| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Medicine Branch (M.V.B., P.G., M.W., S.B., T.F.) and Laboratory of Genetics (L.Y.R.), National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892; and the Thyroid Cancer Research Laboratory (K.B.A.), Department of Internal Medicine, Veterans Administration Medical Center, University of Kentucky Medical Center, Lexington, Kentucky 40536
Address all correspondence and requests for reprints to: Dr. Tito Fojo, Medicine Branch, National Institutes of Health, Building 10, Room 12N226, 9000 Rockville Pike, Bethesda, Maryland 20892. E-mail: tfojo{at}helix.nih.gov
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials And MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials And MethodsResultsDiscussionReferences |
|---|
Although the molecular changes responsible for the aggressive behavior remain to be elucidated, a consistent observation has been a higher frequency of mutations in the p53 tumor suppressor gene in anaplastic thyroid cancers (3). Thus, in one study using immunohistochemistry, p53 expression was found in 62.5% of undifferentiated carcinomas, but in only 5% of other types of thyroid carcinomas (4); in another report, p53 was detected in 11.1% of well differentiated, 40.9% of poorly differentiated, and 63.6% of undifferentiated carcinomas (5). As mutations of the p53 gene are associated with the most aggressive histologic types of thyroid tumors, including anaplastic thyroid cancers, it appears that alterations in p53 represent a late genetic event in human thyroid carcinogenesis (6). Based on these data, it has been proposed that mutations in the p53 gene are responsible for the progression from differentiated into anaplastic carcinoma (7, 8, 9). Moreover, it has been demonstrated that introduction of wild-type (wt) p53 can induce differentiation in some thyroid cancer cell lines (10, 11).
The aggressive clinical behavior of anaplastic thyroid cancer includes a lack of sensitivity to the majority of available chemotherapeutic agents. Although it is likely this resistance is multifactorial, it may be explained to some extent by the high frequency of p53 mutations, as wt p53 may be important for apoptosis and growth arrest after the administration of DNA-damaging drugs (12, 13).
In the present study we report three anaplastic thyroid cancer cells lines with nonfunctional p53 characterized by a lack of induction after exposure to DNA-damaging drugs. To further address the role of p53 in anaplastic thyroid carcinomas, we employed a p53-expressing adenovirus (Ad-p53). Introduction of wt p53 resulted in the induction of p21 and Mdm-2, confirming that the pathway downstream of p53 was intact. Furthermore, introduction of wt p53 increased sensitivity to adriamycin and cisplatin in all three anaplastic thyroid cancer cell lines.
|
Materials And Methods |
|---|
|
TopAbstractIntroductionMaterials And MethodsResultsDiscussionReferences |
|---|
All of the cell lines were derived from primary cultures of human anaplastic thyroid carcinoma tumors. BHT-101 was provided by Istvan Palyi (National Institute of Oncology, Budapest, Hungary). SW-1736 was developed by Drs. Leibowitz and McCombs III at the Scott and White Memorial Hospital (Temple, TX) in 1977 and was provided by Nils-Erik Heldin (Uppsala University, Uppsala, Sweden). KAT-4 was developed and maintained in one of our laboratories (that of K.B.A.). The three cell lines were maintained in RPMI medium containing 10% FBS.
Adenovirus infections
Ad-lacZ, a ß-galactosidase expressing replication-deficient adenovirus, and Ad-p53, a wild-type p53-expressing replication-deficient adenovirus, were gifts from Dr. Bert Vogelstein (Johns Hopkins University, Baltimore, MD). Adenovirus titers were determined by plaque formation after infection of 293 cells. The multiplicity of infection (MOI) was defined as the ratio of the total number of plaque-forming units used in a particular infection divided by the number of cells. X-Galactosidase staining of Ad-lacZ-infected tumor cells was performed 1 day after infection (14).
PCR amplification and sequence analysis of p53 and ß-tubulin
RT of 1 µg total ribonucleic acid (RNA) was performed using a primer complimentary to p53 sequences downstream of exon 9: 5'-1022GTTCCGAGAGCTGAATGAGGC1042-3'. PCR amplifications of p53 were performed using 2.5 mmol/L MgCl2, an annealing temperature of 55 C for 40 cycles, and a primer upstream of exon 5: 5'-339TTCTTGCATTCTGGGACAGCC359-3' together with the primer used in the RT reaction. Using RNA from SW-1736 cells, a PCR product was not obtained even after 45 cycles of PCR amplification. Therefore, for SW-1736 RNA, PCR amplification of p53 was performed using two different sets of primers that gave smaller PCR products, allowing for amplification and sequencing of p53 exons 5–9. The primer pairs used in these reactions included: A, the primer corresponding to residues 339–359 as the 5'-primer together with a primer complimentary to residues 786–804 as the 3'-primer 5'-786GGTAATCTACTGGGACGGA804-3'; and B, a primer corresponding to residues 751–770 (751CCATCCTCACCATCATCAC770) as the 5'-primer together with the primer complimentary to residues 1022–1042 as the 3'-primer. PCR product was purified with PCR Select-III spin columns (5 Prime-3 Prime, Boulder, CO) and directly sequenced with the Taq DyeDeoxy Terminator Cycle Sequencing Kit following the manufacturer’s instructions (Applied Biosystems, Foster City, CA). Two primers were used for sequencing in addition to the above-described primers: a primer corresponding to residues 569–588 (569CCTCCTCAGCATCTTATCC588) and a primer complimentary to residues 686–706 (686CTGTACCACCATCCACTACAA706). The reaction products were purified with Centri-Sep spin purification columns (Princeton Separations, Adelphia, NJ), electrophoresed on 48-cm 4.75% polyacrylamide/urea gels, and analyzed by an automated DNA sequencing system (model 377A, Applied Biosystems). PCR amplification of the widely expressed isotype of ß-tubulin M40 was performed as previously described (15).
Immunoblot analysis
Cells plated at a density of 4 x 105/well in six-well plates were treated with drugs or infected with adenovirus. After incubation for the indicated times, cells were lysed and 20 µg protein were separated by electrophoresis through 12.5 (p21, p53, and tubulin) or 7.5% SDS-PAGE gels (Rb, Mdm-2, and p53) as previously described (15). Immunoblotting was performed using mouse antihuman WAF-1 (EA10), p53 (PAb 1801), Rb, and Mdm-2 (Oncogene Science, Cambridge, MA) as previously described (16).
Growth inhibition and cell viability
Cells were plated at a density of 2500–5000/well in 96-well plates in 0.1 mL medium in triplicate. Twenty-four hours later, adenovirus infection was performed as described above. Chemotherapeutic drugs were added 1 h after adenovirus infections. Three days later, MTT viability assays were performed (14).
|
Results |
|---|
|
TopAbstractIntroductionMaterials And MethodsResultsDiscussionReferences |
|---|
Under normal circumstances, wt p53 protein accumulates after treatment with DNA-damaging agents and induces the transcription of target genes, including p21WAF1/CIP1 and mdm-2. Induction of p21, in turn, inactivates cyclin-dependent kinases that phosphorylate Rb, resulting in its dephosphorylation. Therefore, accumulation of p53 protein, induction of p21 and Mdm-2, and dephosphorylation of Rb are markers of a functional p53.
The levels of p53 protein were highest in KAT-4 cells, a hallmark of
mutant p53; intermediate levels were observed in BHT-101 cells, and
very low to undetectable levels were found in SW-1736 cells (Fig. 1
). Furthermore, treatment with either
adriamycin or mitomycin C did not increase p53 levels or result in
detectable p21 or Mdm-2 and did not cause Rb dephosphorylation.
Therefore, p53 is functionally inactive in all three cell lines. In
agreement with this, sequence analysis revealed mutant p53
status in two of the three cell lines with a substitution in codon 251
in BHT-101 (ATC
ACC; IleThr) and a
substitution in codon 273 in KAT-4 (CGTCAT;
ArgHis). A mutation could not be identified in RNA from SW-1736
cells, which was found on sequence analysis to be wt in exons 5–9.
However, as shown in Fig. 2, consistent
with the low levels of p53 protein, expression of p53 was
markedly reduced, precluding normal p53 protein expression and
function. This pseudo-null p53 status of SW-1736 was functionally
equivalent to a p53 null phenotype.
|
|
Infection of the BHT-101 and SW-1736 cell lines with an adenovirus
containing wt p53 (Ad-p53) resulted in rapid accumulation of p53
protein by 10 h (Fig. 1C
). In KAT-4 cells, the increase in p53
protein was not readily apparent because of the very high levels of
endogenous p53. In all three cell lines, introduction of wt p53
resulted in induction of p21 and Mdm-2 proteins, indicating that the
lack of p21 and Mdm-2 induction after DNA-damaging drugs was a
consequence of a nonfunctional p53 and not defective mdm-2
or p21. Induction of p21 reached maximal levels 1 day after infection
of BHT-101 or SW-1736 cells, but not KAT-4 cells (Fig. 3). With KAT-4 cells it was possible to
obtain comparable induction using a higher dose of Ad-p53 (40 MOI) or a
longer incubation time (48 h). Although it has been suggested that
deletion of p21 may be involved in thyroid carcinogenesis (17), in all
three cell lines we found defects in p53, but not p21.
|
The differential sensitivity to Ad-p53 cytotoxicity correlated
with the kinetics of induction of p53-responsive proteins. BHT-101 and
SW-1736 cells were sensitive to p53. In these two cell lines, induction
of both p21 and Mdm-2 after reintroduction of wt p53 occurred within
10 h, and in BHT-101 cells it began to decline by 40 h. In
contrast, induction of p21 in KAT-4 cells was delayed (Fig. 3).
Quantitatively, 3 days after infection with 2 MOI of Ad p53, only 50%
of BHT-101 cells were alive. SW-1736 cells were also very sensitive to
Ad p53, with a 50% survival 3 days after infection with 8 MOI of Ad
p53. The cytotoxicity of Ad-p53 was p53 specific, as shown in Fig. 3C, which depicts the lack of a significant cytotoxic effect of a control
Ad-lacZ adenovirus lacking p53 even at a MOI of 64. In
contrast, KAT-4 cells were as resistant to Ad-p53 as they were to
Ad-lacZ.
Resistance of KAT-4 cells to Ad-p53 is associated with low infectivity
Although the high levels of nonfunctional p53 present in KAT cells
could explain the blunted induction of p53-inducible proteins, we
considered the possibility that, instead, low infectivity could explain
these observations. The expression of p53 was not considered a reliable
marker because of the very high levels of endogenous mt p53 in KAT-4
cells. Therefore, we compared the expression of ß-galactosidase after
infection with a ß-galactosidase-expressing adenovirus
(Ad-lacZ). Expression of Ad-lacZ required a
10-fold higher MOI in KAT-4 cells than in BHT-101 cells (Fig. 4). Nearly all BHT-101 cells were
infected at a MOI of 2 (Fig. 4B), with increased intensity of staining
observed with increasing MOI. In contrast, about 10% of KAT-4 cells
stained for ß-galactosidase at a MOI of 2 (data not shown),
whereas the majority of cells were positive only when a MOI of 20 was
used (Fig. 4C). As all KAT-4 cells were infected at a MOI above 20, we
can conclude that KAT-4 cells were refractory to p53-mediated
cytotoxicity.
|
To determine whether wt p53 could enhance drug cytotoxicity, we
infected cells with Ad-p53 and examined drug sensitivity after
infection (Fig. 5). Infection with Ad-p53
rendered all cells more sensitive to adriamycin; the only difference
was the amount of Ad-p53 required for sensitization. The results
paralleled the Ad-p53 sensitivity, with enhanced adriamycin
cytotoxicity occurring at a MOI of 2 with BHT-101 and SW-1736 cells,
but only at a MOI of 64 with KAT-4 cells. For example, a MOI of 2
sensitized both BHT-101 and SW-1736 cells, so that the IC50
of adriamycin was approximately 20 ng/mL, but a MOI of 64 was required
to achieve comparable sensitization with KAT-4 cells.
|
Although SW-1736 cells underwent morphological changes after
infection with wt p53 (Fig. 6), no
induction of messenger RNA (mRNA) for TSH receptor, thyroglobulin, or
thyroid peroxidase expression could be demonstrated by PCR (data not
shown). Therefore, introduction of wt p53 caused p53-specific, but not
tissue-specific, responses that correlated with the cytotoxic effects
of p53 in these cells. In addition, treatment with adriamycin resulted
in marked morphologic alterations (Fig. 6).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials And MethodsResultsDiscussionReferences |
|---|
Although emphasis has been placed on the possible role of p53 mutations in thyroid dedifferentiation, p53 mutations may also contribute to the resistance of anaplastic carcinoma to chemotherapy. In the present study we demonstrate that treatment with DNA-damaging drugs did not result in induction of p53 or stimulation of the downstream genes, p21 and mdm-2. Reintroduction of wt p53 using an adenovirus vector was able to induce these changes. Moreover, the cellular response correlated with the cytotoxicity of Ad-p53. BHT-101 and SW-1736 were very sensitive to the cytotoxic effect of Ad-p53, with IC50 values of 2 and 8 MOI, respectively. In contrast, a delayed and blunted response of KAT-4 cells to p53 correlated with a low cytotoxicity of Ad-p53 against these cells. The resistance of KAT-4 cells to Ad-p53 can be explained in at least two nonmutually exclusive ways. The first is a low infectivity of KAT-4 cells. Indeed, 10-fold higher doses of Ad-lacZ were needed to achieve the same degree of ß-galactosidase staining in KAT-4 as in BHT-101 cells. Second, expressed wt p53 may be blocked by mutant p53 (18) or Mdm-2 (19) proteins, both of which were expressed at high levels in KAT-4 cells.
Although p53 caused marked morphological changes in SW-1736 cells, we did not find reexpression of thyroid-specific TSH receptor or thyroglobulin. This contrasts with previous observations in cells stably transfected with a temperature-sensitive murine p53 that reacquired the ability to respond to TSH stimulation (10). However, as ARO cells are not anaplastic and express thyroid-specific genes before transfection, a direct comparison is not possible. In a separate study, papillary carcinoma cells stably transfected with wt p53 were shown to express thyroid peroxidase (TPO). However, as emphasized by the researchers, the yield of transfectants was low, and only one wt p53-overexpressing clone that expressed TPO was isolated (11). Moreover, wt p53 did not directly stimulate the transcriptional activity of a TPO promoter construct (11). The possibilities that the expression of wt p53 is better tolerated by well differentiated thyroid cells, and that the expression of wt p53 led to the selection of a well differentiated papillary carcinoma clone cannot be excluded. Additional studies, consistent with this limited effect of wt p53 expression on thyroid differentiation, showed that inactivation of wt p53 by mt p53 did not result in an anaplastic phenotype, although loss of some tissue-specific markers was reported (3). The results in the present study and the available data suggest that p53 that does not directly control the expression of thyroid-specific genes. However, genomic instability secondary to mt p53 may lead to dedifferentiation and thus could explain the clinical observation that a majority of anaplastic thyroid carcinomas have mutant p53. Alternately, loss of wt p53 function could permit the growth of rapidly growing anaplastic cells that would otherwise be eliminated by wt p53.
Although the problem facing physicians treating anaplastic thyroid carcinoma is a systemic dissemination of disease, this tumor often presents as locally advanced disease, requiring multimodality therapy (2). Adjuvant chemotherapy and radiotherapy have been used in attempts to enhance local control, with only moderate success (2). The present study suggests that although p53 expression may not have a significant impact on the differentiation of anaplastic thyroid carcinomas, it may have a role in chemosensitivity. The advent of therapeutic strategies that target molecular markers such as p53 may provide additional treatment options in patients with localized anaplastic thyroid carcinoma. Such approaches are being actively investigated in head and neck cancers, and have targeted the p53 gene either by attempting to eradicate cells expressing mutant p53 (20) or by trying to restore normal function (21). Here we showed that expression of wt p53 increased the sensitivity of all three cell lines to adriamycin (10-fold decrease in IC50). Similarly, wt p53 increased the sensitivity of KAT-4 cells to cisplatin (not shown). Local administration of Ad-p53 in conjunction with systemic therapy with DNA-damaging drugs could be useful in the treatment of locally advanced anaplastic carcinomas.
Finally, we did observe that adriamycin and cisplatin induced morphological alterations in SW-1736 cells. A previous study reported conversion of noniodine-concentrat-ing differentiated thyroid carcinoma metastasis into iodine-concentrating foci after anticancer chemotherapy (22). The patient presented with metastatic papillary carcinoma and was treated with cisplatin and doxorubicin. Repeat 131I imaging after three cycles of chemotherapy showed significant 131I uptake in previously noniodine-concentrating lesions. Although these must be regarded as preliminary observations, additional studies are planned to determine whether the combination of chemotherapy and wt p53 can cause differentiation.
Received December 3, 1997.
Revised February 25, 1998.
Accepted April 14, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials And MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  R. Malaguarnera, V. Vella, G. Pandini, M. Sanfilippo, V. Pezzino, R. Vigneri, and F. Frasca TAp73{alpha} Increases p53 Tumor Suppressor Activity in Thyroid Cancer Cells via the Inhibition of Mdm2-Mediated Degradation Mol. Cancer Res., January 1, 2008; 6(1): 64 - 77. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Salvatore, T. C. Nappi, P. Salerno, Y. Jiang, C. Garbi, C. Ugolini, P. Miccoli, F. Basolo, M. D. Castellone, A. M. Cirafici, et al. A Cell Proliferation and Chromosomal Instability Signature in Anaplastic Thyroid Carcinoma Cancer Res., November 1, 2007; 67(21): 10148 - 10158. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. Wiseman, O. L. Griffith, S. Deen, A. Rajput, H. Masoudi, B. Gilks, L. Goldstein, A. Gown, and S. J. M. Jones Identification of Molecular Markers Altered During Transformation of Differentiated Into Anaplastic Thyroid Carcinoma Arch Surg, August 1, 2007; 142(8): 717 - 729. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R Malaguarnera, V Vella, R Vigneri, and F Frasca p53 family proteins in thyroid cancer Endocr. Relat. Cancer, March 1, 2007; 14(1): 43 - 60. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. Wiseman, H. Masoudi, P. Niblock, D. Turbin, A. Rajput, J. Hay, S. Bugis, D. Filipenko, D. Huntsman, and B. Gilks Anaplastic Thyroid Carcinoma: Expression Profile of Targets for Therapy Offers New Insights for Disease Treatment Ann. Surg. Oncol., February 1, 2007; 14(2): 719 - 729. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Qin, R. Kishore, C. M. Dolan, M. Silver, A. Wecker, C. N. Luedemann, T. Thorne, A. Hanley, C. Curry, L. Heyd, et al. Cell cycle regulator E2F1 modulates angiogenesis via p53-dependent transcriptional control of VEGF PNAS, July 18, 2006; 103(29): 11015 - 11020. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. E. Nikiforov Anaplastic Carcinoma of the Thyroid--Will Aurora B Light a Path for Treatment? J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1243 - 1245. [Full Text] [PDF]
|
|
|
|
|
|
F. Frasca, V. Vella, A. Aloisi, A. Mandarino, E. Mazzon, R. Vigneri, and P. Vigneri p73 Tumor-Suppressor Activity Is Impaired in Human Thyroid Cancer Cancer Res., September 15, 2003; 63(18): 5829 - 5837. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Takeda, H. Inaba, M. Yamazaki, S. Kyo, T. Miyamoto, S. Suzuki, T. Ehara, T. Kakizawa, M. Hara, L. J. DeGroot, et al. Tumor-Specific Gene Therapy for Undifferentiated Thyroid Carcinoma Utilizing the Telomerase Reverse Transcriptase Promoter J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3531 - 3538. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. K. Chung, Y.-W. Yi, N.-C. Jung, D. Kim, J. M. Suh, H. Kim, K. C. Park, D. W. Kim, E. S. Hwang, J. H. Song, et al. Gadd45{gamma} Expression Is Reduced in Anaplastic Thyroid Cancer and Its Reexpression Results in Apoptosis J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3913 - 3920. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Wu, S.-W. Jiang, and F. J. Couch p53 Mediates Repression of the BRCA2 Promoter and Down-regulation of BRCA2 mRNA and Protein Levels in Response to DNA Damage J. Biol. Chem., April 25, 2003; 278(18): 15652 - 15660. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Portella, S. Scala, D. Vitagliano, G. Vecchio, and A. Fusco ONYX-015, an E1B Gene-Defective Adenovirus, Induces Cell Death in Human Anaplastic Thyroid Carcinoma Cell Lines J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2525 - 2531. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Nagayama, H. Yokoi, K. Takeda, M. Hasegawa, E. Nishihara, H. Namba, S. Yamashita, and M. Niwa Adenovirus-Mediated Tumor Suppressor p53 Gene Therapy for Anaplastic Thyroid Carcinoma in Vitro and in Vivo J. Clin. Endocrinol. Metab., November 1, 2000; 85(11): 4081 - 4086. [Abstract] [Full Text]
|
|
|
|
|
|
N. Mitsiades, V. Poulaki, S. Tseleni-Balafouta, D. A. Koutras, and I. Stamenkovic Thyroid Carcinoma Cells Are Resistant to FAS-mediated Apoptosis But Sensitive to Tumor Necrosis Factor-related Apoptosis-inducing Ligand Cancer Res., August 1, 2000; 60(15): 4122 - 4129. [Abstract] [Full Text]
|
|
|
|
|
|
F. Moretti, S. Nanni, A. Farsetti, M. Narducci, M. Crescenzi, S. Giuliacci, A. Sacchi, and A. Pontecorvi Effects of Exogenous p53 Transduction in Thyroid Tumor Cells with Different p53 Status J. Clin. Endocrinol. Metab., January 1, 2000; 85(1): 302 - 308. [Abstract] [Full Text]
|
|
|
|
 |
|
 N. T. Ueno, C. Bartholomeusz, J. L. Herrmann, Z. Estrov, R. Shao, M. Andreeff, J. Price, R. W. Paul, P. Anklesaria, D. Yu, et al. E1A-mediated Paclitaxel Sensitization in HER-2/neu-overexpressing Ovarian Cancer SKOV3.ip1 through Apoptosis Involving the Caspase-3 Pathway Clin. Cancer Res., January 1, 2000; 6(1): 250 - 259. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
