help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Latronico, A. C.
Right arrow Articles by Mendonca, B. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Latronico, A. C.
Right arrow Articles by Mendonca, B. B.
The Journal of Clinical Endocrinology & Metabolism Vol. 83, No. 7 2435-2440
Copyright © 1998 by The Endocrine Society


Original Studies

A Unique Constitutively Activating Mutation in Third Transmembrane Helix of Luteinizing Hormone Receptor Causes Sporadic Male Gonadotropin-Independent Precocious Puberty1

A. C. Latronico, A. N. Abell, I. J. P. Arnhold, X. Liu, T. S. S. Lins, V. N. Brito, A. E. Billerbeck, D. L. Segaloff2 and B. B. Mendonca

Department of Physiology and Biophysics, The University of Iowa College of Medicine (A.N.A., X.L., D.L.S.), Iowa City, Iowa; Instituto Materno Infantil de Pernambuco (T.S.S.L.), Recife, Brazil; and Developmental Endocrinology Unit, Hospital das Clínicas, São Paulo University, Medical School (A.C.L., I.J.P.A., V.N.B. A.E.B., B.B.M), São Paulo, Brazil

Address all correspondence and requests for reprints to: Ana Claudia Latronico, Hospital das Clínicas, Disciplina de Endocrinologia, Universidade de São Paulo, Caixa Postal: 3671, São Paulo, CEP 01060–970, Brazil. E-mail: anacl{at}usp.br


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added In Proof
 References
 
Several constitutively activating mutations have been demonstrated in the sixth transmembrane helix of the human LH receptor (hLHR) in boys with gonadotropin-independent precocious puberty. In the current study, we examined two unrelated Brazilian boys with gonadotropin-independent precocious puberty caused by two different heterozygous activating mutations of the hLHR. Direct sequencing of the entire exon 11 of the hLHR revealed a heterozygous substitution of T for G at nucleotide 1370, that converts Leu 457 to Arg in the third transmembrane helix of the hLHR in one affected boy. His biological parents had a normal hLHR gene sequence, establishing the sporadic nature of this novel Leu457Arg mutation. Human embryonic 293 cells expressing hLHR mutant (L457R) or hLHR wild-type bound CG with high affinity. However, cells expressing hLHR(L457R) exhibited significantly higher basal levels of cAMP (7- to 14-fold) than cells expressing the wild-type receptor, indicating constitutive activation of hLHR(L457R). Basal levels of cAMP in hLHR(L457R)-expressing cells were, nonetheless, not as great as the levels of cAMP produced by hLHR wild-type-expressing cells incubated with a saturating concentration of CG. Furthermore, cells expressing hLHR(L457R) were unresponsive to further stimulation by CG. This finding was confirmed in the patient by lack of an increase in serum testosterone after CG stimulation. These results suggest that the conformation of hLHR(L457R) mutant represents a different activated receptor state (R*) than the agonist-occupied wild-type receptor. We also identified the previously described Ala568Val mutation in the third intracellular loop of the LHR in the other affected African-Brazilian boy and his normal prepubertal sister, suggesting the inherited form of precocious puberty in this boy. We conclude that the third transmembrane helix is a potential area for activating mutations of the hLHR that cause male precocious puberty.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added In Proof
 References
 
GONADOTROPIN-independent precocious puberty (GIPP) is a distinct form of isosexual precocious puberty in boys. These patients display elevated levels of testosterone independent of GnRH and LH levels (1, 2). Presentation of this disorder usually occurs by age 1–4 yr and is characterized by signs of puberty, rapid virilization, and growth acceleration. Testicular biopsy specimens show premature Leydig cell maturation (1).

Several activating point mutations of the human LH receptor (hLHR) associated with GIPP have been described (2, 3, 4, 5, 6, 7, 8). Most of the activating mutations described thus far have been found in the sixth transmembrane helix (4). Additionally, one activating mutation has been described in helix V, one in the helix II, and two in the third intracellular loop (4, 7, 8). One of the mutations in the third intracellular loop is an Ala568Val substitution we recently reported in a Brazilian black boy with GIPP (7). This mutation leads to increased basal cAMP production in transfected COS-7 cells, reflecting an intrinsic ability of the mutant receptor to couple with and stimulate Gs in the absence of ligand.

In the present study, we examined two other unrelated Brazilian boys with GIPP and no family history of disease. We show that both have heterozygous activating point mutations in the hLHR gene. One boy was found to have the previously identified Ala568Val mutation (7). The other boy exhibited a novel constitutively activating mutation in helix III of the hLHR.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added In Proof
 References
 
Patients

Patient 1 was first seen at 2 yr and 6 months of age because of penile enlargement, frequent erections, fast growth, deepening voice, and aggressive behavior. His height was 113.3 cm (+6.2 SD) and weight was 24.3 kg. Penile length was 10.3 cm, testicular size was 2.0 x 1.4 cm bilaterally, and pubic hair was Tanner stage IV. His bone age was 6 yr. At the time of diagnosis, his basal serum testosterone levels ranged from 392–975 ng/dL. Basal and GnRH-stimulated serum LH and FSH levels were both undetectable (LH, <0.6 U/L and FSH, <1.0 U/L). Plasma concentrations of 17-hydroxyprogesterone, 11-deoxycortisol, dehydroepiandrosterone and dehydroepiandrosterone sulfate levels were normal. Adrenal glands were normal on computed tomography imaging. Selective venous catheterization revealed very high levels of testosterone in both testicular veins when compared with peripheral veins. Bilateral testicular biopsy revealed abundant number of mature Leydig cells and some seminiferous tubular development with spermatogenesis up to spermatocytes. He was first treated with im medroxyprogesterone acetate (100 mg/week), followed by ketoconozole (200 mg every 8 h orally) without a fall in testosterone levels. Currently, he is 7-yr-old boy with bone age of 13 yr. A recent GnRH stimulation test demonstrated suppressed LH and FSH levels. His basal testosterone level was 1556 ng/dL and did not increase after CG stimulation (5000 U, im). He has been treated with oral cyproterone acetate (150 mg/day) for the last 3 yr; his height SD score for bone age increased from -1.5 to -0.8, and penile erections are less frequent.

Patient 2 is a black boy who was clinically evaluated in the Instituto Materno-Infantil of Pernambuco, Brazil, at the age of 6 yr and 5 months because of progressive sexual development. He started to grow rapidly and showed signs of puberty at the age of 3 yr. His height was 136 cm (+3.7 SD). He was classified as Tanner stage III for genital size and Tanner stage II for pubic hair. His bone age was 13 yr. Serum testosterone was elevated (180 ng/dL), whereas serum LH and FSH levels were prepubertal. Serum LH and FSH levels did not increase after administration of GnRH. Testicular biopsy revealed spermatogenesis and aggregates of Leydig cells. He had an asymptomatic younger sister. His father was not available for DNA analysis.

The family history over three previous generations was negative for early sexual maturation or short adult height in both patients. Informed consent was obtained from patients and parents according to institutional guidelines.

DNA analysis

Genomic DNA was isolated from peripheral blood samples. The entire exon 11 of the hLHR gene was amplified by PCR. Amplification was performed for 30 cycles in a Gene Amp PCR system (9600, Perkin-Elmer Cetus, Norwalk, CT). The PCR products were pretreated with an enzymatic combination of shrimp alkaline phosphatase and exonuclease I (United States Biochemical Corp, Cleveland, OH) and directly sequenced by the dideoxy nucleotide chain termination method, using modified T7-DNA polymerase (Sequenase kit version 2.0 United States Biochemical Corp.) in the presence of [{alpha}-35S]deoxy-ATP. Inner primers that spanned the exon 11 of the hLHR gene were used for sequencing, and the reaction products were run on a 6% polyacrylamide gel. Analysis of biological paternity and maternity was performed with highly polymorphic VNTR loci (ACES 2.0, Gibco BRL, Gaithersburg, MD) using genomic DNA from the patient 1 and his parents.

Mnl I restriction enzyme analysis

PCR was performed using the following primers to amplify the DNA sequence surrounding and encompassing residue 457 (1256nt-1422nt): primer A, 5' CAGTTGATTCCCAAACCAAGG 3' and primer B, 5' ATAGCATAGGTGATGGTGTGC 3' (9). Two microliters of purified PCR product were digested for 5 h with 10 U MnlI (New England Biolabs. Beverly, MA), separated on a 3% agarose gel and visualized with ethidium bromide.

Mutagenesis and transfections

The template for mutagenesis was the hLHR complementary DNA (cDNA) kindly donated by Ares Advanced Technology (Ares-Serono Group). After subcloning the cDNA into pcDNA3.1/neo, a substitution of nucleotide 1370 of the hLHR gene was accomplished by mutagenesis using the PCR overlap extension method (10). The entire region that was amplified by PCR was verified by sequencing.

Human embryonic kidney 293 cells were maintained at 5% CO2 in a culture medium consisting of DMEM containing 50 µg/mL gentamicin, 10 mM HEPES, and 10% newborn calf serum. Cells were transfected at a 60–80% confluence using the transient transfection procedure of Chen and Okayama (11) except that the overnight precipitation was performed in a 5% rather than 2.5% CO2 atmosphere. After 18–20 h the cells were washed with Waymouth’s MB752/1 media modified with 50 µg/mL gentamicin and 1 mg/mL BSA, and then fresh growth medium was added. The cells were used for experiments 24 h later.

125I-labeled CG binding to intact cells

Human embryonic 293 cells were plated on gelatin-coated 35-mm wells and transfected as described above. On the day of the experiment, cells were cooled on ice for 10 min and then washed two times with cold Waymouth’s MB752/1 media lacking sodium bicarbonate but containing 50 µg/mL gentamicin and 1 mg/mL BSA. To determine the maximal binding capacity, the cells were then incubated overnight at 4 C in the same media containing a saturating concentration of 125I-labeled CG (100 ng/mL final concentration) with or without an excess of unlabeled CG (50 IU/mL final concentration). To determine the equilibrium binding paramenters, the cells were incubated with a subsaturating concentration of 125I-labeled CG alone or with increasing concentrations of unlabeled CG. The assay was finished by scraping the cells into a small volume of cold HBSS modified to contain 50 µg/mL gentamicin and 1 mg/mL BSA, centrifuging (1500 x g, 10 min), and washing the pellet in 2 mL of the same buffer. The data were analyzed using the computer program LIGAND to calculate the dissociation constant (Kd) (12, 13).

Measurement of cAMP production

In the same experiment, 293 cells were assayed both for maximal 125I-labeled CG binding to intact cells as well as for total (i.e. intracellular plus extracellular) cAMP production under basal and CG-stimulated conditions. Therefore, for any given experiment in which cAMP was determined, the levels of cell surface expression of receptor were also determined. Only those experiments in which the cells expressed comparable numbers of wild-type vs. mutant receptors were utilized for data analyses. The 293 cells were plated on gelatin-coated 35-mm wells and transfected as described above. On the day of the experiment, cells were washed twice with warm Waymouth MB752/1 media containing 50 µg/mL gentamicin and 1 mg/mL BSA and placed in 1 mL of the same medium containing 0.5 mM isobutylmethylxanthine. After 15 min at 37 C, buffer only or increasing concentrations of CG were added, and the incubation was continued for 60 min at 37 C. The cells were then placed on ice and cAMP was extracted by the addition of 1N perchloric acid containing 360 µg/mL theophylline and then measured by RIA. All determinations were performed either in duplicate or triplicate. The data for the cells expressing recombinant LHR wild type [rLHR(wt)] were subsequently analyzed using the computer program DeltaPlot to calculate the Rmax and EC50 for each curve.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added In Proof
 References
 
Sequencing of hLHR gene

Direct sequencing of exon 11 of the hLHR gene revealed a heterozygous substitution of T for G at nucleotide 1370 that converts Leu457 (CTC) to Arg (CGC) in the helix III of the hLHR from patient 1 (Fig. 1Go). In contrast, both parents showed a normal sequence. The biological paternity and maternity were confirmed by microsatellite repeat markers.



View larger version (66K):
[in this window]
[in a new window]
 
Figure 1. Upper, Direct sequencing showing heterozygous substitution of T by G at nucleotide 1370 of LHR gene, resulting in exchange of Leu457 with Arg in third transmembrane helix in patient 1. Lower, Schematic representation of hLHR and positions of known constitutively activating mutations, including novel Leu457Arg mutation, causing GIPP in boys.

 
In patient 2, direct sequencing of exon 11 of the hLHR gene revealed a heterozygous substitution of C for T at nucleotide 1703, that converts Ala 568 (GCT) to Val (GTT) in the third cytoplasmic loop of the hLHR. DNA analysis of his normal prepubertal sister revealed the heterozygous Ala568Val mutation. In contrast, his mother’s DNA showed a normal sequence.

MnlI restriction enzyme analysis

The Leu457Arg mutation abolishes recognition sites for two restriction endonucleases MnlI and Hph. Restriction digestion of the PCR product with MnlI showed an undigested fragment of 166 bp and two digested fragments of 129 and 37 bp in patient 1 with the L457R mutation (Fig. 2Go). In contrast, a normal PCR product digested entirely into two fragments of 129 and 37 bp.



View larger version (47K):
[in this window]
[in a new window]
 
Figure 2. MnlI restriction enzyme analysis of PCR products from patient (I) and his father (II). A normal PCR product before of MnlI digestion (III). DNA of affected boy yielded both uncut (166 bp) and digested (129 and 37 bp) fragments. In contrast, his father’s PCR product digested entirely into two fragments (129 and 37 bp), as expected for a normal subject. Fragments of 37 bp run off bottom of gel.

 
Functional studies

The A568V substitution identified in patient 2 has previously been described in another family and has been shown to result in constitutive activation of the LHR (7). Therefore, no further functional studies of this mutation were carried out in the present study. In contrast, the identification of a L457R substitution in helix III of the LHR has not previously been described. Consequently, the following studies were performed to evaluate the functional status of this mutant hLHR.

Human embryonic 293 cells were transiently transfected with cDNAs encoding either the hLHR(wt) or hLHR(L457R). As shown in Table 1Go, cells expressing hLHR(L457R) bound CG with the same high affinity as cells expressing hLHR(wt). Subsequent experiments were performed to assess the cAMP produced by these cells under both basal conditions and CG-stimulated conditions. Cells transfected with the same amount of hLHR(L457R) cDNA as hLHR(wt) cDNA expressed comparable levels of cell surface receptor. However, because the numbers of receptors expressed (for any receptor cDNA) can vary somewhat from experiment to experiment, and because both basal and CG-stimulated cAMP production can be variable depending on the number of cell surface receptors expressed (14, 15, 16), the experiments examining cAMP responsiveness of the cells always contained parallel dishes in which the maximal amount of 125I-labeled CG binding was concomitantly determined. The data are presented only for those experiments in which comparable levels of wild-type and mutant cell surface receptors were observed. As shown in Table 2Go, the basal levels of cAMP produced by cells expressing hLHR(L457R) were significantly (7- to 14-fold) higher than the cAMP levels produced by cells expressing comparable levels of hLHR(wt). Interestingly, the cAMP levels in cells expressing hLHR(L457R) were not further augmented by CG. This is strikingly apparent when viewing a full dose-response curve for CG-stimulated cAMP production in the hLHR(wt) vs. hLHR(L457R) cells, which was done for Exps 2 and 3. As shown in Fig. 3Go, cells expressing the wild-type receptor exhibited a 20- to 25-fold stimulation of cAMP in response to saturating concentrations of CG. In contrast, cells expressing hLHR(L457R) produced the same levels of cAMP regardless of the concentration of exogenous CG present.


View this table:
[in this window]
[in a new window]
 
Table 1. CG binding affinities to intact cells expressing either hLHR(wt) or hLHR(L457R)

 

View this table:
[in this window]
[in a new window]
 
Table 2. Basal and CG-stimulated cAMP in cells expressing hLHR(wt) vs. hLHR(L457R)

 


View larger version (29K):
[in this window]
[in a new window]
 
Figure 3. Lack of effect of CG on cAMP production in hLHR(L457R) expressing cells. This figure shows a full CG dose curve for cAMP production in transfected 293 cells of Exps 2 and 3 of Table 2Go. Results are presented as fold increase in cAMP relative to basal levels present in cells expressing wild-type receptor. Data shown are mean ± range of two experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added In Proof
 References
 
Recent studies have demonstrated that naturally occurring activating mutations in the hLHR are associated with Leydig cell activation and sporadic or familial male-limited precocious puberty. So far, 11 missense mutations have been found within exon 11 of the hLHR gene in boys with precocious puberty (2, 3, 4, 5, 6, 7, 8). Eight mutations are located in helices V and VI, two mutations in the third intracellular loop and one mutation in helix II of the hLHR (2, 3, 4, 5, 6, 7, 8). The majority of mutations identified thus far are located in helix VI, and an Asp578Gly mutation in this transmembrane domain has been the most frequently identified activating mutation (17). Although it is likely that helix VI of the hLHR plays an important role in signal transduction, it must also be pointed out that the apparent scarcity of mutations in other regions of exon 11 may simply reflect the fact that in many of the earlier studies investigators sequenced only a limited portion of exon 11. Because activating mutations have been identified in some, but not all, cases of male-limited precocious puberty (6), it is possible that mutations elsewhere in exon 11 went undetected. In this study we examined the entire sequence of exon 11 of the hLHR in two Brazilian boys exhibiting GIPP. In one boy a heterozygous mutation was found causing substitution of Ala568 with Val, a previously characterized activating mutation in the third cytoplasmic loop (7). However, a novel mutation in helix III of the hLHR, L457R, was identified in the other boy.

The L457R is a dominant mutation in the third transmembrane helix of the hLHR, a region for which an activating mutation for any of the gonadotropin hormone receptors has not yet been described. Activating mutations for other G protein-coupled receptors (GPCRs), however, have been reported in the third transmembrane helix, albeit not at this same position (see Refs. 18, 19, 20 for examples). Interestingly, two activating mutations (S505 and V509) in the related human TSH receptor are predicted to lie on the same helical face (20). The particular Leu 457 found to be mutated in this study is highly conserved among human, porcine, rat, and mouse LHRs, as well as among TSH and FSH receptors. Furthermore, within the superfamily of GPCRs, it is considered a consensus residue in that it is conserved in over 70% of the GPCR sequences analyzed by Baldwin (21), Baldwin et al. (22), and Lin et al. (23). In the structural model of GPCRs postulated by Baldwin (21) and Baldwin et al. (22), this Leu residue is positioned such that it faces the central cavity formed by the seven transmembrane helices. In addition, the Leu 457 is closely positioned to the absolutely conserved Arg at the end of third helix (21, 22). The high conservation and positioning of this residue suggests that it may play an important structural and/or functional role in other GPCRs as well. Within the hLHR, mutation of Leu457 to Arg abolishes two restriction sites of MnlI and Hph, which could facilitate rapid screening for this mutation by restriction fragment length polymorphism analysis.

As shown herein, substitution of Leu457 with Arg causes constitutive activation of the hLHR. There are several possible mechanisms, each of which is not exclusive of the others, by which this activation could occur. It is possible that Leu457 normally interacts with a residue in another helix that constrains the receptor in an inactive conformation. Substitution of Leu457 might disrupt this interaction, allowing flexibility of the receptor and its activation. This scenario would not be unlike the mechanism of activation of rhodopsin, which involves the disruption of interhelical interactions, resulting in increased mobility of the receptor helices (24, 25, 26). The possibility further exists that transmembrane helix three of the hLHR might be able to interact with and activate Gs, but that Leu457 normally constrains this interaction. The latter possibility is based on recent observations suggesting a direct role in helix VI of the hLHR in Gs activation (27). These latter two models complement each other, allowing one to envision how the disruption of interhelical interactions might cause greater flexibility of the helices, thus now allowing Gs to enter the cytoplasmic cleft formed by the transmembrane helices (24, 26, 28). Evidence for other GPCRs suggests that activation by mutations or by agonist occupancy appears to be associated with increased mobility of one or more helices. It has been suggested that this in turn may cause an enlargement of the cytoplasmic crevice, allowing access of Gs to residues previously held inaccessible (29). Lastly, it is also possible that the substitution of Leu457 with Arg causes a global conformational change that allosterically affects the conformation of intracellular loop regions involved in Gs activation.

Substitution of Leu457 in helix III with Arg causes constitutive activation of the receptor, presumably by allowing it to assume an activated R1 state, as hypothesized for the ternary activation model of GPCRs (30, 31). However, there are two important points to note. First, the activity of hLHR(L457R) mutant in its basal state is less than the wild-type receptor when stimulated with a maximally effective concentration of CG. Secondly, although the hLHR(L457R) mutant binds CG with normal high affinity and is expressed well at the cell surface, it is unresponsive to CG stimulation. These observations suggest that the conformation of hLHR(L457R) mutant is not equivalent to the R1 state of the agonist-occupied wild-type receptor. More likely, the hLHR(L457R) mutant represents a different R1 state, one that allows partial activation of Gs but that does not allow for further activation by agonist. Two other activating mutations of the hLHR (Ile542Leu in helix V and Cys581Arg in helix VI) have been described in which basal cAMP production is elevated, but the mutant receptors are not responsive to CG (4). A CG stimulation test in patient 1 confirmed the unresponsiveness of the L457R to CG. Although the mechanisms underlying these observations are as yet not known, they may be clinically relevant. We speculate that plasma testosterone in this Brazilian boy with the L457R mutation will not increase normally in response to the pubertal rise in circulating LH that should occur with the maturation of the hypothalamic-pituitary-gonadal axis. Interestingly, the serum testosterone levels in this boy were higher than in previously reported boys with hLHR activating mutations (1, 2, 5, 7). Although we have not yet directly compared cells expressing the L457R mutation with cells expressing comparable levels of the other activating mutations, we predict that the increased basal level of cAMP observed in L457R-expressing cells would be greater than in the others. In addition, the high testosterone levels in this patient may inhibit the normal pubertal gonadotropin secretion by a negative feedback mechanism, which could result in deleterious effects in his future fertility. These possibilities will be resolved with continued follow-up of this patient.

Testicular size is useful in the differential diagnosis of precocious puberty in boys and reflects development of seminiferous tubules. Patients with gonadotropin-dependent precocious puberty have testes of pubertal size, probably caused by testicular stimulation by both gonadotropins. On the other hand, testes of prepubertal size usually indicate an extratesticular source of androgens, such as virilizing congenital adrenal hyperplasia or adrenal tumor. GIPP or testotoxicosis has been characterized by increased testicular size, although less than expected for the degree of virilization. Patient 1 demonstrates that normal prepubertal testicular size can occur in patients with GIPP.

This study also identified the previously described Ala568Val mutation in the third intracellular loop of the LHR in a Brazilian black boy with GIPP. His normal prepubertal sister carried the same mutation in the LHR gene, suggesting an inherited form of precocious puberty in this boy. Previous studies demonstrated that this mutant receptor produced increased levels of basal cAMP, consistent with constitutive activation of the hLHR (7). Interestingly, the Ala568Val mutation was found only in two Brazilian natives of African descent, but not in 40 families previously published (2, 4, 7). The previously studied boy with Ala568Val was adopted, and it is unclear at this time whether these Brazilian kindreds share a common ancestral origin and thus, it might represent a founder effect of the LHR gene mutation in Brazil.

In summary, we have identified two point mutations, one within helix III and one in the third cytoplasmic loop, of the hLHR that are responsible for constitutive activation of testicular Leydig cells and consequent sexual precocity in these Brazilian boys. We conclude that the third transmembrane helix is a potential area for activating mutations of the hLHR that cause GIPP. Further studies on these and other activating mutations of the hLHR should provide valuable insights into the mechanism of action of the glycoprotein hormone receptors.


    Note Added In Proof
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added In Proof
 References
 
While this manuscript was under review, a heterozygous C to T base change at nucleotide position 1126, exchanging codon 373 from Ala to Val in the first transmembrane domain of the LHR, was reported in a boy with precocious puberty (Gromoll J, Partsch C-J, Simoni M, et al. 1998. A mutation in the first transmembrane domain of the lutropin receptor causes male precocious puberty. J Clin Endocrinol Metab. 83:476–480, 1998)


    Acknowledgments
 
The services and facilities provided by the Diabetes and Endocrinology Research Center of the University of Iowa (supported by Grant DK-25295) are gratefully acknowledged. We thank Eliana Turri Salgado Frazatto and Maria Aparecida Medeiros for excellent technical support.


    Footnotes
 
1 This work was supported in part by the Fundação de Amparo a Pesquisa do Estado de São Paulo (FAPESP Grants 96/2040–2 and 96/2020–1) (A.C.L.). Back

2 Supported by NIH Grant HD22196. Back

Received January 22, 1998.

Revised January 31, 1998.

Accepted April 8, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added In Proof
 References
 

  1. Rosenthal SM, Grumbach M, Kaplan SL. 1983 Gonadotropin-independent familial sexual precocity with premature Leydig and germinal cell maturation (familial testotoxicosis): effects of a potent luteinizing hormone-releasing factor agonist and medroxyprogesterone acetate therapy in four cases. J Clin Endocrinol Metab. 57:571–579.[Abstract/Free Full Text]
  2. Shenker A, Laue L, Kosugi S, Merendino Jr JJ, Minegishi T, Cutler Jr GB. 1993 A constitutively activating mutation of the luteinizing hormone receptor in familial male precocious puberty. Nature. 365:652–654.[CrossRef][Medline]
  3. Kremer H, Edwin M, Otten BJ, et al. 1993 Cosegregation of missense mutations of the luteinizing hormone receptor gene with familial male-limited precocious puberty. Hum Mol Genet. 2:1779–1783.[Abstract/Free Full Text]
  4. Laue L, Chan WY, Hsueh AJW, et al. 1995 Genetic heterogeneity of constitutively activating mutations of the human luteinizing hormone receptor in familial male-limited precocious puberty. Proc Natl Acad Sci USA. 92:1906–1910.[Abstract/Free Full Text]
  5. Yano K, Saji M, Hidaka A, et al. 1995 A new constitutively activating point mutation in the luteinizing hormone/choriogonadotropin receptor gene in cases of male-limited precocious puberty. J Clin Endocrinol Metab. 80:1162–1168.[Abstract]
  6. Kosugi S, Dop CV, Geffner ME, et al. 1995 Characterization of heterogeneous mutations causing constitutive activation of the luteinizing hormone receptor in familial male precocious puberty. Hum Mol Genet. 4:183–188.[Abstract/Free Full Text]
  7. Latronico AC, Anasti J, Arnhold IJP, et al. 1995 A novel mutation of the luteinizing hormone receptor gene causing male gonadotropin-independent precocious puberty. J Clin Endocrinol Metab. 80:2490–2494.[Abstract]
  8. Kraaij R, Post M, Kremer H, et al. 1995 A missense mutation in the second transmembrane segment of the luteinizing hormone receptor causes familial male-limited precocious puberty. J Clin Endocrinol Metab. 80:3168–3172.[Abstract]
  9. Minegishi T, Nakamura K, Takamura Y, et al. 1990 Cloning and sequencing of human/hCG receptor cDNA. Biochem Biophys Res Commun. 172:1049–1054.[CrossRef][Medline]
  10. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. 1989 Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene. 77:51–59.[CrossRef][Medline]
  11. Chen C, Okayama H. 1987 High-efficiency transformation of mammalian cells by plasmid DNA. Mol Cell Biol. 7:2745–2752.[Abstract/Free Full Text]
  12. De Lean A, Munson PJ, Rodbard D. 1978 Simultaneous analysis of families of sigmoidal curves: application to biossay, radioligand assay and physiological dose-response curves. Am J Physiol 235:E97–E102.
  13. Munson PJ, Rodbard D. 1980 LIGAND: a versatile computerized approach for characterization of ligand-binding system. Anal Biochem. 107:220–239.[CrossRef][Medline]
  14. Hwa J, Graham RM, Perez DM. 1996 Chimeras of {alpha}1-adrenergic receptor subtypes identify critical residues that modulate active state isomerization. J Biol Chem. 271:7956–7964.[Abstract/Free Full Text]
  15. Whaley BS, Yuan N, Birnbaumer L, Clark RB, Barber R. 1994 Differential expression of the ß-adrenergic receptor modifies agonist stimulation of adenylyl cyclase: a quantitative evaluation. Mol Pharmacol. 45:481–489.[Abstract]
  16. Zhu X, Gilbert S, Birnbaumer M, Birnbaumer L. 1994 Dual signaling potential is common among Gs-coupled receptors and dependent on receptor density. Mol Pharmacol. 46:460–469.[Abstract]
  17. Shenker A. 1998 In: Spiegel AM, ed. G protein and disease. Totowa, NJ: Human Press. (in press).
  18. Groblewski T, Maigret B, Larguier R, Lombard C, Bonnafous JC, Marie J. 1997 Mutation of Asn111 in the third transmembrane domain of the AT1A angiotensin II receptor induces its constitutive activation. J Biol Chem. 272:1822–1826.[Abstract/Free Full Text]
  19. Porter JE, Hwa J, Perez DM. 1996 Activating of the {alpha}1b-adrenergic receptor is initiated by disruption of an interhelical salt bridge constraint. J Biol Chem. 271:28318–28323.[Abstract/Free Full Text]
  20. Epstein FH. 1997 The thyrotropin receptor in thyroid diseases. N Engl J Med. 337:1675–1681.[Free Full Text]
  21. Baldwin JM. 1993 The probable arrangement of the helices in G protein-coupled receptors. EMBO J. 12:1693–1703.[Medline]
  22. Baldwin JM, Schertler GFX, Unger VM. 1997 An alpha-carbon template for the transmembrane helices in the rhodopsin family of G-protein-coupled receptors. J Mol Biol. 272:144–164.[CrossRef][Medline]
  23. Lin Z, Shenker A, Pearlstein R. 1997 A model of the lutropin/choriogonadotropin receptor: insights into the structure and functional aspects of constitutively activating mutations. Protein Eng. 10:5015–5010.
  24. Farrens DL, Altenbach C, Yang K, Hubbell WL, Khorana HG. 1996 Requirement of rigid-body motion of transmembrane helices for light activation of rhodopsin. Science. 274:768–770.[Abstract/Free Full Text]
  25. Hargrave P, McDowell JH. 1992 Rhodopsin and phototransduction: a model system for G protein-linked receptors. FASEB J. 6:2323–2331.[Abstract]
  26. Sheikh SP, Zvyaga TA, Lichtarge O, Sakmar TP, Bourne HR. 1996 Rhodopsin activation blocked by metal-ion-binding sites linking transmembrane helices C and F. Nature. 383:347–350.[CrossRef][Medline]
  27. Abell AN, Segaloff DL 1997. Evidence for the direct involvement of transmembrane region six of the lutropin/choriogonadotropin receptor in activating Gs. J Biol Chem. 272:14586–14591.
  28. Javitch JA, Fu D, Liapakis G, Chen J. 1997 Constitutive activation of the ß2- adrenergic receptor alters the orientation of its sixth membrane-spanning segment. J Biol Chem. 272:18546–18549.[Abstract/Free Full Text]
  29. Bourne HR. 1997. How receptors talk to trimeric G proteins. Curr Opin Cell Biol. 9:134–142.
  30. Bond RA, Leff P, Johnson D, Milano CA, et al. 1995 Physiological effects of inverse agonists in transgenic mice with myocardial overexpression of the ß2-adrenoreceptor. Nature. 374:72–76.
  31. Samama P, Cotecchia S, Costa T, Lefkowitz RJ. 1993 A mutation-induced activated state of the ß2-adrenergic receptor: extending the ternary complex model. J Biol Chem. 268:4625–4636.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
M. Zhang, Y.-X. Tao, G. L. Ryan, X. Feng, F. Fanelli, and D. L. Segaloff
Intrinsic Differences in the Response of the Human Lutropin Receptor Versus the Human Follitropin Receptor to Activating Mutations
J. Biol. Chem., August 31, 2007; 282(35): 25527 - 25539.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
P. Nurwakagari, A. Breit, C. Hess, H. Salman-Livny, D. Ben-Menahem, and T. Gudermann
A conformational contribution of the luteinizing hormone-receptor ectodomain to receptor activation
J. Mol. Endocrinol., February 1, 2007; 38(2): 259 - 275.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. Galet and M. Ascoli
A Constitutively Active Mutant of the Human Lutropin Receptor (hLHR-L457R) Escapes Lysosomal Targeting and Degradation
Mol. Endocrinol., November 1, 2006; 20(11): 2931 - 2945.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Zhang, D. Mizrachi, F. Fanelli, and D. L. Segaloff
The Formation of a Salt Bridge Between Helices 3 and 6 Is Responsible for the Constitutive Activity and Lack of Hormone Responsiveness of the Naturally Occurring L457R Mutation of the Human Lutropin Receptor
J. Biol. Chem., July 15, 2005; 280(28): 26169 - 26176.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Hirakawa and M. Ascoli
A Constitutively Active Somatic Mutation of the Human Lutropin Receptor Found in Leydig Cell Tumors Activates the Same Families of G Proteins as Germ Line Mutations Associated with Leydig Cell Hyperplasia
Endocrinology, September 1, 2003; 144(9): 3872 - 3878.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. Shinozaki, V. Butnev, Y.-X. Tao, K. L. Ang, M. Conti, and D. L. Segaloff
Desensitization of Gs-Coupled Receptor Signaling by Constitutively Active Mutants of the Human Lutropin/Choriogonadotropin Receptor
J. Clin. Endocrinol. Metab., March 1, 2003; 88(3): 1194 - 1204.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
M. Ascoli, F. Fanelli, and D. L. Segaloff
The Lutropin/Choriogonadotropin Receptor, A 2002 Perspective
Endocr. Rev., April 1, 2002; 23(2): 141 - 174.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Hirakawa, C. Galet, and M. Ascoli
MA-10 Cells Transfected with the Human Lutropin/Choriogonadotropin Receptor (hLHR): A Novel Experimental Paradigm to Study the Functional Properties of the hLHR
Endocrinology, March 1, 2002; 143(3): 1026 - 1035.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Shinozaki, F. Fanelli, X. Liu, J. Jaquette, K. Nakamura, and D. L. Segaloff
Pleiotropic Effects of Substitutions of a Highly Conserved Leucine in Transmembrane Helix III of the Human Lutropin/Choriogonadotropin Receptor with Respect to Constitutive Activation and Hormone Responsiveness
Mol. Endocrinol., June 1, 2001; 15(6): 972 - 984.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. C. Latronico, H. Shinozaki, G. Guerra Jr., M. A. A. Pereira, S. H. V. Lemos Marini, M. T. M. Baptista, I. J. P. Arnhold, F. Fanelli, B. B. Mendonca, and D. L. Segaloff
Gonadotropin-Independent Precocious Puberty Due to Luteinizing Hormone Receptor Mutations in Brazilian Boys: A Novel Constitutively Activating Mutation in the First Transmembrane Helix
J. Clin. Endocrinol. Metab., December 1, 2000; 85(12): 4799 - 4805.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
L. Min and M. Ascoli
Effect of Activating and Inactivating Mutations on the Phosphorylation and Trafficking of the Human Lutropin/Choriogonadotropin Receptor
Mol. Endocrinol., November 1, 2000; 14(11): 1797 - 1810.
[Abstract] [Full Text]


Home page
Endocr. Rev.Home page
A. P. N. Themmen and I. T. Huhtaniemi
Mutations of Gonadotropins and Gonadotropin Receptors: Elucidating the Physiology and Pathophysiology of Pituitary-Gonadal Function
Endocr. Rev., October 1, 2000; 21(5): 551 - 583.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
Y.-X. Tao, A. N. Abell, X. Liu, K. Nakamura, and D. L. Segaloff
Constitutive Activation of G Protein-Coupled Receptors as a Result of Selective Substitution of a Conserved Leucine Residue in Transmembrane Helix III
Mol. Endocrinol., August 1, 2000; 14(8): 1272 - 1282.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
K. Nakamura, M. d. F. M. Lazari, S. Li, C. Korgaonkar, and M. Ascoli
Role of the Rate of Internalization of the Agonist-Receptor Complex on the Agonist-Induced Down-Regulation of the Lutropin/ Choriogonadotropin Receptor
Mol. Endocrinol., August 1, 1999; 13(8): 1295 - 1304.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
K.-S. Min, X. Liu, J. Fabritz, J. Jaquette, A. N. Abell, and M. Ascoli
Mutations That Induce Constitutive Activation and Mutations That Impair Signal Transduction Modulate the Basal and/or Agonist-stimulated Internalization of the Lutropin/Choriogonadotropin Receptor
J. Biol. Chem., December 25, 1998; 273(52): 34911 - 34919.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. N. Abell, D. J. McCormick, and D. L. Segaloff
Certain Activating Mutations within Helix 6 of the Human Luteinizing Hormone Receptor May Be Explained by Alterations That Allow Transmembrane Regions to Activate Gs
Mol. Endocrinol., December 1, 1998; 12(12): 1857 - 1869.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
L. Min, C. Galet, and M. Ascoli
The Association of Arrestin-3 with the Human Lutropin/Choriogonadotropin Receptor Depends Mostly on Receptor Activation Rather than on Receptor Phosphorylation
J. Biol. Chem., January 4, 2002; 277(1): 702 - 710.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Latronico, A. C.
Right arrow Articles by Mendonca, B. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Latronico, A. C.
Right arrow Articles by Mendonca, B. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals