| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Departments of Obstetrics/Gynecology (S.W.K., V.B.-J., S.W.W.), Microbiology/Immunology (S.W.K.), and Physiology (S.W.W.), Virginia Commonwealth University/Medical College of Virginia, Richmond, Virginia 23298
Address all correspondence and requests for reprints to: Dr. Scott Kauma, Department of Obstetrics/Gynecology and Microbiology/Immunology, Virginia Commonwealth University/Medical College of Virginia, Box 980034, Richmond, Virginia 23298.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
HGF is a pleiotropic cytokine that was first characterized by its ability to promote the proliferation of hepatocytes in vitro (8). Subsequently, HGF was found to play a role in cell migration, proliferation, and morphogenesis in a number of different cell types and tissues (9). The receptor for HGF is a tyrosine kinase receptor and is the product of the c-met protooncogene (10). HGF is mainly produced by fibroblasts and other mesenchymal cell types (9). The HGF receptor, Met, is primarily found in endothelial and epithelial cell types. HGF/Met interaction provides a classical example for mesenchymal cell paracrine regulation of epithelial cell function (11). A potential role for HGF during pregnancy was first suggested in studies demonstrating high levels of HGF messenger ribonucleic acid (mRNA) expression and extractable HGF protein in human placentas (12). In addition, HGF knockout mutations in mice are lethal to the embryo due to abnormal placental development (13). Studies in our laboratory have shown that villous core mesenchymal cells produce HGF, whereas trophoblast express Met (14).
As HGF is known to stimulate the migration and invasion of a number of epithelial cell types, we hypothesized that placental villous core mesenchymal cell production of HGF may regulate trophoblast invasion. Consequently, this study was designed to test the hypothesis that decreased placental HGF production is a potential mechanism for shallow trophoblast invasion in preeclampsia.
| Materials and Methods |
|---|
|
|
|---|
Placentas were obtained immediately after delivery from normal (n = 5) and preeclamptic (n = 5) pregnancies (3540 weeks gestation). Preeclampsia was defined as maternal blood pressure of more than 140/90 mm Hg with proteinuria (>300 mg/24 h or +2 on single urine sample) and edema. Placental villous explants were cultured as previously described (14). Immediately after obtaining the placenta, placental villi were dissected free from the decidua basalis, minced into small pieces, and rinsed free of blood. The placental villi (350 mg wet weight) were cultured in duplicate in 5 mL DMEM with 10 mmol L-glutamine, 100 mIU/mL penicillin, and 100 mg/mL streptomycin, pH 7.4 (Sigma Chemical Co., St. Louis, MO) for 24 h, and the medium was stored at -20 C until assayed for HGF.
Enzyme-linked immunosorbant assay (ELISA) for HGF
HGF in placental villous explant-conditioned medium was quantified by a sandwich ELISA for human HGF as previously described (14). Polystyrene 96-well plates (Costar, Cambridge, MA) were coated with mouse monoclonal antibody to human HGF (R&D Systems, Minneapolis, MN) at a concentration of 2 µg/mL in 0.2 mol/L Na2CO3 buffer, pH 9.6, for 24 h at 4 C. The plates were washed with phosphate-buffered saline with 0.05% Tween-20 (PBST) and blocked with 1% BSA in 0.2 mol/L Na2CO3 buffer, pH 9.6, for 1 h at 37C. After washing the plates with PBST, 100 µL of the conditioned medium samples or human recombinant HGF standard (R&D Systems) in triplicate were added to the plates and incubated at 4 C overnight. The plates were then washed with PBST and incubated with 100 µL goat anti-HGF antibody (R&D Systems) at a concentration of 2 µg/mL in PBST for 2 h at room temperature. The plates were washed with PBST and then incubated with 100 µL of a 1:15,000 dilution of peroxidase-conjugated mouse antigoat IgG (Pierce Chemical Co., Rockford, IL) for 1 h at room temperature. The wells were washed with PBST and developed with a 0.1% O-phenylenediamine dihydrochloride substrate (Sigma Chemical Co.) in 0.1 mol/L citric acid buffer, pH 4.5, with 0.005% H2O2 for 20 min at room temperature. The reaction was stopped by the addition of an equal volume of 2 mol/L H2SO4, and the plates were read at 490 mm in a V-max Kinetic Microplate Reader (Molecular Devices, Palo Alto, CA). The assay sensitivity and range were 240 pg/mL to 60 ng/mL. To validate the assay, samples that were either serially diluted or to which known amounts of the HGF standard were added were compared to the standard curve to demonstrate appropriate parallelism. The within-assay coefficient of variation was 4% at 20 ng/mL, 7% at 4 ng/mL, and 15% at 0.8 ng/mL. All sample comparisons were run in the same assay to eliminate between assay variability.
ED27 trophoblast cells
The ED27 trophoblast cell line used in these studies was derived from a prenatal diagnostic first trimester chorionic villous sample. The pregnancy resulted in a normal male infant. This cell line produces estradiol and progesterone, expresses placental alkaline phosphatase, produces low amounts of hCG, is positive for cytokeratin type 8, and is negative for vimentin (15).
RT-PCR for Met
RT-PCR was performed by isolating total RNA from the human first trimester trophoblast cell line, ED27, using the acid guanidinium isothiocyanate-phenol-chloroform extraction method. First strand synthesis was performed on 1 µg total RNA using specific human Met 3'-primers and SuperScript II ribonuclease HG reverse transcriptase (Life Technologies, Inc., Gaithersburg, MD). Yeast RNA (Sigma Chemical Co.) was used as a negative control. The complementary DNA was amplified using the GeneAmp system of DNA amplification (Perkin Elmer Corp./Cetus, Norwalk, CT). Samples were incubated in a thermocycler (M. J. Research, Inc., Watertown, MA) for 30 cycles after the addition of the 5'-primers and Taq polymerase. Denaturing was carried out at 94 C for 1 min, followed by primer annealing at 58 C (Met) for 1 min and primer extension at 72 C for 2 min. The PCR products were then separated by size in a 1.5% agarose gel by electrophoresis and stained with ethidium bromide.
The primers were synthesized in the Nucleic Acid Core Facility at Virginia Commonwealth University using a PE Applied Biosystems 380 A DNA synthesizer (Foster City, CA). The sequences of the Met primers were 5'-226 tcctcgtgctcctgtttacc 245 and 3'-865 tctttcgtttcctttagccttc 844.
Western immunoblotting for Met
The ED27 cell line was homogenized in RIPA buffer (5 mmol/L Tris, 150 mmol/L NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 0.1 mmol/L ethylenediamine tetraacetate, 0.1 mmol/L phenyl-methylsulfonylfluoride, and 2 µg/mL aprotinin, pH 7.5). The homogenate was clarified by centrifugation, and the protein concentration of the supernatant was determined in a Coomassie protein assay using albumin as the standard (Pierce Chemical Co.). The soluble protein extract (10 µg) was electrophoresed through a denaturing 7.5% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane. The membrane was blocked with 5% nonfat dry milk in TBST (100 mmol/L Tris, 0.9% NaCl, and 0.05% Tween-20, pH 7.4) for 1 h. The membrane was then incubated for 1 h with 2 µg/mL rabbit IgG antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) developed against a synthetic Met peptide. Development of the Western blots was performed using the Amersham Pharmacia Biotech ECL system (Amersham Pharmacia Biotech, Arlington Heights, IL).
Immunoprecipitation/Western immunoblotting of Met for phosphorylation of tyrosines
ED27 cells were grown in DMEM-Hams F-12 with 10% FBS until semiconfluent. The medium was replaced with serum-free DMEM-Hams F-12 and cultured for 24 h. ED27 cells were then exposed to HGF (50 ng/mL) for either 15 or 30 min. The cells were lysed in RIPA buffer with the addition of NaVO4 at 1 mmol/L. The homogenate was clarified by centrifugation, and the protein concentration of the supernatant was determined in a Coomassie protein assay using albumin as the standard (Pierce Chemical Co.).
For immunoprecipitation of Met, 100 µg total cellular protein was incubated with 1 µg anti-Met rabbit polyclonal antibody (Santa Cruz Biotechnology, Inc.) overnight at 4 C, followed by the addition of protein G-agarose (Sigma Chemical Co.) for 2 h at 4 C. The immunoprecipitated receptor/protein G-agarose complexes were then washed extensively with RIPA buffer and boiled for 2 min in denaturing loading buffer. The protein samples were electrophoresed through a denaturing 7.5% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane. The membrane was blocked with 1% BSA in TBST for 1 h. The membrane was then incubated overnight at 4 C with 2 µg/mL horseradish peroxidase-conjugated RC20 monoclonal antiphosphotyrosine antibody (Transduction Laboratories, Lexington, KY). Development of the Western blots was performed using the Amersham Pharmacia Biotech ECL system. Control for specificity of the Western blots included substituting the specific Met antibody with nonspecific IgG at the same concentration.
ED27 invasion assay
The Boyden chamber invasion assay was performed by coating porous membrane (8-mm) culture well inserts with 25 µg rat tail collagen type 1 (Collaborative Biomedical Products, Bedford, MA). The ED27 cells (105 cells/well) were then added on top of the collagen-coated membrane insert and incubated in DMEM-Hams F-12 medium with 10% FBS for 72 h with the addition of 0, 0.1, 1.0, 10, or 100 ng/mL of HGF (n = 4 wells/dose). The inserts were fixed and stained with crystal violet in methanol. The side of the membrane insert with the collagen coating and noninvading ED27 cells was gently scraped away with a cotton swab, and the opposite side of the membrane was examined to determine cell invasion. This assay was quantified by counting the number of ED27 cells that had invaded the collagen-coated membranes. To demonstrate the specificity of the HGF-induced invasion, the invasion assay was also performed with or without the addition of neutralizing antibody to HGF (R&D Systems) at a concentration of 20 µg/mL in the presence of 10 ng/mL HGF. One-way ANOVA was used to analyze the Boyden chamber invasion assays.
Zymography for 92-kDa collagenase
Confluent ED27 cells were cultured in 35-mm2 dishes for 48 h in 5 mL serum-free DMEM-Hams F-12 with the addition of either 0 or 10 ng/mL HGF. The conditioned medium was then collected and concentrated 20-fold using Centricon concentrators (Amicon, Beverly, MA). Nonreducing 10% polyacrylamide gels supplemented with 1% gelatin were used to determine the proteolytic activity of the conditioned medium. After electrophoresis, the gels were washed in renaturing buffer (2.5% Triton X-100) and once in developing buffer (10 mmol/L Tris base, 40 mmol/L Tris-HCl, 20 mmol/L NaCl, 5 mmol/L CaCl2, and 0.02% 23 BRIJ35; Novex, San Diego, CA). Gels were incubated in fresh developing buffer overnight at 37 C. Gels were stained in 0.05% Coomassie blue with 30% methanol and 10% glacial acetic acid for 3 h and then destained in 30% methanol and 10% glacial acetic acid as needed. Prestained molecular mass standards (Bio-Rad Laboratories, Inc., Hercules, CA) were used to determine the molecular mass of proteolytic activity.
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
HGF may play an important role in placental trophoblast invasion through the activation of Met and the subsequent induction of 92-kDa collagenase in these cells. The 2-fold induction of 92-kDa collagenase in ED27 trophoblast by HGF is comparable to IL-1 which stimulates a 3-fold induction of 92-kDa collagenase in isolated villous trophoblast (19). Our laboratory and others have previously shown that the major site of placental HGF production is the villous core, specifically villous core mesenchymal cells (14, 20). In placental villi, the HGF receptor Met, is expressed mainly in cytotrophoblast. These findings in addition to studies showing the stimulation of trophoblast proliferation in response to HGF has suggested an important role for villous core HGF in the regulation of trophoblast proliferation (21). However, our laboratory has also shown that Met is localized to invasive trophoblast at the site of anchoring villi (22). As the current study shows that HGF stimulates trophoblast invasion in vitro, HGF produced and secreted by the villous core may play a role in the regulation of trophoblast invasion in vivo. This hypothesis of a villous core paracrine factor regulating trophoblast invasion helps explain why the majority of trophoblasts do not invade a great distance from the placenta into the uterus during normal pregnancy. As trophoblasts migrate further away from the villous core, there would be lower concentrations of villous core HGF present to stimulate trophoblast invasion.
One of the pathological findings associated with preeclampsia is the presence of shallow trophoblast invasion. This study demonstrated decreased placental production and secretion of HGF in placental villi from pregnancies complicated by preeclampsia. These findings are consistent with a previous study that showed decreased HGF mRNA expression and tissue-extractable HGF protein in placentas from women with preeclampsia (20). It is possible that the adverse effects of preeclampsia result in the decreased expression of placental HGF and are not a cause of preeclampsia. However, as the current study has shown that HGF stimulates trophoblast invasion, these findings suggest the possibility that decreased placental HGF production in pregnancies complicated by preeclampsia may be a potential mechanism for the shallow trophoblast invasion seen in this pregnancy disorder.
|
| Footnotes |
|---|
Received April 30, 1999.
Revised June 22, 1999.
Accepted July 21, 1999.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
F. Dominguez, B. Gadea, F. J. Esteban, J. A. Horcajadas, A. Pellicer, and C. Simon Comparative protein-profile analysis of implanted versus non-implanted human blastocysts Hum. Reprod., September 1, 2008; 23(9): 1993 - 2000. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Fitzgerald, T. G. Poehlmann, E. Schleussner, and U. R. Markert Trophoblast invasion: the role of intracellular cytokine signalling via signal transducer and activator of transcription 3 (STAT3) Hum. Reprod. Update, April 17, 2008; (2008) dmn010v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ganapathy, G. S. J. Whitley, J.E. Cartwright, P.R. Dash, and B. Thilaganathan Effect of heparin and fractionated heparin on trophoblast invasion Hum. Reprod., September 1, 2007; 22(9): 2523 - 2527. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.J. Ayling, G.St.J. Whitley, J.D. Aplin, and J.E. Cartwright Dimethylarginine dimethylaminohydrolase (DDAH) regulates trophoblast invasion and motility through effects on nitric oxide Hum. Reprod., October 1, 2006; 21(10): 2530 - 2537. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hayashi, M. Sakata, T. Takeda, M. Tahara, T. Yamamoto, Y. Okamoto, R. Minekawa, A. Isobe, M. Ohmichi, K. Tasaka, et al. Up-Regulation of c-met Protooncogene Product Expression through Hypoxia-Inducible Factor-1{alpha} Is Involved in Trophoblast Invasion under Low-Oxygen Tension Endocrinology, November 1, 2005; 146(11): 4682 - 4689. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Nicola, A. V. Timoshenko, S. J. Dixon, P. K. Lala, and C. Chakraborty EP1 Receptor-Mediated Migration of the First Trimester Human Extravillous Trophoblast: The Role of Intracellular Calcium and Calpain J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4736 - 4746. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Belkacemi, G. E. Lash, S. K. Macdonald-Goodfellow, J. D. Caldwell, and C. H. Graham Inhibition of Human Trophoblast Invasiveness by High Glucose Concentrations J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4846 - 4851. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Thadhani, W. P. Mutter, M. Wolf, R. J. Levine, R. N. Taylor, V. P. Sukhatme, J. Ecker, and S. A. Karumanchi First Trimester Placental Growth Factor and Soluble Fms-Like Tyrosine Kinase 1 and Risk for Preeclampsia J. Clin. Endocrinol. Metab., February 1, 2004; 89(2): 770 - 775. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hirata, T. Sato, M. Tsumagari, A. Shimada, H. Nakano, K. Hashizume, and A. Ito Differential Regulation of the Expression of Matrix Metalloproteinases and Tissue Inhibitors of Metalloproteinases by Cytokines and Growth Factors in Bovine Endometrial Stromal Cells and Trophoblast Cell Line BT-1 In Vitro Biol Reprod, April 1, 2003; 68(4): 1276 - 1281. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Hess, S. E. Waltz, E. L. Chan, and S. J.F. Degen Receptor Tyrosine Kinase Ron Is Expressed in Mouse Reproductive Tissues During Embryo Implantation and Is Important in Trophoblast Cell Function Biol Reprod, April 1, 2003; 68(4): 1267 - 1275. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |