This decrease in arterial trophoblast invasion is thought to result in placental hypoxemia with subsequent production of placental factors that lead to the development of preeclampsia (2). Although the mechanism for decreased trophoblast invasion in preeclampsia is unknown, abnormal trophoblast integrin expression, insulin-like growth factors, and hypoxia have all been implicated in this process (3, 4). In addition, a number of other cytokines, including transforming growth facot-ß, epidermal growth factor, and interleukin-1, have been shown to regulate trophoblast invasion in vitro (5, 6, 7). Another cytokine that may have potential to affect trophoblast invasion is hepatocyte growth factor (HGF).

HGF is a pleiotropic cytokine that was first characterized by its ability to promote the proliferation of hepatocytes in vitro (8). Subsequently, HGF was found to play a role in cell migration, proliferation, and morphogenesis in a number of different cell types and tissues (9). The receptor for HGF is a tyrosine kinase receptor and is the product of the c-met protooncogene (10). HGF is mainly produced by fibroblasts and other mesenchymal cell types (9). The HGF receptor, Met, is primarily found in endothelial and epithelial cell types. HGF/Met interaction provides a classical example for mesenchymal cell paracrine regulation of epithelial cell function (11). A potential role for HGF during pregnancy was first suggested in studies demonstrating high levels of HGF messenger ribonucleic acid (mRNA) expression and extractable HGF protein in human placentas (12). In addition, HGF knockout mutations in mice are lethal to the embryo due to abnormal placental development (13). Studies in our laboratory have shown that villous core mesenchymal cells produce HGF, whereas trophoblast express Met (14).

As HGF is known to stimulate the migration and invasion of a number of epithelial cell types, we hypothesized that placental villous core mesenchymal cell production of HGF may regulate trophoblast invasion. Consequently, this study was designed to test the hypothesis that decreased placental HGF production is a potential mechanism for shallow trophoblast invasion in preeclampsia.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Culture of placental villous explants

Placentas were obtained immediately after delivery from normal (n = 5) and preeclamptic (n = 5) pregnancies (35–40 weeks gestation). Preeclampsia was defined as maternal blood pressure of more than 140/90 mm Hg with proteinuria (>300 mg/24 h or +2 on single urine sample) and edema. Placental villous explants were cultured as previously described (14). Immediately after obtaining the placenta, placental villi were dissected free from the decidua basalis, minced into small pieces, and rinsed free of blood. The placental villi (350 mg wet weight) were cultured in duplicate in 5 mL DMEM with 10 mmol L-glutamine, 100 mIU/mL penicillin, and 100 mg/mL streptomycin, pH 7.4 (Sigma Chemical Co., St. Louis, MO) for 24 h, and the medium was stored at -20 C until assayed for HGF.

Enzyme-linked immunosorbant assay (ELISA) for HGF

HGF in placental villous explant-conditioned medium was quantified by a sandwich ELISA for human HGF as previously described (14). Polystyrene 96-well plates (Costar, Cambridge, MA) were coated with mouse monoclonal antibody to human HGF (R&D Systems, Minneapolis, MN) at a concentration of 2 µg/mL in 0.2 mol/L Na2CO3 buffer, pH 9.6, for 24 h at 4 C. The plates were washed with phosphate-buffered saline with 0.05% Tween-20 (PBST) and blocked with 1% BSA in 0.2 mol/L Na2CO3 buffer, pH 9.6, for 1 h at 37C. After washing the plates with PBST, 100 µL of the conditioned medium samples or human recombinant HGF standard (R&D Systems) in triplicate were added to the plates and incubated at 4 C overnight. The plates were then washed with PBST and incubated with 100 µL goat anti-HGF antibody (R&D Systems) at a concentration of 2 µg/mL in PBST for 2 h at room temperature. The plates were washed with PBST and then incubated with 100 µL of a 1:15,000 dilution of peroxidase-conjugated mouse antigoat IgG (Pierce Chemical Co., Rockford, IL) for 1 h at room temperature. The wells were washed with PBST and developed with a 0.1% O-phenylenediamine dihydrochloride substrate (Sigma Chemical Co.) in 0.1 mol/L citric acid buffer, pH 4.5, with 0.005% H2O2 for 20 min at room temperature. The reaction was stopped by the addition of an equal volume of 2 mol/L H2SO4, and the plates were read at 490 mm in a V-max Kinetic Microplate Reader (Molecular Devices, Palo Alto, CA). The assay sensitivity and range were 240 pg/mL to 60 ng/mL. To validate the assay, samples that were either serially diluted or to which known amounts of the HGF standard were added were compared to the standard curve to demonstrate appropriate parallelism. The within-assay coefficient of variation was 4% at 20 ng/mL, 7% at 4 ng/mL, and 15% at 0.8 ng/mL. All sample comparisons were run in the same assay to eliminate between assay variability.

ED27 trophoblast cells

The ED27 trophoblast cell line used in these studies was derived from a prenatal diagnostic first trimester chorionic villous sample. The pregnancy resulted in a normal male infant. This cell line produces estradiol and progesterone, expresses placental alkaline phosphatase, produces low amounts of hCG, is positive for cytokeratin type 8, and is negative for vimentin (15).

RT-PCR for Met

RT-PCR was performed by isolating total RNA from the human first trimester trophoblast cell line, ED27, using the acid guanidinium isothiocyanate-phenol-chloroform extraction method. First strand synthesis was performed on 1 µg total RNA using specific human Met 3'-primers and SuperScript II ribonuclease HG reverse transcriptase (Life Technologies, Inc., Gaithersburg, MD). Yeast RNA (Sigma Chemical Co.) was used as a negative control. The complementary DNA was amplified using the GeneAmp system of DNA amplification (Perkin Elmer Corp./Cetus, Norwalk, CT). Samples were incubated in a thermocycler (M. J. Research, Inc., Watertown, MA) for 30 cycles after the addition of the 5'-primers and Taq polymerase. Denaturing was carried out at 94 C for 1 min, followed by primer annealing at 58 C (Met) for 1 min and primer extension at 72 C for 2 min. The PCR products were then separated by size in a 1.5% agarose gel by electrophoresis and stained with ethidium bromide.

The primers were synthesized in the Nucleic Acid Core Facility at Virginia Commonwealth University using a PE Applied Biosystems 380 A DNA synthesizer (Foster City, CA). The sequences of the Met primers were 5'-226 tcctcgtgctcctgtttacc 245 and 3'-865 tctttcgtttcctttagccttc 844.

Western immunoblotting for Met

The ED27 cell line was homogenized in RIPA buffer (5 mmol/L Tris, 150 mmol/L NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 0.1 mmol/L ethylenediamine tetraacetate, 0.1 mmol/L phenyl-methylsulfonylfluoride, and 2 µg/mL aprotinin, pH 7.5). The homogenate was clarified by centrifugation, and the protein concentration of the supernatant was determined in a Coomassie protein assay using albumin as the standard (Pierce Chemical Co.). The soluble protein extract (10 µg) was electrophoresed through a denaturing 7.5% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane. The membrane was blocked with 5% nonfat dry milk in TBST (100 mmol/L Tris, 0.9% NaCl, and 0.05% Tween-20, pH 7.4) for 1 h. The membrane was then incubated for 1 h with 2 µg/mL rabbit IgG antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) developed against a synthetic Met peptide. Development of the Western blots was performed using the Amersham Pharmacia Biotech ECL system (Amersham Pharmacia Biotech, Arlington Heights, IL).

Immunoprecipitation/Western immunoblotting of Met for phosphorylation of tyrosines

ED27 cells were grown in DMEM-Ham’s F-12 with 10% FBS until semiconfluent. The medium was replaced with serum-free DMEM-Ham’s F-12 and cultured for 24 h. ED27 cells were then exposed to HGF (50 ng/mL) for either 15 or 30 min. The cells were lysed in RIPA buffer with the addition of NaVO4 at 1 mmol/L. The homogenate was clarified by centrifugation, and the protein concentration of the supernatant was determined in a Coomassie protein assay using albumin as the standard (Pierce Chemical Co.).

For immunoprecipitation of Met, 100 µg total cellular protein was incubated with 1 µg anti-Met rabbit polyclonal antibody (Santa Cruz Biotechnology, Inc.) overnight at 4 C, followed by the addition of protein G-agarose (Sigma Chemical Co.) for 2 h at 4 C. The immunoprecipitated receptor/protein G-agarose complexes were then washed extensively with RIPA buffer and boiled for 2 min in denaturing loading buffer. The protein samples were electrophoresed through a denaturing 7.5% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane. The membrane was blocked with 1% BSA in TBST for 1 h. The membrane was then incubated overnight at 4 C with 2 µg/mL horseradish peroxidase-conjugated RC20 monoclonal antiphosphotyrosine antibody (Transduction Laboratories, Lexington, KY). Development of the Western blots was performed using the Amersham Pharmacia Biotech ECL system. Control for specificity of the Western blots included substituting the specific Met antibody with nonspecific IgG at the same concentration.

ED27 invasion assay

The Boyden chamber invasion assay was performed by coating porous membrane (8-mm) culture well inserts with 25 µg rat tail collagen type 1 (Collaborative Biomedical Products, Bedford, MA). The ED27 cells (105 cells/well) were then added on top of the collagen-coated membrane insert and incubated in DMEM-Ham’s F-12 medium with 10% FBS for 72 h with the addition of 0, 0.1, 1.0, 10, or 100 ng/mL of HGF (n = 4 wells/dose). The inserts were fixed and stained with crystal violet in methanol. The side of the membrane insert with the collagen coating and noninvading ED27 cells was gently scraped away with a cotton swab, and the opposite side of the membrane was examined to determine cell invasion. This assay was quantified by counting the number of ED27 cells that had invaded the collagen-coated membranes. To demonstrate the specificity of the HGF-induced invasion, the invasion assay was also performed with or without the addition of neutralizing antibody to HGF (R&D Systems) at a concentration of 20 µg/mL in the presence of 10 ng/mL HGF. One-way ANOVA was used to analyze the Boyden chamber invasion assays.

Zymography for 92-kDa collagenase

Confluent ED27 cells were cultured in 35-mm2 dishes for 48 h in 5 mL serum-free DMEM-Ham’s F-12 with the addition of either 0 or 10 ng/mL HGF. The conditioned medium was then collected and concentrated 20-fold using Centricon concentrators (Amicon, Beverly, MA). Nonreducing 10% polyacrylamide gels supplemented with 1% gelatin were used to determine the proteolytic activity of the conditioned medium. After electrophoresis, the gels were washed in renaturing buffer (2.5% Triton X-100) and once in developing buffer (10 mmol/L Tris base, 40 mmol/L Tris-HCl, 20 mmol/L NaCl, 5 mmol/L CaCl2, and 0.02% 23 BRIJ35; Novex, San Diego, CA). Gels were incubated in fresh developing buffer overnight at 37 C. Gels were stained in 0.05% Coomassie blue with 30% methanol and 10% glacial acetic acid for 3 h and then destained in 30% methanol and 10% glacial acetic acid as needed. Prestained molecular mass standards (Bio-Rad Laboratories, Inc., Hercules, CA) were used to determine the molecular mass of proteolytic activity.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Our initial experiments found significant differences in the production and secretion of HGF by normal and preeclamptic placentas (Fig. 1Go). The secretion of HGF into the culture medium by placental villous explants over 24 h was 25% less in placentas from preeclamptic pregnancies (7.29 ± 0.8 ng/mL) compared to that in placentas from normal pregnancies (9.76 ± 0.5 ng/mL; P < 0.05).



View larger version (14K):
[in this window]
[in a new window]
 
Figure 1. Placental villous explants were cultured for 24 h in serum-free DMEM, and the medium was assayed for HGF by ELISA. Placental HGF production was 25% lower (*, P < 0.05) in patients with preeclampsia (PE) compared to that in normal patients (NL).

 
To determine the potential role of HGF/Met in trophoblast invasion, we characterized the first trimester human trophoblast cell line ED27 for Met expression. As shown in Fig. 2Go, ED27 cells express c-met RNA similarly to freshly isolated first trimester trophoblast cells, as demonstrated by the appropriate size 639-bp band. Similar to isolated trophoblast, ED27 cells show no evidence of HGF mRNA expression by RT-PCR (data not shown). Western blot analysis for Met protein demonstrated that the appropriate size 140-kDa band was expressed in ED27 cells (Fig. 3Go). Finally, the addition of HGF to the ED27 cells resulted in the phosphorylation of tyrosine residues on Met within 15 min of the addition of HGF, whereas no evidence of phosphorylation was seen without the presence of HGF (Fig. 4Go). These findings show that ED27 cells produce and express a functional Met receptor for HGF.



View larger version (59K):
[in this window]
[in a new window]
 
Figure 2. RT-PCR analysis for Met expression in ED27 trophoblast. ED27 trophoblast expressed the appropriate size 639-bp mRNA band for Met. Trophoblasts isolated from first trimester placental villi were used as a positive control, and yeast RNA served as a negative control.

 


View larger version (33K):
[in this window]
[in a new window]
 
Figure 3. Western blot analysis for Met expression in ED27 trophoblasts. The ED27 trophoblast expressed the 140-kDa Met protein similar to isolated villous trophoblast. The control for antibody specificity included substituting the specific Met antibody (anti-Met) with a nonspecific antibody (Control) at the same concentration.

 


View larger version (33K):
[in this window]
[in a new window]
 
Figure 4. Met activation by HGF in ED27 trophoblasts. ED27 trophoblasts were treated with 50 ng/mL HGF for 30 min (A), 50 ng/mL HGF for 15 min (B), or no HGF (C). Met was immunoprecipitated from cell lysates, and Western blot analysis was performed for phosphotyrosine. As shown, treatment of the ED27 trophoblast with HGF was required for the phosphorylation of tyrosine residues on Met.

 
To evaluate the role of Met activation by HGF in trophoblast invasion, Boyden chamber invasion assays were performed. As shown in Fig. 5Go, HGF caused a specific dose-response increase in ED27 cell invasion. This stimulatory effect on invasion was first seen at 10 ng/mL HGF (P < 0.01) and was approximately 3.5-fold higher at 100 ng/mL HGF. The stimulation of trophoblast invasion was readily apparent upon microscopic visual examination of the bottom side of the Boyden chamber membrane (Fig. 6Go). The specificity of HGF action on trophoblast invasion was further demonstrated by the complete inhibition of HGF-stimulated trophoblast invasion by HGF neutralizing antibody (Figs. 6Go and 7).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 5. Effect of HGF on the invasive capacity of the ED27 trophoblast cell line as determined by the Boyden’s chamber technique. Invasion of the ED27 trophoblast was stimulated by the addition of HGF in a dose-dependent fashion. Results are presented as the mean number of cells (±SEM) from three separate experiments (*, P < 0.05).

 


View larger version (87K):
[in this window]
[in a new window]
 
Figure 6. Microscopic morphology of the ED27 trophoblast after invasion through the collagen-coated membranes in the presence of ED27 trophoblast incubated in the presence of 10 ng/mL HGF (A), ED27 trophoblast incubated in the absence of HGF (B), or ED27 trophoblast incubated in the presence of 10 ng/mL HGF with the addition of a neutralizing antibody to HGF (C).

 
To determine whether increased collagenase production is a mechanism of HGF stimulation of ED27 trophoblast invasion, zymogram analysis of ED27 cell-conditioned medium was performed. Conditioned medium from ED27 cells treated with 10 ng/mL HGF showed a 2-fold increase in 92-kDa collagenase compared to untreated control cells (Fig. 8Go). No evidence of collagenases of other molecular sizes were detected in these studies. These experiments were repeated three times with similar results.



View larger version (53K):
[in this window]
[in a new window]
 
Figure 8. Zymogram analysis of ED27 trophoblast-conditioned medium after culture for 48 h in either the presence or absence of 10 ng/mL HGF. Dilutions of the conditioned medium (either 1:2 or 1:4) were electrophoresed through a nonreducing 10% polyacrylamide gel supplemented with 1% gelatin. Proteolytic activity was noted for the 92-kDa collagenase. The addition of HGF resulted in a 2-fold induction of the 92-kDa collagenase.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The findings from this study demonstrate for the first time that HGF stimulates the invasion of trophoblast through the activation of Met present on these cells. HGF was found to increase the expression of 92-kDa collagenase by these trophoblast cells and provide a mechanism by which HGF may enhance trophoblast invasion. ED27 trophoblast cells were used as a model for trophoblast invasion in these studies, because these cells express Met and produce 92-kDa collagenase, similarly to freshly isolated first trimester villous trophoblast. Although abnormalities in trophoblast invasion in preeclampsia may not occur until after the first trimester, trophoblasts from all gestational ages express Met and collagenase similar to ED27 trophoblasts (14, 16). The stimulation of trophoblast invasion and induction of collagenase production by HGF is consistent with the action of HGF in several different epithelial carcinomas (17, 18). HGF is also known as "scatter factor" for its ability to induce motility of epithelial cells in culture (2). Although the ability of HGF to induce motility in trophoblast cells was not directly tested in this study, it is possible that trophoblast invasion may have been enhanced by the stimulation of trophoblast motility.

HGF may play an important role in placental trophoblast invasion through the activation of Met and the subsequent induction of 92-kDa collagenase in these cells. The 2-fold induction of 92-kDa collagenase in ED27 trophoblast by HGF is comparable to IL-1 which stimulates a 3-fold induction of 92-kDa collagenase in isolated villous trophoblast (19). Our laboratory and others have previously shown that the major site of placental HGF production is the villous core, specifically villous core mesenchymal cells (14, 20). In placental villi, the HGF receptor Met, is expressed mainly in cytotrophoblast. These findings in addition to studies showing the stimulation of trophoblast proliferation in response to HGF has suggested an important role for villous core HGF in the regulation of trophoblast proliferation (21). However, our laboratory has also shown that Met is localized to invasive trophoblast at the site of anchoring villi (22). As the current study shows that HGF stimulates trophoblast invasion in vitro, HGF produced and secreted by the villous core may play a role in the regulation of trophoblast invasion in vivo. This hypothesis of a villous core paracrine factor regulating trophoblast invasion helps explain why the majority of trophoblasts do not invade a great distance from the placenta into the uterus during normal pregnancy. As trophoblasts migrate further away from the villous core, there would be lower concentrations of villous core HGF present to stimulate trophoblast invasion.

One of the pathological findings associated with preeclampsia is the presence of shallow trophoblast invasion. This study demonstrated decreased placental production and secretion of HGF in placental villi from pregnancies complicated by preeclampsia. These findings are consistent with a previous study that showed decreased HGF mRNA expression and tissue-extractable HGF protein in placentas from women with preeclampsia (20). It is possible that the adverse effects of preeclampsia result in the decreased expression of placental HGF and are not a cause of preeclampsia. However, as the current study has shown that HGF stimulates trophoblast invasion, these findings suggest the possibility that decreased placental HGF production in pregnancies complicated by preeclampsia may be a potential mechanism for the shallow trophoblast invasion seen in this pregnancy disorder.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 7. A, In the presence of 10 ng/mL HGF, 2.4 times as many ED27 trophoblasts were able to invade the collagen-coated membranes compared to cells not treated with HGF (*, P < 0.001). B, The addition of a neutralizing antibody to HGF completely inhibited stimulation of ED27 trophoblast invasion by 10 ng/mL HGF (*, P < 0.001).

 

    Footnotes
 
1 This work was supported by a grant from the NIH/NICHHD (HD-35640, to S.W.K.). Back

Received April 30, 1999.

Revised June 22, 1999.

Accepted July 21, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Genbacev O, Joslin R, Damsky CH, Polliotti BM, Fisher SJ. 1996 Hypoxia alters early gestation human cytotrophoblast differentiation/invasion in vitro and models the placental defects that occur in preeclampsia. J Clin Invest. 97:540–550.[Medline]
  2. Beyno DF, Miles TM, Conrad KP. 1997 Hypoxia stimulates cytokine production by villous explants from the human placenta. J Clin Endocrinol Metab. 82:1582–1588.[Abstract/Free Full Text]
  3. Damsky CH, Fitzgerald ML, Fisher SJ. 1992 Distribution patterns of extracellular matrix components and adhesion receptors are intricately modulated during first trimester cytotrophoblast differentiation along the invasive pathway, in vivo. J Clin Invest. 89:210–222.
  4. Giudice LC, Martina NA, Crystal RA, Tazuke S, Druzin M. 1997 Insulin-like growth factor binding protein-1 at the maternal-fetal interface and insulin-like growth factor-I, insulin-like growth factor-II, and insulin-like growth factor binding protein-1 in the circulation of women with severe preeclampsia. Am J Obstet Gynecol. 176:751–757.[CrossRef][Medline]
  5. Graham CH, Lala PK. 1991 Mechanism of control of trophoblast invasion in situ. J Cell Physiol. 148:228–234.[CrossRef][Medline]
  6. Bass KE, Morrish D, Roth I, Bhardwaj D, Taylor R, Zhou Y, Fisher SJ. 1994 Human cytotrophoblast invasion is up-regulated by epidermal growth factor: evidence that paracrine factors modify this process. Dev Biol. 164:550–561.[CrossRef][Medline]
  7. Librach CL, Feigenbaum SL, Bass KE, et al. 1994 Interleukin-1ß regulates human cytotrophoblast metalloproteinase activity and invasion in vitro. J Biol Chem. 269:17125–17131.[Abstract/Free Full Text]
  8. Michalopoulos G, Houck KA, Dolan ML, Dolan ML. 1984 Control of hepatocyte replication by two serum factors. Cancer Res. 44:4414–4419.[Abstract/Free Full Text]
  9. Rubin JS, Donald P, Aaronson SA. 1993 Hepatocyte growth factor/scatter factor and its receptor, the c-met proto-oncogene product. Biochim Biophys Acta. 1155:357–371.[Medline]
  10. Morag P, Michael D, Karen K, Braun MJ, Gonda MA, Vande Woude G. 1987 Sequence of met protooncogene cDNA has features characteristic of the tyrosine kinase family of growth-factor receptors. Proc Natl Acad Sci USA. 84:6379–6383.[Abstract/Free Full Text]
  11. Tsarfaty I, Resau RH, Rulong S, Keydar I, Faletto D, Vande Woude G. 1992 The met proto-oncogene receptor and lumen formation. Science. 257:1258–1261.[Abstract/Free Full Text]
  12. Wolf HK, Zarnegar R, Oliver L, Michalopoulos GK. 1991 Hepatocyte growth factor in human placenta and trophoblastic disease. Am J Pathol. 138:1035–1043.[Abstract]
  13. Uehara Y, Minowa O, Mori C, et al. 1995 Placental defect and embryonic lethality in mice lacking hepatocyte growth factor/scatter factor. Nature. 373:702–705.[CrossRef][Medline]
  14. Kauma S, Hayes N, Weatherford S. 1997 The differential expression of hepatocyte growth factor and Met in human placenta. J Clin Endocrinol Metab. 82;949–954.
  15. Kniss D, Shubert P, Zimmerman P, et al. 1994 Insulin-like growth factors: their regulation of glucose and amino acid transport in placental trophoblasts isolated from first-trimester chorionic villi. J Reprod Med. 39:249.[Medline]
  16. Huppertz B, Kertschanska S, Demir AY, Frank HG, Kaufmann P. 1998 Immunohistochemistry of matrix metalloproteinases (MMP), their substrates, and their inhibitors (TIMP) during trophoblast invasion in the human placenta. Cell Tissue Res. 291:133–148.[Medline]
  17. Rusciano D, Lin S, Lorenzoni P, Casella N, Burger MM. 1998 Influence of hepatocyte growth factor/scatter factor on the metastatic phenotype of B16 melanoma cells. Tumour Biol19 :335–345.
  18. Uchiyama A, Essner R, Doi F, et al. 1996 Interleukin 4 inhibits hepatocyte growth factor-induced invasion and migration of colon carcinomas. J Cell Biochem. 62:443–453.[CrossRef][Medline]
  19. Shimonovitz S, Hurwitz A, Barak V, Dushnik M, Adashi EY, Anteby E, Yagel S. 1996 Cytokine-mediated regulation of type IV collagenase expression, and production in human trophoblast cells. J Clin Endocrinol Metab. 81:3091–6.[Abstract/Free Full Text]
  20. Furugori K, Kurauchi O, Itakura A, Kanou Y, Murata Y, Mizutani S, Seo H, Tomoda Y, Nakamura T. 1997 Levels of hepatocyte growth factor and its messenger ribonucleic acid in uncomplicated pregnancies and those complicated by preeclampsia. J Clin Endocrinol Metab. 82:2726–30.[Abstract/Free Full Text]
  21. Saito S, Sakakura S, Enomoto M, Ichijo M, Matsumoto K, Nakamura T. 1995 Hepatocyte growth factor promotes the growth of cytotrophoblasts by the paracrine mechanism. J Biochem. 117:671–676.[Abstract/Free Full Text]
  22. Kauma S. Cytokines in implantation. J Reprod Infertil. In press.



This article has been cited by other articles:


Home page
Hum ReprodHome page
F. Dominguez, B. Gadea, F. J. Esteban, J. A. Horcajadas, A. Pellicer, and C. Simon
Comparative protein-profile analysis of implanted versus non-implanted human blastocysts
Hum. Reprod., September 1, 2008; 23(9): 1993 - 2000.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
J. S. Fitzgerald, T. G. Poehlmann, E. Schleussner, and U. R. Markert
Trophoblast invasion: the role of intracellular cytokine signalling via signal transducer and activator of transcription 3 (STAT3)
Hum. Reprod. Update, April 17, 2008; (2008) dmn010v1.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
R. Ganapathy, G. S. J. Whitley, J.E. Cartwright, P.R. Dash, and B. Thilaganathan
Effect of heparin and fractionated heparin on trophoblast invasion
Hum. Reprod., September 1, 2007; 22(9): 2523 - 2527.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
L.J. Ayling, G.St.J. Whitley, J.D. Aplin, and J.E. Cartwright
Dimethylarginine dimethylaminohydrolase (DDAH) regulates trophoblast invasion and motility through effects on nitric oxide
Hum. Reprod., October 1, 2006; 21(10): 2530 - 2537.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Hayashi, M. Sakata, T. Takeda, M. Tahara, T. Yamamoto, Y. Okamoto, R. Minekawa, A. Isobe, M. Ohmichi, K. Tasaka, et al.
Up-Regulation of c-met Protooncogene Product Expression through Hypoxia-Inducible Factor-1{alpha} Is Involved in Trophoblast Invasion under Low-Oxygen Tension
Endocrinology, November 1, 2005; 146(11): 4682 - 4689.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. Nicola, A. V. Timoshenko, S. J. Dixon, P. K. Lala, and C. Chakraborty
EP1 Receptor-Mediated Migration of the First Trimester Human Extravillous Trophoblast: The Role of Intracellular Calcium and Calpain
J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4736 - 4746.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. Belkacemi, G. E. Lash, S. K. Macdonald-Goodfellow, J. D. Caldwell, and C. H. Graham
Inhibition of Human Trophoblast Invasiveness by High Glucose Concentrations
J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4846 - 4851.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. Thadhani, W. P. Mutter, M. Wolf, R. J. Levine, R. N. Taylor, V. P. Sukhatme, J. Ecker, and S. A. Karumanchi
First Trimester Placental Growth Factor and Soluble Fms-Like Tyrosine Kinase 1 and Risk for Preeclampsia
J. Clin. Endocrinol. Metab., February 1, 2004; 89(2): 770 - 775.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Hirata, T. Sato, M. Tsumagari, A. Shimada, H. Nakano, K. Hashizume, and A. Ito
Differential Regulation of the Expression of Matrix Metalloproteinases and Tissue Inhibitors of Metalloproteinases by Cytokines and Growth Factors in Bovine Endometrial Stromal Cells and Trophoblast Cell Line BT-1 In Vitro
Biol Reprod, April 1, 2003; 68(4): 1276 - 1281.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
K. A. Hess, S. E. Waltz, E. L. Chan, and S. J.F. Degen
Receptor Tyrosine Kinase Ron Is Expressed in Mouse Reproductive Tissues During Embryo Implantation and Is Important in Trophoblast Cell Function
Biol Reprod, April 1, 2003; 68(4): 1267 - 1275.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kauma, S. W.
Right arrow Articles by Walsh, S. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kauma, S. W.
Right arrow Articles by Walsh, S. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals