help button home button Endocrine Society JCEM JCEM Call for Nominations for EIC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rosenbloom, A. L.
Right arrow Articles by Parks, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rosenbloom, A. L.
Right arrow Articles by Parks, J. S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*OMIM
*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*HYDROCORTISONE
The Journal of Clinical Endocrinology & Metabolism Vol. 84, No. 1 50-57
Copyright © 1999 by The Endocrine Society


Original Studies

Clinical and Biochemical Phenotype of Familial Anterior Hypopituitarism from Mutation of the PROP1 Gene1

Arlan L. Rosenbloom, Antonio Selman Almonte, Milton R. Brown, Delbert A. Fisher, Lisa Baumbach and John S. Parks

Department of Pediatrics, University of Florida, Children’s Medical Services Center (A.L.R.), Gainesville, Florida 32608; Centro Medico National (A.S.A.), Santo Domingo, Dominican Republic; Department of Pediatrics, Emory University (M.R.B.), Atlanta, Georgia; Quest Diagnostics, Inc.-Nichols Institute Diagnostics (D.A.F.), San Juan Capistrano, California 92690; Department of Pediatrics, University of Miami (L.B.), Miami, Florida 33101; and the Department of Pediatrics, Emory University (J.S.P.), Atlanta, Georgia 30322

Address all correspondence and requests for reprints to: Dr. Arlan L. Rosenbloom, Department of Pediatrics, University of Florida, Children’s Medical Services Center, 1701 SW 16th Avenue, Gainesville, Florida 32608.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
We have investigated the largest family with PROP1 deficiency reported to date. Eight patients, aged 17–40 yr, in two sibships with possibly related mothers but no parental consanguinity were 109–137 cm in height (-8.8 to [minsu]5.9 SD score) and sexually immature. None had received hormonal therapy. Affected individuals had similarities to and significant differences from patients with insulin-like growth factor I (IGF-I) deficiency due to GH receptor deficiency (GHRD) and normal thyroid function and sexual maturation. The differences from patients with GHRD include normal hand and foot length in seven of eight, normal arm span with relatively long legs, and persistence of extremely low levels of IGF-I into adulthood; similarities include the degree of growth failure, frequent but not uniform increased body weight for height or body mass index, and the presence of limited elbow extensibility and blue scleras in six of eight. Three patients had markedly increased sella turcica area for height age and bone age, determined from lateral skull films. The degree of sellar enlargement is variable in these two sibships.

Serum GH concentrations were 0.1 ng/mL or less after clonidine ingestion. Other results were: IGF-I, 3–11 ng/mL (normal, 114–492); IGF-II, 185–299 ng/mL (normal, 358–854); IGF-binding protein-1 (IGFBP-1), 12–200 ng/mL (normal, 13–73); IGFBP-2, 60–384 ng/mL (normal, 55–480); and IGFBP-3, 400–600 ng/mL (normal, 2000–4000). The very low IGF-I and normal IGFBP-1 and -2 levels differ from findings in adults with GHRD. The GH-binding protein concentration was 58–799 pmol/L, with two patients above the normal range of 66–306. LH and FSH levels were very low, with no sex differences between serum levels of estradiol (3–6 pg/mL) and testosterone (3–10 ng/dL). PRL levels all were below normal. Serum concentrations of cortisol were normal. Serum T4 levels were uniformly low (<0.2–0.5; normal, 0.8–2.7 ng/dL), free T3 values were less than normal in seven of eight subjects, and total T3 concentrations were below normal in five of eight, but TSH levels were normal (0.58–2.18; normal, 0.4–4.2 mU/L).

DNA specimens from affected individuals in each sibship were homozygous for a 2-bp deletion in exon 2 of the PROPI (Prophet of Pit-I) gene, which causes a shift of reading frames and results in a translational stop signal at codon 109. The mutant protein, when expressed in vivo lacks DNA-binding and transcriptional activation functions. The consequences of the PROPI abnormality in this and other kindreds include gonadotropin deficiency as well as the expected deficiencies in products of Pit-I-dependent somatotrophs, lactotrophs, and thyrotrophs. The severity of the hormone deficiency phenotype is compatible with the complete loss of PROP1 activity.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
ANTERIOR pituitary deficiency involving several hormones typically occurs sporadically. When the cause is not an apparent organic lesion, damage from perinatal events is frequently implicated. The finding of a small sella turcica and an ectopic posterior pituitary gland often supports this implication (1). Familial occurrences of multiple anterior pituitary hormone deficiency (MPHD) are unusual and have been described as being transmitted in an autosomal recessive, autosomal dominant, or X-linked recessive manner. Such occurrences also have been characterized by a small or normal sella turcica (2, 3). In the families described by Nader et al. (4) in 1975 and by Parks et al. (5) in 1978, however, MPHD was associated with enlargement of the sella turcica.

Some instances of MPHD have been attributed to dominant and recessive mutations of the gene for pituitary transcription factor, POU1F1 (formerly referred to as Pit-1), which is critical for the differentiation of somatotrophs, thyrotrophs, and lactotrophs. Affected patients have intact corticotropin and gonadotropin functions (6). A similar phenotype in the Ames dwarf mouse is caused by mutation of the PROP1 gene. This gene encodes a paired-like homeodomain protein expressed briefly in embryonic pituitary and necessary for POU1F1 expression (7). Thus, it was anticipated that mutation of the PROP1 gene in humans would result in a clinical picture similar to that in patients with POU1F1 mutations. It has recently been demonstrated in several families as well as in sporadic cases, however, that mutation of the PROP1 gene can cause gonadotropin deficiency in addition to somatotropin, TSH, and PRL deficiencies (8, 9, 10, 11). Some of these individuals have had enlargement of the sella turcica (12).

We are reporting a family from the Dominican Republic with six of nine siblings with MPHD and two affected sisters in another probably related family, who are homozygous for a mutation of the PROP1 gene. These patients are untreated and span a wide age range, providing an opportunity to observe the natural history of this disorder.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
The affected patients included two sisters who were the only offspring of unrelated parents, and six affected of nine children from another nonconsanguineous union. The mothers are thought to be related, and they have the same last name. In addition to the eight patients, both sets of parents and two of the three normal siblings were studied. Examinations were performed by authors A.L.R. and A.S.A. in the subjects’ home village, where blood specimens also were obtained for biochemical and genetic studies. Informed consent was obtained from each of the subjects.

Patient characteristics

Stature was measured in centimeters using a Raven Minimetre (Raven Equipment Ltd., Dunnow, UK) attached to the wall, with the average of three measurements recorded (13). Weight was measured with a balance-beam scale. The SD score for height and height age (age for which height is zero SD score) were estimated from U.S. reference values (14). The body mass index (BMI) was calculated as weight in kilograms divided by the square of height in meters, and comparisons were made to U.S. data for white males and females (15). Hand length was measured across the palmar surface as the distance from the distal wrist crease to the tip of the middle finger. Foot length was recorded as the distance from the heel to the tip of the longest toe along the plantar surface. Head circumference was measured with a flexible tape. A plastic goniometer was used to measure the degree of elbow joint limitation when full extension was not possible. Head circumference, hand length, and foot length were compared to reference values for the U.S. population (16). For calculation of body proportions, arm span and lower body segment (from the top of the symphysis pubis to the floor) were measured; the upper body segment was taken as the height minus the lower body segment (17).

Roentgenograms of the hand and wrist were compared to the standards of Greulich and Pyle to determine bone age (18). Lateral skull films were examined for sellar area by the method of Silverman (19).

Biochemical analyses

Single blood specimens obtained 1 h after clonidine ingestion were separated, and the sera were frozen in dry ice on site. The serum specimens remained frozen until processing at Quest Diagnostics, Inc.-Nichols Institute Diagnostics (San Juan Capistrano, CA). Brief descriptions of the assays follow.

GH was measured by immunochemiluminometric assay (ICMA), using a goat polyclonal antihuman GH labeled with an acridinium ester and a mouse monoclonal GH antibody immobilized on a polystyrene bead; the sensitivity with a 0.2 mL specimen is 0.10 ng/mL. The GH-binding protein (GHBP) concentration was estimated by the ligand-mediated immunofunctional assay. This assay has a sensitivity of 15.6 pmol/L and an interassay variation of less than 12%.

Insulin like growth factor I (IGF-I) and IGF-II concentrations were measured by RIA after acid-ethanol extraction, using specific monoclonal antibodies; the sensitivities for IGF-I and IGF-II are 0.1 and 0 2 ng/mL, respectively. The IGF-binding proteins (IGFBP) were measured without extraction, by RIA, using antibodies that were highly specific for IGFBP-1, IGFBP-2, or IGFBP-3; the sensitivities are 0.4, 0.1, and 3.1 ng/mL, respectively.

LH and FSH concentrations in serum were determined using highly sensitive, third generation ICMA assays, employing capture antibodies immobilized to polystyrene beads and alkaline phosphatase-labeled signal antibodies; the sensitivity is 0.02 IU/L for both methods. Estradiol concentrations were measured after extraction, using ethyl acetate in hexane followed by Celite chromatography purification, with specific RIA using rabbit antiestradiol; the sensitivity is 3 pg/mL. Testosterone was measured by RIA using a rabbit antitestosterone antiserum after ethyl acetate-hexane extraction and Celite chromatography; sensitivity is less than 1 ng/dL.

PRL was measured by ICMA (Ciba Corning ACS-180) using a monoclonal mouse anti-PRL capture antibody and an acridinium ester-labeled polyclonal signal antibody; the sensitivity is 0.3 ng/mL. TSH was measured using a third generation ICMA containing acridinium ester-labeled antibody and a biotin-coupled antibody linked to an avidin-coated polystyrene bead; the sensitivity is 0.01 mU/L. Serum T4 was measured by RIA using a polyclonal anti-T4 and polyethylene glycol separation of bound and free hormone; the sensitivity is 1 µg/dL. Free T4 was measured by direct (equilibrium) dialysis and RIA using a highly sensitive anti-T4 antiserum; the sensitivity is 0.2 ng/dL. Free T3 was measured by tracer (equilibrium) dialysis and RIA. Total T3 was determined by RIA and the free fraction was determined by dialysis; these were performed separately, and the free T3 concentration was calculated as the product of the two. The sensitivities are 25 ng/dL and 0.01%, respectively.

Molecular analysis

Exon 2 of the PROP1 gene was amplified by PCR from 100 ng genomic DNA. Amplification conditions were 100 ng genomic DNA, 0.6 mmol/L primer 13 (TGGTCCAGCACCGAGGAG) and primer 14 (TGCCCAACATTCTATGATAGC), 1.5 mmol/L MgCl2, 1.25 U Taq polymerase (Promega Corp., Madison, WI), 0.2 mmol/L of each deoxy-NTP, and buffer containing 50 mmol/L KCl, 10 mmol/L Tris-HCl (pH 9.0), and 0.1% Triton X-100. The thermal program consisted of preincubation at 95 C for 3 min followed by 30 cycles of 94 C for 45 s, 55 C for 45 s, and 72 C for 60 s, followed by 72 C for 3 min. Normal alleles yielded products of 365 bp, whereas the 2-bp deletion allele yielded 363 bp.

Detection of deletion allele by BcgI digestion of exon 2

PCR products were digested with 6 U BcgI (New England Biolabs, Inc., Beverley, MA) for 1 h at 37 C. Reactions were terminated by heating at 65 C for 20 min. The digestion products were precipitated with ethanol and sodium acetate before separation on 8% PAGE. Gels were stained with ethidium bromide or were silver stained. Digestion of alleles containing the 2-bp deletion yielded products of 234, 97, and 32 bp.

Statistical analysis

All individual data are presented and summarized as means with SDs. Pearson correlation coefficients were calculated using the Statistical Analysis System (SAS Institute, Inc., Cary, NC).


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Patient characteristics

The ages of the patients ranged from 17.5–39.8 yr, and height SD score ranged from -5.9 to -9.6, with modest, but nonsignificant, correlation of height SD score with age, suggesting continued growth through this entire age range (Table 1Go). Parental height SD score varied from -2.3 to -1.2; the two normal siblings in the larger family were at -1.7 for the 22-yr-old woman and -0.3 for the 35-yr-old man. Over the 22-yr age span of the patients, height age varied only 4.9 yr, but correlated with chronological age, further indicating continued growth into the fourth decade of life. With the exception of the tallest individual, who had a height age of 9.9 yr, height age over this age span varied only 1.4 yr, from 5.0–6.4 yr. Bone ages ranged more widely, from 3–13.8 yr, but did not correlate significantly with chronological age for all eight patients or for the six patients from the large family (no. 1 and 4–8) analyzed separately.


View this table:
[in this window]
[in a new window]
 
Table 1. Anthropometric characteristics of patients with familial anterior hypopituitarism

 
There was a wide variation in BMI, with five patients having increased BMI for height age and bone age (>75 percentile); two of these individuals, however, had BMI below the fifth percentile for age along with three other individuals. Only one patient (no. 7) had increased BMI for age. Hand length and foot length were proportionate (10th to 90th percentile for height age) in all but one individual (no. 6), who had small hands (5th percentile) and feet (<3rd percentile).

Body proportion data are shown in Table 2Go. The difference between arm span and height is considered normal if it is within 4 cm of the reference value (20). By this criterion, only one individual had reduced arm span for bone age (no. 7), and none had abnormal span for height. The ratios of upper to lower body segments (U/L) of the patients were all less than normal for U.S. adults, but were comparable to those of the normal sister and brother. The patients’ U/L were substantially lower than normal for height and bone age, indicating disproportionate growth, with the legs growing more than the trunk. Although the ratios of the upper body segment to the lower body segment suggest eunuchoidal proportions, which would be expected to worsen with the duration of hypopituitarism, differences between patients’ U/L and those expected for height or bone age did not increase with age.


View this table:
[in this window]
[in a new window]
 
Table 2. Body proportions and elbow limitation in patients with familial anterior hypopituitarism

 
Limitation of elbow extensibility was noted in six of the eight patients and in all five who were over 23 yr of age (Table 2Go). The younger of the two sisters from one family had the limitation; the other did not. The limitation varied from 8–20° and was usually symmetrical. The degree of elbow mobility correlated with age (r = 0.85; P = 0.005).

Head circumference varied greatly, unrelated to age or statural deviation (Table 3Go). All patients had depressed nasal bridge and immature facies with a relative decrease in the vertical dimension of the face compared to that in unaffected relatives (Figs. 1Go and 2Go). Six patients had blue scleras, excluding patients 1 and 3. All had high-pitched voices. None had any signs of sexual maturation; the four men had testicular volumes ranging from 0.5–1 cc and penis lengths of 2.5–4 cm.


View this table:
[in this window]
[in a new window]
 
Table 3. Head size in patients with familial anterior hypopituitarism

 


View larger version (137K):
[in this window]
[in a new window]
 
Figure 1. Front and profile views of family with six siblings homozygous for the PROP1 mutation causing MPHD. Top row, Mother (age 62 yr) and father (age 64 yr). Second row, Patients 8 and 7 and the normal brother. Third row, Patients 6, 5, and 4. Bottom row, Normal sister and patient 1.

 


View larger version (123K):
[in this window]
[in a new window]
 
Figure 2. Front and profile views of family with two siblings homozygous for the PROP1 mutation causing MPHD. Upper row, Mother (age 45 yr) and father (age 45 yr). Lower row, Patients 3 and 2.

 
Lateral skull roentgenograms were obtained for all patients and the 22-yr-old unaffected sister in the larger family (Fig. 3Go and Table 4Go). Three of the patients had markedly increased sellar area for height age and bone age (no. 1, 4, and 5), which was unrelated to variations in head circumference.



View larger version (192K):
[in this window]
[in a new window]
 
Figure 3. Lateral skull films used to measure sellar area in patients with MPHD resulting from PROP1 deficiency. Top row, Patients 1–3; middle row, patients 4–6; bottom row, patients 7 and 8 and the normal sister. See Table 4Go for measurements. Patients 1, 4, and 5 have sellar enlargement for height and bone age.

 

View this table:
[in this window]
[in a new window]
 
Table 4. Sella turcica area in patients with familial anterior hypopituitarism

 
The parents could not recall any symptoms of hypoglycemia in the patients, nor could the patients recall any such symptoms. Intelligence was normal, with a wide range of school attendance from nil to seventh grade, where the youngest patient is performing above the average for her class. Another patient taught herself to read and write.

Biochemical analyses

GH-IGF axis (Table 5Go). The GH concentrations in serum in response to clonidine ingestion were extremely low. GHBP concentrations were substantially above the normal range in two patients and were just below normal in one. Parents and siblings had GHBP values from 136–363 pmol/L. IGF-I concentrations were extremely low; the mean was approximately 5% of the lower limit of normal. Parents and normal siblings had serum IGF-I concentrations from 100–242 ng/mL. IGF-II concentrations in serum were uniformly low, but less dramatically suppressed than were IGF-I levels; the mean IGF-II level for the patients was 60% of the lower limit of normal. The parents’ and siblings’ values for IGF-II fell in a narrow range of 431–474 ng/mL.


View this table:
[in this window]
[in a new window]
 
Table 5. GH-IGF axis biochemistry in patients with familial anterior hypopituitarism

 
Three patients had serum IGFBP-1 concentrations above the normal range, and one was just below normal. No attempt was made to control for prandial state, a critical factor in assessing serum values for this binding protein. One patient had a serum IGFBP-2 concentration that was just below the normal range, whereas two men (no. 6 and 7) had values above the normal male range; however, so did a father (432 ng/mL) and an unaffected brother (244 ng/mL). IGFBP-3 concentrations in serum were uniformly low, with a mean less than one fourth the lower limit of normal; sibling and parent values ranged from 2.0–2.9 mg/L.

Sex hormones (Table 6Go). Concentrations of LH and FSH in serum were all below normal limits for age. These were completely normal in the unaffected relatives, with menopausal elevation in the 62-yr-old mother. Estradiol and testosterone concentrations were uniformly very low, with no sex differences in the patients. The menopausal mother had a serum concentration of estradiol (10 pg/mL) that was more than twice the mean of the patients and a testosterone concentration (16 ng/dL) higher than those of any of the affected males.


View this table:
[in this window]
[in a new window]
 
Table 6. Sex hormone biochemistry in patients with familial anterior hypopituitarism

 
PRL, thyroid axis, and cortisol (Table 7Go). PRL concentrations in serum were all below the lower limits of normal. Although the only PRL values over 2 ng/mL were found in three of the four youngest subjects, there was no correlation between age and PRL concentrations (r = -0.48; P = 0.23). Serum concentrations of free T4 were uniformly low, with a mean value half that of the lower limit of normal. Total T3 serum concentrations were normal in the four patients under 27 yr of age and were low in the four older individuals. Serum free T3 concentrations were below the lower limit of normal in all but one individual and were lowest in the older patients. All TSH serum concentrations were normal.


View this table:
[in this window]
[in a new window]
 
Table 7. Cortisol, PRL, and thyroid biochemistry in patients with familial anterior hypopituitarism

 
Serum cortisol concentrations determined between 1300–1600 h were all normal. The lowest value, in patient 2, was found at 1600 h. The parents and normal siblings had serum cortisol levels comparable to those of the patients, from 8–16 µg/dL.

Molecular genetic analysis (Fig. 4Go)

DNA specimens from the eight affected individuals and their parents were screened for the presence of a 2-bp deletion in exon 2 of the PROP1 gene. The products of PCR amplification were digested with BcgI and run on polyacrylamide gels, silver stained, and photographed. Digestion of the wild-type allele produced a single band at 365 bp. Alleles with the 2-bp 296delGA mutation generated bands of 234 and 97 bp, and a 32-bp band that migrates off the gel. The parents in families 1 and 2 were heterozygous for 296delGA, whereas all affected individuals were homozygous for the deletion allele, and the two normal siblings in family 1 were homozygous for the wild-type allele. The presence of 296delGA was confirmed by direct DNA sequencing



View larger version (52K):
[in this window]
[in a new window]
 
Figure 4. Gel analysis of exon 2 of the PROP1 gene of parents, affected siblings, and normal siblings in two families with MPHD due to the PROP1 mutation. Exon 2 of PROP-1 was amplified from genomic DNA, and the products were digested with BcgI. Digestion products were separated on 8% polyacrylamide gels and detected with silver stain. Digestion of the wild-type allele produces a single band at 365 bp. Alleles with the 2-bp 296delGA mutation generated bands of 234 and 97 bp, and a 32-bp band that migrates off the gel. The sibships in the pedigrees correspond to the descending age order of the photographs in Figs. 1Go and 2Go.

 

    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
We have described the clinical, biochemical, and genetic characteristics of the largest family identified to date with PROP1 gene mutation, involving six siblings and two sisters in another family that is probably related to them. There is an even sex distribution, and the parents are heterozygous for the mutation, confirming autosomal recessive inheritance.

The severe deficiency of GH and IGF-I, with absence of adolescent development and mild hypothyroidism, led to marked growth failure with only a modest increase in height age with age. The height SD score, however, did not correlate significantly with age, although the tallest individual was the second oldest. Considerable heterogeneity was seen in osseous maturation, which also did not correlate with age. All bone ages, except for that of the youngest patient, were more advanced than height ages, a phenomenon that has been described in GH receptor deficiency (GHRD) and severe GH deficiency (GHD) due to GH gene deletion (21). In most instances of GHD, osseous maturation is less than or equal to height age; the addition of thyroid deficiency would be expected to enhance this discrepancy, but this was the case only in the youngest patient.

The finding of generally normal hand and foot lengths is very different from observations in patients with severe IGF-I deficiency due to GHRD. Over 70% of both children and adults with GHRD have small hands or feet, as herein defined, less than the 10th percentile for height (22). This difference in hand and foot growth does not reflect a difference in overall severity of growth failure, as SD scores for height are comparable in these conditions. Neither can this difference be related to the failure of sexual maturation in the Dominican patients as opposed to the normal, although often delayed, sexual maturation in patients with GHRD; the relatively small hands and feet are present before adolescence in the latter condition (22).

It is of interest to compare the body proportions and body composition in these patients who have deficiencies of IGF-I, thyroid function, and sex steroids to those of patients with GHRD who have comparable IGF-I deficiency, but normal thyroid and gonadal function. With severe IGF-I deficiency due to GHRD, body proportions are normal before puberty, whereas in adults, the limbs are relatively short (22). The patients with MPHD maintained bone ages that were prepubertal, or early pubertal (patient 7), into adulthood in the absence of sex steroids. Their continued slow growth, impaired by both GH and thyroid deficiency, was associated with very different adult body proportions than those seen with GHRD, with normal arm span and increased lower segments for height and bone age. In subjects with GHRD, the percent ideal body weight for height increases with age, and almost all postpubertal women and two thirds of the men are above 120% ideal body weight (22). In this study obesity was estimated using BMI. Although the youngest patient (no. 1) had the lowest BMI for height, there was no correlation between age and BMI percentile for height (r = 0.23). Among eight Russian patients, aged 10–17.7 yr, from six families with MPHD due to PROP1 mutations, the BMI percentile for height was more than 75% in four of the six females only (10). In contrast to the present report, the BMI percentile for height correlated significantly with chronological age (r = 0.63; P = 0.05). That five subjects in our study had substantially increased BMI percentile for height and the correlation of this measure of obesity with age in a pediatric population with MPHD from PROP1 mutation indicate that the obesity seen only with adulthood in the GHRD subjects is not entirely an effect of sexual maturation in the IGF-deficient state.

Limitation of elbow extensibility, initially observed in 85% of Ecuadorian patients with GHRD after 5 yr of age and with increasing severity with age, has not been described in GHD (22). The cause of this limitation is not known, but its occurrence in both of these conditions indicates that the limitation is the result of GH-IGF-I deficiency.

Three of the eight patients had head circumference measurements greater than 2 SD below the mean for height, and five had measurements more than 2 SD below the mean for bone age. All but one had a head circumference that was more than 2.2 SD below the mean for chronological age. Head circumference was considered to be normal for height in GHD and GHRD (23). The reason for the reduced head size in these Dominican patients is unclear. Two of the three with sellar enlargement were among those with normal head size.

As has been previously noted with hypopituitarism due to PROP1 mutation, sellar enlargement varied within our patient group (12). Furthermore, enlargement may not be detected initially, but may appear during follow-up (12, 24). The mass may evolve into a radiological appearance of empty sella, with a rim of residual pituitary tissue.

Serum concentrations of IGF-I were comparable to those recorded for children with GHRD, but were much lower than those seen in adults with GHRD (22). This observation is consistent with the hypothesis that the significant increase in serum IGF-I concentrations in adults compared to children with GHRD is a direct effect of sex steroids.

The reduced serum concentrations of IGFBP-3 are typical of GHD, whereas the normality of IGFBP-2 concentrations, with the exception of one patient who had a lower than normal value, is unexpected. Patients with GHD or GHRD have elevated levels of IGFBP-2, which increase further with replacement therapy (25). Other GH- or IGF-I-deficient patients also have elevated IGFBP-1 serum concentrations, reflecting hypoinsulinemia (26). The lack of consistency for such a finding in this study, with only three patients having elevations, is probably due to the variation in their fasting status at the time of testing.

Gonadotropin and sex steroid concentrations in serum were extremely low and did not vary with age or gender, indicating hypopituitary hypogonadism. PRL concentrations also were low. Afternoon cortisol levels were all normal, with no age correlations to suggest deteriorating ACTH secretion.

The affected individuals in this series were all homozygous for a GA or an AG deletion in the sequence 296GAGAGAG in exon 2 of PROP1. Similar deletion alleles were present in the homozygous state in two families and in the compound heterozygous state in one of the four families with PROP1 deficiency reported by Wu et al. (8). The same mutation has been noted in patients of Russian (9, 11), Turkish (11), Jamaican (12), U.S. (12), and Brazilian (11, 12) descent. The series of three dinucleotide repeats appears to be a mutational hot spot, with susceptibility to misalignment of DNA generating slippage and deletion independently in different populations. Another mutational hot spot has recently been described that also results in a 2-bp deletion in exon 2 (149delGA) that leads to the same serine to stop codon change at codon 109 and is present as a compound heterozygote with the 296delGA mutation in children with MPHD from four Russian families (10). It is entirely possible that a single mutational event was responsible for PROP1 deficiency in the eight affected individuals in a single small village. The 296GAdel mutation represents a severe loss of function mutation. The altered sequence predicts a protein of 108 amino acids with a frameshift and truncation in the second {alpha}-helix of the DNA-binding domain. When expressed in a mouse PROP1 context, the recombinant protein lacks detectable DNA-binding and transcriptional activation activities (8). The severity of the hormone deficiency phenotype is compatible with the complete loss of PROP1 activity.


    Acknowledgments
 
We thank the following individuals for their assistance: Antonio Selman Geara, M.D., Roger M. Kulstad Gonzalez, and Franklin R. Montero Contreras, M.D., of Santo Domingo, Dominican Republic; Esther Carlton, David Asher, and J. C. Tercero of Quest Diagnostics, Inc.-Nichols Institute Diagnostics; and Edith K. Rosenbloom of Gainesville, FL.


    Footnotes
 
1 This work was supported by NIH Grant DK-45830 (to A.L.R.) and Genentech, Inc. Foundation Grant 97–27 (to J.S.P.). Back

Received August 7, 1998.

Revised September 18, 1998.

Accepted September 22, 1998.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Underwood LE, Radcliffe WB, Strickland AL, Van Wyk JJ. 1973 Assessment of the sella turcica volume in dwarfed children. J Clin Endocrinol Metab. 36:734–741.[Medline]
  2. Phelan PD, Connelly J, Martin FIR, et al. 1971 X-linked recessive hypopituitarism. Birth Defects. 7:24–27.
  3. Adler-Bier M, Pertzelan A, Laron Z, Lieberman E, Moses S. 1979 Multiple pituitary hormone deficiencies in eight siblings of one Jewish Moroccan family. Acta Paediatr Scand. 68:401–404.[Medline]
  4. Nader S, Fisher JA, Doyle FH, Mashiter K, Joplin GF. 1975 Familial dwarfism: case report. Postgrad Med J. 51:676–681.[Medline]
  5. Parks JS, Tenore A, Bongiovanni AM, Kirkland RT. 1978 Familial hypopituitarism with large sella turcica. N Engl J Med. 298:698–702.[Abstract]
  6. Parks JS, Brown MR, Abdul-Latif H, Kinoshita E. 1995 Abnormalities of the pituitary-specific transcription factor-1 gene and protein. Clin Pediatr Endocrinol. 4:33–39.
  7. Sornson MW, Wu W, Dasen JS, et al. 1996 Pituitary lineage determination by the Prophet of Pit-1 homeodomain factor defective in Ames dwarfism. Nature. 384:327–333.[CrossRef][Medline]
  8. Wu W, Cogan JD, Pfaffle RW, et al. 1998 Mutations in PROP1 cause familial combined pituitary hormone deficiency. Nat Genet. 18:147–149.[CrossRef][Medline]
  9. Fofanova OV, Takamura N, Kinoshita E, et al. 1998 A mutational hot spot in the Prop-1 gene in Russian children with combined pituitary hormone deficiency. Pituitary. 1:45–49.[CrossRef][Medline]
  10. Fofanova O, Takamura N, Kinoshita E, et al. 1998 Compound heterozygous deletion of the PROP1 gene in children with combined pituitary hormone deficiency. J Clin Endocrinol Metab. 83:2601–2604.[Abstract/Free Full Text]
  11. Cogan JD, Wu W, Phillips JA, at al. 1998 The PROP-1 2 bp deletion is a common cause of combined pituitary hormone deficiency. J Clin Endocrinol Metab. 83:3346–3349.[Abstract/Free Full Text]
  12. Parks JS, Brown MR, Baumbach L, et al. Natural history and molecular mechanisms of hypopituitarism with large sella turcica. Proc of the 80th Annual Meet of The Endocrine Soc. 1998; 471.
  13. Diamond FB Jr, Guevara-Aguirre J, Rosenbloom AL. 1994 Accurate determination of height using an inexpensive measuring device. Clin Pediatr. 33:172–174.
  14. National Center for Health Statistics. Hamil PVV. 1977 NCHS. growth curves for children birth-18 years: United States. Vital and health statistics, ser 11, no. 165. Washington DC: U.S. Government Printing Office. DHEW publication (PHS) 78–1650.
  15. Hammer LD, Kraemer HC, Wilson DM, Ritter PL, Dornbusch SM. 1991 Standardized percentile curves of body mass index for children and adolescents. Am J Dis Child. 145:259–263.[Abstract]
  16. Jones KL. 1997 Smith’s recognizable patterns of malformation, 5th ed. Philadelphia: Saunders; 758–763.
  17. Wilkins L. 1965 The diagnosis and treatment of endocrine disorders in childhood and adolescence, 3rd ed. Springfield: Thomas; 33.
  18. Greulich WW, Pyle SI. 1959 Radiographic atlas of skeletal development of the hand and wrist, 2nd ed. Stanford: Stanford University Press.
  19. Silverman FN. 1957 Roentgen standards for a size of the pituitary fossa from infancy through adolescence. Am J Roentgenol. 78:451–460.
  20. Hall JG, Froster- Iskenius UG, Allanson JE. 1989 Handbook of normal physical measurements. Toronto: Oxford University Press; 224–226.
  21. Rosenbloom AL, Guevara-Aguirre J, Rosenfeld RG, Pollock BH. 1994 Growth in growth hormone insensitivity. Trends Endocrinol Metab. 5:296–303.[Medline]
  22. Rosenbloom AL, Guevara-Aguirre J, Fielder PJ, et al. 1993 Growth hormone receptor deficiency/Laron syndrome in Ecuador: clinical and biochemical characteristics. In: Laron Z, Parks JS, eds. Lessons from Laron syndrome (LS) 1966–1992. Pediatric and Adolescent Endocrinology. Basel: Karger, vol 24:34–52.
  23. Schaefer GB, Rosenbloom AL, Guevara-Aguirre J, et al. 1994 Facial morphometry of Ecuadorian patients with growth hormone receptor deficiency/Laron syndrome. J Med Genet. 31:635–639.[Abstract]
  24. White MC, Chahal P, Banks L, Joplin GF. 1986 Familial hypopituitarism associated with an enlarged pituitary fossa and an empty sella. Clin Endocrinol (Oxf). 24:63–70.[Medline]
  25. Vaccarello MA, Diamond FB Jr, Guevara-Aguirre J, et al. 1993 Hormonal and metabolic effects and pharmacokinetics of recombinant human insulin-like growth factor-I in growth hormone receptor deficiency/Laron syndrome. J Clin Endocrinol Metab. 77:273–280.[Abstract]
  26. Rajaram S, Baylink DJ, Mohan S. 1997 Insulin-like growth factor-binding proteins in serum and other biological fluids: regulation and functions. Endocr Rev. 18:801–31.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Neuroradiol.Home page
L.L.F. do Amaral, R.M. Ferreira, N.P.F.D. Ferreira, R.A. Mendonca, V.H.R. Marussi, J.L. da Cunha, B.R. Macaranduba, and J.D. Medeiros
Combined Pituitary Hormone Deficiency and PROP-1 Mutation in Two Siblings: A Distinct MR Imaging Pattern of Pituitary Enlargement
AJNR Am. J. Neuroradiol., August 1, 2007; 28(7): 1369 - 1370.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
M J E Walenkamp and J M Wit
Genetic disorders in the GH IGF-I axis in mouse and man
Eur. J. Endocrinol., August 1, 2007; 157(suppl_1): S15 - S26.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
J. Lebl, J. Vosahlo, R. W Pfaeffle, H. Stobbe, J. Cerna, D. Novotna, J. Zapletalova, B. Kalvachova, V. Hana, V. Weiss, et al.
Auxological and endocrine phenotype in a population-based cohort of patients with PROP1 gene defects
Eur. J. Endocrinol., September 1, 2005; 153(3): 389 - 396.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. J. E. Walenkamp, M. Karperien, A. M. Pereira, Y. Hilhorst-Hofstee, J. van Doorn, J. W. Chen, S. Mohan, A. Denley, B. Forbes, H. A. van Duyvenvoorde, et al.
Homozygous and Heterozygous Expression of a Novel Insulin-Like Growth Factor-I Mutation
J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 2855 - 2864.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
P. E Mullis
Genetic control of growth
Eur. J. Endocrinol., January 1, 2005; 152(1): 11 - 31.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. Reynaud, M. Chadli-Chaieb, S. Vallette-Kasic, A. Barlier, J. Sarles, I. Pellegrini-Bouiller, A. Enjalbert, L. Chaieb, and T. Brue
A Familial Form of Congenital Hypopituitarism Due to a PROP1 Mutation in a Large Kindred: Phenotypic and in Vitro Functional Studies
J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5779 - 5786.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. K. Lee, Y.-S. Zhu, J. J. Cordero, L.-Q. Cai, I. Labour, C. Herrera, and J. Imperato-McGinley
Long-Term Growth Hormone Therapy in Adulthood Results in Significant Linear Growth in Siblings with a PROP-1 Gene Mutation
J. Clin. Endocrinol. Metab., October 1, 2004; 89(10): 4850 - 4856.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Bottner, E. Keller, J. Kratzsch, H. Stobbe, J. F. W. Weigel, A. Keller, W. Hirsch, W. Kiess, W. F. Blum, and R. W. Pfaffle
PROP1 Mutations Cause Progressive Deterioration of Anterior Pituitary Function including Adrenal Insufficiency: A Longitudinal Analysis
J. Clin. Endocrinol. Metab., October 1, 2004; 89(10): 5256 - 5265.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Voutetakis, M. Argyropoulou, A. Sertedaki, S. Livadas, P. Xekouki, M. Maniati-Christidi, I. Bossis, N. Thalassinos, N. Patronas, and C. Dacou-Voutetakis
Pituitary Magnetic Resonance Imaging in 15 Patients with Prop1 Gene Mutations: Pituitary Enlargement May Originate from the Intermediate Lobe
J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2200 - 2206.
[Abstract] [Full Text] [PDF]


Home page
Sci Aging Knowl EnvironHome page
R. J. Davenport
Power to the People
Sci. Aging Knowl. Environ., December 17, 2003; 2003(50): ns8 - 8.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. N. Cohen, L. E. Cohen, D. Botero, C. Yu, A. Sagar, M. Jurkiewicz, and S. Radovick
Enhanced Repression by HESX1 as a Cause of Hypopituitarism and Septooptic Dysplasia
J. Clin. Endocrinol. Metab., October 1, 2003; 88(10): 4832 - 4839.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
T. C. Vieira, M. R. Dias da Silva, J. M. Cerutti, E. Brunner, M. Borges, L. T. Arnaldi, P. Kopp, and J. Abucham
Familial Combined Pituitary Hormone Deficiency due to a Novel Mutation R99Q in the Hot Spot Region of Prophet of Pit-1 Presenting as Constitutional Growth Delay
J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 38 - 44.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
L. E. Cohen and S. Radovick
Molecular Basis of Combined Pituitary Hormone Deficiencies
Endocr. Rev., August 1, 2002; 23(4): 431 - 442.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. N. Kalantaridou and G. P. Chrousos
Monogenic Disorders of Puberty
J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2481 - 2494.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
F. G. Riepe, C.-J. Partsch, O. Blankenstein, H. Monig, R. W. Pfaffle, and W. G. Sippell
Longitudinal Imaging Reveals Pituitary Enlargement Preceding Hypoplasia in Two Brothers with Combined Pituitary Hormone Deficiency Attributable to PROP1 Mutation
J. Clin. Endocrinol. Metab., September 1, 2001; 86(9): 4353 - 4357.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. G. F. Osorio, P. Kopp, S. Marui, A. C. Latronico, B. B. Mendonca, and I. J. P. Arnhold
Combined Pituitary Hormone Deficiency Caused by a Novel Mutation of a Highly Conserved Residue (F88S) in the Homeodomain of PROP-1
J. Clin. Endocrinol. Metab., August 1, 2000; 85(8): 2779 - 2785.
[Abstract] [Full Text]


Home page
Am. J. Roentgenol.Home page
O. Fofanova, N. Takamura, E.-i. Kinoshita, A. Vorontsov, V. Vladimirova, I. Dedov, V. Peterkova, and S. Yamashita
MR Imaging of the Pituitary Gland in Children and Young Adults with Congenital Combined Pituitary Hormone Deficiency Associated with PROP1 Mutations
Am. J. Roentgenol., February 1, 2000; 174(2): 555 - 559.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
F. Pernasetti, S. P. A. Toledo, V. V. Vasilyev, C. Y. Hayashida, J. D. Cogan, C. Ferrari, D. M. Lourenço, and P. L. Mellon
Impaired Adrenocorticotropin-Adrenal Axis in Combined Pituitary Hormone Deficiency Caused by a Two-Base Pair Deletion (301-302delAG) in the Prophet of Pit-1 Gene
J. Clin. Endocrinol. Metab., January 1, 2000; 85(1): 390 - 397.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rosenbloom, A. L.
Right arrow Articles by Parks, J. S.
Right arrow