| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Department of Pediatrics, University of Florida, Childrens Medical Services Center (A.L.R.), Gainesville, Florida 32608; Centro Medico National (A.S.A.), Santo Domingo, Dominican Republic; Department of Pediatrics, Emory University (M.R.B.), Atlanta, Georgia; Quest Diagnostics, Inc.-Nichols Institute Diagnostics (D.A.F.), San Juan Capistrano, California 92690; Department of Pediatrics, University of Miami (L.B.), Miami, Florida 33101; and the Department of Pediatrics, Emory University (J.S.P.), Atlanta, Georgia 30322
Address all correspondence and requests for reprints to: Dr. Arlan L. Rosenbloom, Department of Pediatrics, University of Florida, Childrens Medical Services Center, 1701 SW 16th Avenue, Gainesville, Florida 32608.
| Abstract |
|---|
|
|
|---|
Serum GH concentrations were 0.1 ng/mL or less after clonidine ingestion. Other results were: IGF-I, 311 ng/mL (normal, 114492); IGF-II, 185299 ng/mL (normal, 358854); IGF-binding protein-1 (IGFBP-1), 12200 ng/mL (normal, 1373); IGFBP-2, 60384 ng/mL (normal, 55480); and IGFBP-3, 400600 ng/mL (normal, 20004000). The very low IGF-I and normal IGFBP-1 and -2 levels differ from findings in adults with GHRD. The GH-binding protein concentration was 58799 pmol/L, with two patients above the normal range of 66306. LH and FSH levels were very low, with no sex differences between serum levels of estradiol (36 pg/mL) and testosterone (310 ng/dL). PRL levels all were below normal. Serum concentrations of cortisol were normal. Serum T4 levels were uniformly low (<0.20.5; normal, 0.82.7 ng/dL), free T3 values were less than normal in seven of eight subjects, and total T3 concentrations were below normal in five of eight, but TSH levels were normal (0.582.18; normal, 0.44.2 mU/L).
DNA specimens from affected individuals in each sibship were homozygous for a 2-bp deletion in exon 2 of the PROPI (Prophet of Pit-I) gene, which causes a shift of reading frames and results in a translational stop signal at codon 109. The mutant protein, when expressed in vivo lacks DNA-binding and transcriptional activation functions. The consequences of the PROPI abnormality in this and other kindreds include gonadotropin deficiency as well as the expected deficiencies in products of Pit-I-dependent somatotrophs, lactotrophs, and thyrotrophs. The severity of the hormone deficiency phenotype is compatible with the complete loss of PROP1 activity.
| Introduction |
|---|
|
|
|---|
Some instances of MPHD have been attributed to dominant and recessive mutations of the gene for pituitary transcription factor, POU1F1 (formerly referred to as Pit-1), which is critical for the differentiation of somatotrophs, thyrotrophs, and lactotrophs. Affected patients have intact corticotropin and gonadotropin functions (6). A similar phenotype in the Ames dwarf mouse is caused by mutation of the PROP1 gene. This gene encodes a paired-like homeodomain protein expressed briefly in embryonic pituitary and necessary for POU1F1 expression (7). Thus, it was anticipated that mutation of the PROP1 gene in humans would result in a clinical picture similar to that in patients with POU1F1 mutations. It has recently been demonstrated in several families as well as in sporadic cases, however, that mutation of the PROP1 gene can cause gonadotropin deficiency in addition to somatotropin, TSH, and PRL deficiencies (8, 9, 10, 11). Some of these individuals have had enlargement of the sella turcica (12).
We are reporting a family from the Dominican Republic with six of nine siblings with MPHD and two affected sisters in another probably related family, who are homozygous for a mutation of the PROP1 gene. These patients are untreated and span a wide age range, providing an opportunity to observe the natural history of this disorder.
| Subjects and Methods |
|---|
|
|
|---|
Patient characteristics
Stature was measured in centimeters using a Raven Minimetre (Raven Equipment Ltd., Dunnow, UK) attached to the wall, with the average of three measurements recorded (13). Weight was measured with a balance-beam scale. The SD score for height and height age (age for which height is zero SD score) were estimated from U.S. reference values (14). The body mass index (BMI) was calculated as weight in kilograms divided by the square of height in meters, and comparisons were made to U.S. data for white males and females (15). Hand length was measured across the palmar surface as the distance from the distal wrist crease to the tip of the middle finger. Foot length was recorded as the distance from the heel to the tip of the longest toe along the plantar surface. Head circumference was measured with a flexible tape. A plastic goniometer was used to measure the degree of elbow joint limitation when full extension was not possible. Head circumference, hand length, and foot length were compared to reference values for the U.S. population (16). For calculation of body proportions, arm span and lower body segment (from the top of the symphysis pubis to the floor) were measured; the upper body segment was taken as the height minus the lower body segment (17).
Roentgenograms of the hand and wrist were compared to the standards of Greulich and Pyle to determine bone age (18). Lateral skull films were examined for sellar area by the method of Silverman (19).
Biochemical analyses
Single blood specimens obtained 1 h after clonidine ingestion were separated, and the sera were frozen in dry ice on site. The serum specimens remained frozen until processing at Quest Diagnostics, Inc.-Nichols Institute Diagnostics (San Juan Capistrano, CA). Brief descriptions of the assays follow.
GH was measured by immunochemiluminometric assay (ICMA), using a goat polyclonal antihuman GH labeled with an acridinium ester and a mouse monoclonal GH antibody immobilized on a polystyrene bead; the sensitivity with a 0.2 mL specimen is 0.10 ng/mL. The GH-binding protein (GHBP) concentration was estimated by the ligand-mediated immunofunctional assay. This assay has a sensitivity of 15.6 pmol/L and an interassay variation of less than 12%.
Insulin like growth factor I (IGF-I) and IGF-II concentrations were measured by RIA after acid-ethanol extraction, using specific monoclonal antibodies; the sensitivities for IGF-I and IGF-II are 0.1 and 0 2 ng/mL, respectively. The IGF-binding proteins (IGFBP) were measured without extraction, by RIA, using antibodies that were highly specific for IGFBP-1, IGFBP-2, or IGFBP-3; the sensitivities are 0.4, 0.1, and 3.1 ng/mL, respectively.
LH and FSH concentrations in serum were determined using highly sensitive, third generation ICMA assays, employing capture antibodies immobilized to polystyrene beads and alkaline phosphatase-labeled signal antibodies; the sensitivity is 0.02 IU/L for both methods. Estradiol concentrations were measured after extraction, using ethyl acetate in hexane followed by Celite chromatography purification, with specific RIA using rabbit antiestradiol; the sensitivity is 3 pg/mL. Testosterone was measured by RIA using a rabbit antitestosterone antiserum after ethyl acetate-hexane extraction and Celite chromatography; sensitivity is less than 1 ng/dL.
PRL was measured by ICMA (Ciba Corning ACS-180) using a monoclonal mouse anti-PRL capture antibody and an acridinium ester-labeled polyclonal signal antibody; the sensitivity is 0.3 ng/mL. TSH was measured using a third generation ICMA containing acridinium ester-labeled antibody and a biotin-coupled antibody linked to an avidin-coated polystyrene bead; the sensitivity is 0.01 mU/L. Serum T4 was measured by RIA using a polyclonal anti-T4 and polyethylene glycol separation of bound and free hormone; the sensitivity is 1 µg/dL. Free T4 was measured by direct (equilibrium) dialysis and RIA using a highly sensitive anti-T4 antiserum; the sensitivity is 0.2 ng/dL. Free T3 was measured by tracer (equilibrium) dialysis and RIA. Total T3 was determined by RIA and the free fraction was determined by dialysis; these were performed separately, and the free T3 concentration was calculated as the product of the two. The sensitivities are 25 ng/dL and 0.01%, respectively.
Molecular analysis
Exon 2 of the PROP1 gene was amplified by PCR from 100 ng genomic DNA. Amplification conditions were 100 ng genomic DNA, 0.6 mmol/L primer 13 (TGGTCCAGCACCGAGGAG) and primer 14 (TGCCCAACATTCTATGATAGC), 1.5 mmol/L MgCl2, 1.25 U Taq polymerase (Promega Corp., Madison, WI), 0.2 mmol/L of each deoxy-NTP, and buffer containing 50 mmol/L KCl, 10 mmol/L Tris-HCl (pH 9.0), and 0.1% Triton X-100. The thermal program consisted of preincubation at 95 C for 3 min followed by 30 cycles of 94 C for 45 s, 55 C for 45 s, and 72 C for 60 s, followed by 72 C for 3 min. Normal alleles yielded products of 365 bp, whereas the 2-bp deletion allele yielded 363 bp.
Detection of deletion allele by BcgI digestion of exon 2
PCR products were digested with 6 U BcgI (New England Biolabs, Inc., Beverley, MA) for 1 h at 37 C. Reactions were terminated by heating at 65 C for 20 min. The digestion products were precipitated with ethanol and sodium acetate before separation on 8% PAGE. Gels were stained with ethidium bromide or were silver stained. Digestion of alleles containing the 2-bp deletion yielded products of 234, 97, and 32 bp.
Statistical analysis
All individual data are presented and summarized as means with SDs. Pearson correlation coefficients were calculated using the Statistical Analysis System (SAS Institute, Inc., Cary, NC).
| Results |
|---|
|
|
|---|
The ages of the patients ranged from 17.539.8 yr, and height
SD score ranged from -5.9 to -9.6, with modest, but
nonsignificant, correlation of height SD score with age,
suggesting continued growth through this entire age range (Table 1
). Parental height SD score
varied from -2.3 to -1.2; the two normal siblings in the larger
family were at -1.7 for the 22-yr-old woman and -0.3 for the
35-yr-old man. Over the 22-yr age span of the patients, height age
varied only 4.9 yr, but correlated with chronological age, further
indicating continued growth into the fourth decade of life. With the
exception of the tallest individual, who had a height age of 9.9 yr,
height age over this age span varied only 1.4 yr, from 5.06.4 yr.
Bone ages ranged more widely, from 313.8 yr, but did not correlate
significantly with chronological age for all eight patients or for the
six patients from the large family (no. 1 and 48) analyzed
separately.
|
Body proportion data are shown in Table 2
. The difference between arm span and
height is considered normal if it is within 4 cm of the reference value
(20). By this criterion, only one individual had reduced arm span for
bone age (no. 7), and none had abnormal span for height. The ratios of
upper to lower body segments (U/L) of the patients were all less than
normal for U.S. adults, but were comparable to those of the normal
sister and brother. The patients U/L were substantially lower than
normal for height and bone age, indicating disproportionate growth,
with the legs growing more than the trunk. Although the ratios of the
upper body segment to the lower body segment suggest eunuchoidal
proportions, which would be expected to worsen with the duration of
hypopituitarism, differences between patients U/L and those expected
for height or bone age did not increase with age.
|
Head circumference varied greatly, unrelated to age or statural
deviation (Table 3
). All patients had
depressed nasal bridge and immature facies with a relative decrease in
the vertical dimension of the face compared to that in unaffected
relatives (Figs. 1
and 2
). Six patients had blue scleras,
excluding patients 1 and 3. All had high-pitched voices. None had any
signs of sexual maturation; the four men had testicular volumes ranging
from 0.51 cc and penis lengths of 2.54 cm.
|
|
|
|
|
Biochemical analyses
GH-IGF axis (Table 5
). The GH
concentrations in serum in response to clonidine ingestion were
extremely low. GHBP concentrations were substantially above the normal
range in two patients and were just below normal in one. Parents and
siblings had GHBP values from 136363 pmol/L. IGF-I concentrations
were extremely low; the mean was approximately 5% of the lower limit
of normal. Parents and normal siblings had serum IGF-I concentrations
from 100242 ng/mL. IGF-II concentrations in serum were uniformly low,
but less dramatically suppressed than were IGF-I levels; the mean
IGF-II level for the patients was 60% of the lower limit of normal.
The parents and siblings values for IGF-II fell in a narrow range
of 431474 ng/mL.
|
Sex hormones (Table 6
).
Concentrations of LH and FSH in serum were all below normal limits for
age. These were completely normal in the unaffected relatives, with
menopausal elevation in the 62-yr-old mother. Estradiol and
testosterone concentrations were uniformly very low, with no sex
differences in the patients. The menopausal mother had a serum
concentration of estradiol (10 pg/mL) that was more than twice the mean
of the patients and a testosterone concentration (16 ng/dL) higher than
those of any of the affected males.
|
|
Molecular genetic analysis (Fig. 4
)
DNA specimens from the eight affected individuals and their parents were screened for the presence of a 2-bp deletion in exon 2 of the PROP1 gene. The products of PCR amplification were digested with BcgI and run on polyacrylamide gels, silver stained, and photographed. Digestion of the wild-type allele produced a single band at 365 bp. Alleles with the 2-bp 296delGA mutation generated bands of 234 and 97 bp, and a 32-bp band that migrates off the gel. The parents in families 1 and 2 were heterozygous for 296delGA, whereas all affected individuals were homozygous for the deletion allele, and the two normal siblings in family 1 were homozygous for the wild-type allele. The presence of 296delGA was confirmed by direct DNA sequencing
|
| Discussion |
|---|
|
|
|---|
The severe deficiency of GH and IGF-I, with absence of adolescent development and mild hypothyroidism, led to marked growth failure with only a modest increase in height age with age. The height SD score, however, did not correlate significantly with age, although the tallest individual was the second oldest. Considerable heterogeneity was seen in osseous maturation, which also did not correlate with age. All bone ages, except for that of the youngest patient, were more advanced than height ages, a phenomenon that has been described in GH receptor deficiency (GHRD) and severe GH deficiency (GHD) due to GH gene deletion (21). In most instances of GHD, osseous maturation is less than or equal to height age; the addition of thyroid deficiency would be expected to enhance this discrepancy, but this was the case only in the youngest patient.
The finding of generally normal hand and foot lengths is very different from observations in patients with severe IGF-I deficiency due to GHRD. Over 70% of both children and adults with GHRD have small hands or feet, as herein defined, less than the 10th percentile for height (22). This difference in hand and foot growth does not reflect a difference in overall severity of growth failure, as SD scores for height are comparable in these conditions. Neither can this difference be related to the failure of sexual maturation in the Dominican patients as opposed to the normal, although often delayed, sexual maturation in patients with GHRD; the relatively small hands and feet are present before adolescence in the latter condition (22).
It is of interest to compare the body proportions and body composition in these patients who have deficiencies of IGF-I, thyroid function, and sex steroids to those of patients with GHRD who have comparable IGF-I deficiency, but normal thyroid and gonadal function. With severe IGF-I deficiency due to GHRD, body proportions are normal before puberty, whereas in adults, the limbs are relatively short (22). The patients with MPHD maintained bone ages that were prepubertal, or early pubertal (patient 7), into adulthood in the absence of sex steroids. Their continued slow growth, impaired by both GH and thyroid deficiency, was associated with very different adult body proportions than those seen with GHRD, with normal arm span and increased lower segments for height and bone age. In subjects with GHRD, the percent ideal body weight for height increases with age, and almost all postpubertal women and two thirds of the men are above 120% ideal body weight (22). In this study obesity was estimated using BMI. Although the youngest patient (no. 1) had the lowest BMI for height, there was no correlation between age and BMI percentile for height (r = 0.23). Among eight Russian patients, aged 1017.7 yr, from six families with MPHD due to PROP1 mutations, the BMI percentile for height was more than 75% in four of the six females only (10). In contrast to the present report, the BMI percentile for height correlated significantly with chronological age (r = 0.63; P = 0.05). That five subjects in our study had substantially increased BMI percentile for height and the correlation of this measure of obesity with age in a pediatric population with MPHD from PROP1 mutation indicate that the obesity seen only with adulthood in the GHRD subjects is not entirely an effect of sexual maturation in the IGF-deficient state.
Limitation of elbow extensibility, initially observed in 85% of Ecuadorian patients with GHRD after 5 yr of age and with increasing severity with age, has not been described in GHD (22). The cause of this limitation is not known, but its occurrence in both of these conditions indicates that the limitation is the result of GH-IGF-I deficiency.
Three of the eight patients had head circumference measurements greater than 2 SD below the mean for height, and five had measurements more than 2 SD below the mean for bone age. All but one had a head circumference that was more than 2.2 SD below the mean for chronological age. Head circumference was considered to be normal for height in GHD and GHRD (23). The reason for the reduced head size in these Dominican patients is unclear. Two of the three with sellar enlargement were among those with normal head size.
As has been previously noted with hypopituitarism due to PROP1 mutation, sellar enlargement varied within our patient group (12). Furthermore, enlargement may not be detected initially, but may appear during follow-up (12, 24). The mass may evolve into a radiological appearance of empty sella, with a rim of residual pituitary tissue.
Serum concentrations of IGF-I were comparable to those recorded for children with GHRD, but were much lower than those seen in adults with GHRD (22). This observation is consistent with the hypothesis that the significant increase in serum IGF-I concentrations in adults compared to children with GHRD is a direct effect of sex steroids.
The reduced serum concentrations of IGFBP-3 are typical of GHD, whereas the normality of IGFBP-2 concentrations, with the exception of one patient who had a lower than normal value, is unexpected. Patients with GHD or GHRD have elevated levels of IGFBP-2, which increase further with replacement therapy (25). Other GH- or IGF-I-deficient patients also have elevated IGFBP-1 serum concentrations, reflecting hypoinsulinemia (26). The lack of consistency for such a finding in this study, with only three patients having elevations, is probably due to the variation in their fasting status at the time of testing.
Gonadotropin and sex steroid concentrations in serum were extremely low and did not vary with age or gender, indicating hypopituitary hypogonadism. PRL concentrations also were low. Afternoon cortisol levels were all normal, with no age correlations to suggest deteriorating ACTH secretion.
The affected individuals in this series were all homozygous for a
GA or an AG deletion in the sequence 296GAGAGAG in exon 2 of PROP1.
Similar deletion alleles were present in the homozygous state in two
families and in the compound heterozygous state in one of the four
families with PROP1 deficiency reported by Wu et al. (8).
The same mutation has been noted in patients of Russian (9, 11),
Turkish (11), Jamaican (12), U.S. (12), and Brazilian (11, 12) descent.
The series of three dinucleotide repeats appears to be a mutational hot
spot, with susceptibility to misalignment of DNA generating slippage
and deletion independently in different populations. Another mutational
hot spot has recently been described that also results in a 2-bp
deletion in exon 2 (149delGA) that leads to the same serine to stop
codon change at codon 109 and is present as a compound heterozygote
with the 296delGA mutation in children with MPHD from four Russian
families (10). It is entirely possible that a single mutational event
was responsible for PROP1 deficiency in the eight affected individuals
in a single small village. The 296GAdel mutation represents a severe
loss of function mutation. The altered sequence predicts a protein of
108 amino acids with a frameshift and truncation in the second
-helix of the DNA-binding domain. When expressed in a mouse PROP1
context, the recombinant protein lacks detectable DNA-binding and
transcriptional activation activities (8). The severity of the
hormone deficiency phenotype is compatible with the complete loss of
PROP1 activity.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received August 7, 1998.
Revised September 18, 1998.
Accepted September 22, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
L.L.F. do Amaral, R.M. Ferreira, N.P.F.D. Ferreira, R.A. Mendonca, V.H.R. Marussi, J.L. da Cunha, B.R. Macaranduba, and J.D. Medeiros Combined Pituitary Hormone Deficiency and PROP-1 Mutation in Two Siblings: A Distinct MR Imaging Pattern of Pituitary Enlargement AJNR Am. J. Neuroradiol., August 1, 2007; 28(7): 1369 - 1370. [Abstract] [Full Text] [PDF] |
||||
![]() |
M J E Walenkamp and J M Wit Genetic disorders in the GH IGF-I axis in mouse and man Eur. J. Endocrinol., August 1, 2007; 157(suppl_1): S15 - S26. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lebl, J. Vosahlo, R. W Pfaeffle, H. Stobbe, J. Cerna, D. Novotna, J. Zapletalova, B. Kalvachova, V. Hana, V. Weiss, et al. Auxological and endocrine phenotype in a population-based cohort of patients with PROP1 gene defects Eur. J. Endocrinol., September 1, 2005; 153(3): 389 - 396. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. E. Walenkamp, M. Karperien, A. M. Pereira, Y. Hilhorst-Hofstee, J. van Doorn, J. W. Chen, S. Mohan, A. Denley, B. Forbes, H. A. van Duyvenvoorde, et al. Homozygous and Heterozygous Expression of a Novel Insulin-Like Growth Factor-I Mutation J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 2855 - 2864. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. E Mullis Genetic control of growth Eur. J. Endocrinol., January 1, 2005; 152(1): 11 - 31. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Reynaud, M. Chadli-Chaieb, S. Vallette-Kasic, A. Barlier, J. Sarles, I. Pellegrini-Bouiller, A. Enjalbert, L. Chaieb, and T. Brue A Familial Form of Congenital Hypopituitarism Due to a PROP1 Mutation in a Large Kindred: Phenotypic and in Vitro Functional Studies J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5779 - 5786. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Lee, Y.-S. Zhu, J. J. Cordero, L.-Q. Cai, I. Labour, C. Herrera, and J. Imperato-McGinley Long-Term Growth Hormone Therapy in Adulthood Results in Significant Linear Growth in Siblings with a PROP-1 Gene Mutation J. Clin. Endocrinol. Metab., October 1, 2004; 89(10): 4850 - 4856. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bottner, E. Keller, J. Kratzsch, H. Stobbe, J. F. W. Weigel, A. Keller, W. Hirsch, W. Kiess, W. F. Blum, and R. W. Pfaffle PROP1 Mutations Cause Progressive Deterioration of Anterior Pituitary Function including Adrenal Insufficiency: A Longitudinal Analysis J. Clin. Endocrinol. Metab., October 1, 2004; 89(10): 5256 - 5265. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Voutetakis, M. Argyropoulou, A. Sertedaki, S. Livadas, P. Xekouki, M. Maniati-Christidi, I. Bossis, N. Thalassinos, N. Patronas, and C. Dacou-Voutetakis Pituitary Magnetic Resonance Imaging in 15 Patients with Prop1 Gene Mutations: Pituitary Enlargement May Originate from the Intermediate Lobe J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2200 - 2206. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Davenport Power to the People Sci. Aging Knowl. Environ., December 17, 2003; 2003(50): ns8 - 8. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. N. Cohen, L. E. Cohen, D. Botero, C. Yu, A. Sagar, M. Jurkiewicz, and S. Radovick Enhanced Repression by HESX1 as a Cause of Hypopituitarism and Septooptic Dysplasia J. Clin. Endocrinol. Metab., October 1, 2003; 88(10): 4832 - 4839. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. C. Vieira, M. R. Dias da Silva, J. M. Cerutti, E. Brunner, M. Borges, L. T. Arnaldi, P. Kopp, and J. Abucham Familial Combined Pituitary Hormone Deficiency due to a Novel Mutation R99Q in the Hot Spot Region of Prophet of Pit-1 Presenting as Constitutional Growth Delay J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 38 - 44. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. E. Cohen and S. Radovick Molecular Basis of Combined Pituitary Hormone Deficiencies Endocr. Rev., August 1, 2002; 23(4): 431 - 442. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Kalantaridou and G. P. Chrousos Monogenic Disorders of Puberty J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2481 - 2494. [Full Text] [PDF] |
||||
![]() |
F. G. Riepe, C.-J. Partsch, O. Blankenstein, H. Monig, R. W. Pfaffle, and W. G. Sippell Longitudinal Imaging Reveals Pituitary Enlargement Preceding Hypoplasia in Two Brothers with Combined Pituitary Hormone Deficiency Attributable to PROP1 Mutation J. Clin. Endocrinol. Metab., September 1, 2001; 86(9): 4353 - 4357. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. F. Osorio, P. Kopp, S. Marui, A. C. Latronico, B. B. Mendonca, and I. J. P. Arnhold Combined Pituitary Hormone Deficiency Caused by a Novel Mutation of a Highly Conserved Residue (F88S) in the Homeodomain of PROP-1 J. Clin. Endocrinol. Metab., August 1, 2000; 85(8): 2779 - 2785. [Abstract] [Full Text] |
||||
![]() |
O. Fofanova, N. Takamura, E.-i. Kinoshita, A. Vorontsov, V. Vladimirova, I. Dedov, V. Peterkova, and S. Yamashita MR Imaging of the Pituitary Gland in Children and Young Adults with Congenital Combined Pituitary Hormone Deficiency Associated with PROP1 Mutations Am. J. Roentgenol., February 1, 2000; 174(2): 555 - 559. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Pernasetti, S. P. A. Toledo, V. V. Vasilyev, C. Y. Hayashida, J. D. Cogan, C. Ferrari, D. M. Lourenço, and P. L. Mellon Impaired Adrenocorticotropin-Adrenal Axis in Combined Pituitary Hormone Deficiency Caused by a Two-Base Pair Deletion (301-302delAG) in the Prophet of Pit-1 Gene J. Clin. Endocrinol. Metab., January 1, 2000; 85(1): 390 - 397. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |