| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Department of Physiology and Biophysics, The University of Iowa College of Medicine (A.N.A., X.L., D.L.S.), Iowa City, Iowa; Instituto Materno Infantil de Pernambuco (T.S.S.L.), Recife, Brazil; and Developmental Endocrinology Unit, Hospital das Clínicas, São Paulo University, Medical School (A.C.L., I.J.P.A., V.N.B. A.E.B., B.B.M), São Paulo, Brazil
Address all correspondence and requests for reprints to: Ana Claudia Latronico, Hospital das Clínicas, Disciplina de Endocrinologia, Universidade de São Paulo, Caixa Postal: 3671, São Paulo, CEP 01060970, Brazil. E-mail: anacl{at}usp.br
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Several activating point mutations of the human LH receptor (hLHR) associated with GIPP have been described (2, 3, 4, 5, 6, 7, 8). Most of the activating mutations described thus far have been found in the sixth transmembrane helix (4). Additionally, one activating mutation has been described in helix V, one in the helix II, and two in the third intracellular loop (4, 7, 8). One of the mutations in the third intracellular loop is an Ala568Val substitution we recently reported in a Brazilian black boy with GIPP (7). This mutation leads to increased basal cAMP production in transfected COS-7 cells, reflecting an intrinsic ability of the mutant receptor to couple with and stimulate Gs in the absence of ligand.
In the present study, we examined two other unrelated Brazilian boys with GIPP and no family history of disease. We show that both have heterozygous activating point mutations in the hLHR gene. One boy was found to have the previously identified Ala568Val mutation (7). The other boy exhibited a novel constitutively activating mutation in helix III of the hLHR.
| Materials and Methods |
|---|
|
|
|---|
Patient 1 was first seen at 2 yr and 6 months of age because of penile enlargement, frequent erections, fast growth, deepening voice, and aggressive behavior. His height was 113.3 cm (+6.2 SD) and weight was 24.3 kg. Penile length was 10.3 cm, testicular size was 2.0 x 1.4 cm bilaterally, and pubic hair was Tanner stage IV. His bone age was 6 yr. At the time of diagnosis, his basal serum testosterone levels ranged from 392975 ng/dL. Basal and GnRH-stimulated serum LH and FSH levels were both undetectable (LH, <0.6 U/L and FSH, <1.0 U/L). Plasma concentrations of 17-hydroxyprogesterone, 11-deoxycortisol, dehydroepiandrosterone and dehydroepiandrosterone sulfate levels were normal. Adrenal glands were normal on computed tomography imaging. Selective venous catheterization revealed very high levels of testosterone in both testicular veins when compared with peripheral veins. Bilateral testicular biopsy revealed abundant number of mature Leydig cells and some seminiferous tubular development with spermatogenesis up to spermatocytes. He was first treated with im medroxyprogesterone acetate (100 mg/week), followed by ketoconozole (200 mg every 8 h orally) without a fall in testosterone levels. Currently, he is 7-yr-old boy with bone age of 13 yr. A recent GnRH stimulation test demonstrated suppressed LH and FSH levels. His basal testosterone level was 1556 ng/dL and did not increase after CG stimulation (5000 U, im). He has been treated with oral cyproterone acetate (150 mg/day) for the last 3 yr; his height SD score for bone age increased from -1.5 to -0.8, and penile erections are less frequent.
Patient 2 is a black boy who was clinically evaluated in the Instituto Materno-Infantil of Pernambuco, Brazil, at the age of 6 yr and 5 months because of progressive sexual development. He started to grow rapidly and showed signs of puberty at the age of 3 yr. His height was 136 cm (+3.7 SD). He was classified as Tanner stage III for genital size and Tanner stage II for pubic hair. His bone age was 13 yr. Serum testosterone was elevated (180 ng/dL), whereas serum LH and FSH levels were prepubertal. Serum LH and FSH levels did not increase after administration of GnRH. Testicular biopsy revealed spermatogenesis and aggregates of Leydig cells. He had an asymptomatic younger sister. His father was not available for DNA analysis.
The family history over three previous generations was negative for early sexual maturation or short adult height in both patients. Informed consent was obtained from patients and parents according to institutional guidelines.
DNA analysis
Genomic DNA was isolated from peripheral blood samples. The
entire exon 11 of the hLHR gene was amplified by PCR. Amplification was
performed for 30 cycles in a Gene Amp PCR system (9600, Perkin-Elmer
Cetus, Norwalk, CT). The PCR products were pretreated with an enzymatic
combination of shrimp alkaline phosphatase and exonuclease I (United
States Biochemical Corp, Cleveland, OH) and directly sequenced by the
dideoxy nucleotide chain termination method, using modified T7-DNA
polymerase (Sequenase kit version 2.0 United States Biochemical Corp.)
in the presence of [
-35S]deoxy-ATP. Inner primers that
spanned the exon 11 of the hLHR gene were used for sequencing, and the
reaction products were run on a 6% polyacrylamide gel. Analysis of
biological paternity and maternity was performed with highly
polymorphic VNTR loci (ACES 2.0, Gibco BRL, Gaithersburg, MD) using
genomic DNA from the patient 1 and his parents.
Mnl I restriction enzyme analysis
PCR was performed using the following primers to amplify the DNA sequence surrounding and encompassing residue 457 (1256nt-1422nt): primer A, 5' CAGTTGATTCCCAAACCAAGG 3' and primer B, 5' ATAGCATAGGTGATGGTGTGC 3' (9). Two microliters of purified PCR product were digested for 5 h with 10 U MnlI (New England Biolabs. Beverly, MA), separated on a 3% agarose gel and visualized with ethidium bromide.
Mutagenesis and transfections
The template for mutagenesis was the hLHR complementary DNA (cDNA) kindly donated by Ares Advanced Technology (Ares-Serono Group). After subcloning the cDNA into pcDNA3.1/neo, a substitution of nucleotide 1370 of the hLHR gene was accomplished by mutagenesis using the PCR overlap extension method (10). The entire region that was amplified by PCR was verified by sequencing.
Human embryonic kidney 293 cells were maintained at 5% CO2 in a culture medium consisting of DMEM containing 50 µg/mL gentamicin, 10 mM HEPES, and 10% newborn calf serum. Cells were transfected at a 6080% confluence using the transient transfection procedure of Chen and Okayama (11) except that the overnight precipitation was performed in a 5% rather than 2.5% CO2 atmosphere. After 1820 h the cells were washed with Waymouths MB752/1 media modified with 50 µg/mL gentamicin and 1 mg/mL BSA, and then fresh growth medium was added. The cells were used for experiments 24 h later.
125I-labeled CG binding to intact cells
Human embryonic 293 cells were plated on gelatin-coated 35-mm wells and transfected as described above. On the day of the experiment, cells were cooled on ice for 10 min and then washed two times with cold Waymouths MB752/1 media lacking sodium bicarbonate but containing 50 µg/mL gentamicin and 1 mg/mL BSA. To determine the maximal binding capacity, the cells were then incubated overnight at 4 C in the same media containing a saturating concentration of 125I-labeled CG (100 ng/mL final concentration) with or without an excess of unlabeled CG (50 IU/mL final concentration). To determine the equilibrium binding paramenters, the cells were incubated with a subsaturating concentration of 125I-labeled CG alone or with increasing concentrations of unlabeled CG. The assay was finished by scraping the cells into a small volume of cold HBSS modified to contain 50 µg/mL gentamicin and 1 mg/mL BSA, centrifuging (1500 x g, 10 min), and washing the pellet in 2 mL of the same buffer. The data were analyzed using the computer program LIGAND to calculate the dissociation constant (Kd) (12, 13).
Measurement of cAMP production
In the same experiment, 293 cells were assayed both for maximal 125I-labeled CG binding to intact cells as well as for total (i.e. intracellular plus extracellular) cAMP production under basal and CG-stimulated conditions. Therefore, for any given experiment in which cAMP was determined, the levels of cell surface expression of receptor were also determined. Only those experiments in which the cells expressed comparable numbers of wild-type vs. mutant receptors were utilized for data analyses. The 293 cells were plated on gelatin-coated 35-mm wells and transfected as described above. On the day of the experiment, cells were washed twice with warm Waymouth MB752/1 media containing 50 µg/mL gentamicin and 1 mg/mL BSA and placed in 1 mL of the same medium containing 0.5 mM isobutylmethylxanthine. After 15 min at 37 C, buffer only or increasing concentrations of CG were added, and the incubation was continued for 60 min at 37 C. The cells were then placed on ice and cAMP was extracted by the addition of 1N perchloric acid containing 360 µg/mL theophylline and then measured by RIA. All determinations were performed either in duplicate or triplicate. The data for the cells expressing recombinant LHR wild type [rLHR(wt)] were subsequently analyzed using the computer program DeltaPlot to calculate the Rmax and EC50 for each curve.
| Results |
|---|
|
|
|---|
Direct sequencing of exon 11 of the hLHR gene revealed a
heterozygous substitution of T for G at nucleotide 1370 that converts
Leu457 (CTC) to Arg (CGC) in the helix III of the hLHR from patient 1
(Fig. 1
). In contrast, both parents
showed a normal sequence. The biological paternity and maternity were
confirmed by microsatellite repeat markers.
|
MnlI restriction enzyme analysis
The Leu457Arg mutation abolishes recognition sites for two
restriction endonucleases MnlI and Hph.
Restriction digestion of the PCR product with MnlI showed an
undigested fragment of 166 bp and two digested fragments of 129 and 37
bp in patient 1 with the L457R mutation (Fig. 2
). In contrast, a normal PCR product
digested entirely into two fragments of 129 and 37 bp.
|
The A568V substitution identified in patient 2 has previously been described in another family and has been shown to result in constitutive activation of the LHR (7). Therefore, no further functional studies of this mutation were carried out in the present study. In contrast, the identification of a L457R substitution in helix III of the LHR has not previously been described. Consequently, the following studies were performed to evaluate the functional status of this mutant hLHR.
Human embryonic 293 cells were transiently transfected with cDNAs
encoding either the hLHR(wt) or hLHR(L457R). As shown in Table 1
, cells expressing hLHR(L457R) bound CG
with the same high affinity as cells expressing hLHR(wt). Subsequent
experiments were performed to assess the cAMP produced by these cells
under both basal conditions and CG-stimulated conditions. Cells
transfected with the same amount of hLHR(L457R) cDNA as hLHR(wt) cDNA
expressed comparable levels of cell surface receptor. However, because
the numbers of receptors expressed (for any receptor cDNA) can vary
somewhat from experiment to experiment, and because both basal and
CG-stimulated cAMP production can be variable depending on the number
of cell surface receptors expressed (14, 15, 16), the experiments examining
cAMP responsiveness of the cells always contained parallel dishes in
which the maximal amount of 125I-labeled CG binding was
concomitantly determined. The data are presented only for those
experiments in which comparable levels of wild-type and mutant cell
surface receptors were observed. As shown in Table 2
, the basal levels of cAMP produced by
cells expressing hLHR(L457R) were significantly (7- to 14-fold) higher
than the cAMP levels produced by cells expressing comparable levels of
hLHR(wt). Interestingly, the cAMP levels in cells expressing
hLHR(L457R) were not further augmented by CG. This is strikingly
apparent when viewing a full dose-response curve for CG-stimulated cAMP
production in the hLHR(wt) vs. hLHR(L457R) cells, which was
done for Exps 2 and 3. As shown in Fig. 3
, cells expressing the wild-type
receptor exhibited a 20- to 25-fold stimulation of cAMP in response to
saturating concentrations of CG. In contrast, cells expressing
hLHR(L457R) produced the same levels of cAMP regardless of the
concentration of exogenous CG present.
|
|
|
| Discussion |
|---|
|
|
|---|
The L457R is a dominant mutation in the third transmembrane helix of the hLHR, a region for which an activating mutation for any of the gonadotropin hormone receptors has not yet been described. Activating mutations for other G protein-coupled receptors (GPCRs), however, have been reported in the third transmembrane helix, albeit not at this same position (see Refs. 18, 19, 20 for examples). Interestingly, two activating mutations (S505 and V509) in the related human TSH receptor are predicted to lie on the same helical face (20). The particular Leu 457 found to be mutated in this study is highly conserved among human, porcine, rat, and mouse LHRs, as well as among TSH and FSH receptors. Furthermore, within the superfamily of GPCRs, it is considered a consensus residue in that it is conserved in over 70% of the GPCR sequences analyzed by Baldwin (21), Baldwin et al. (22), and Lin et al. (23). In the structural model of GPCRs postulated by Baldwin (21) and Baldwin et al. (22), this Leu residue is positioned such that it faces the central cavity formed by the seven transmembrane helices. In addition, the Leu 457 is closely positioned to the absolutely conserved Arg at the end of third helix (21, 22). The high conservation and positioning of this residue suggests that it may play an important structural and/or functional role in other GPCRs as well. Within the hLHR, mutation of Leu457 to Arg abolishes two restriction sites of MnlI and Hph, which could facilitate rapid screening for this mutation by restriction fragment length polymorphism analysis.
As shown herein, substitution of Leu457 with Arg causes constitutive activation of the hLHR. There are several possible mechanisms, each of which is not exclusive of the others, by which this activation could occur. It is possible that Leu457 normally interacts with a residue in another helix that constrains the receptor in an inactive conformation. Substitution of Leu457 might disrupt this interaction, allowing flexibility of the receptor and its activation. This scenario would not be unlike the mechanism of activation of rhodopsin, which involves the disruption of interhelical interactions, resulting in increased mobility of the receptor helices (24, 25, 26). The possibility further exists that transmembrane helix three of the hLHR might be able to interact with and activate Gs, but that Leu457 normally constrains this interaction. The latter possibility is based on recent observations suggesting a direct role in helix VI of the hLHR in Gs activation (27). These latter two models complement each other, allowing one to envision how the disruption of interhelical interactions might cause greater flexibility of the helices, thus now allowing Gs to enter the cytoplasmic cleft formed by the transmembrane helices (24, 26, 28). Evidence for other GPCRs suggests that activation by mutations or by agonist occupancy appears to be associated with increased mobility of one or more helices. It has been suggested that this in turn may cause an enlargement of the cytoplasmic crevice, allowing access of Gs to residues previously held inaccessible (29). Lastly, it is also possible that the substitution of Leu457 with Arg causes a global conformational change that allosterically affects the conformation of intracellular loop regions involved in Gs activation.
Substitution of Leu457 in helix III with Arg causes constitutive activation of the receptor, presumably by allowing it to assume an activated R1 state, as hypothesized for the ternary activation model of GPCRs (30, 31). However, there are two important points to note. First, the activity of hLHR(L457R) mutant in its basal state is less than the wild-type receptor when stimulated with a maximally effective concentration of CG. Secondly, although the hLHR(L457R) mutant binds CG with normal high affinity and is expressed well at the cell surface, it is unresponsive to CG stimulation. These observations suggest that the conformation of hLHR(L457R) mutant is not equivalent to the R1 state of the agonist-occupied wild-type receptor. More likely, the hLHR(L457R) mutant represents a different R1 state, one that allows partial activation of Gs but that does not allow for further activation by agonist. Two other activating mutations of the hLHR (Ile542Leu in helix V and Cys581Arg in helix VI) have been described in which basal cAMP production is elevated, but the mutant receptors are not responsive to CG (4). A CG stimulation test in patient 1 confirmed the unresponsiveness of the L457R to CG. Although the mechanisms underlying these observations are as yet not known, they may be clinically relevant. We speculate that plasma testosterone in this Brazilian boy with the L457R mutation will not increase normally in response to the pubertal rise in circulating LH that should occur with the maturation of the hypothalamic-pituitary-gonadal axis. Interestingly, the serum testosterone levels in this boy were higher than in previously reported boys with hLHR activating mutations (1, 2, 5, 7). Although we have not yet directly compared cells expressing the L457R mutation with cells expressing comparable levels of the other activating mutations, we predict that the increased basal level of cAMP observed in L457R-expressing cells would be greater than in the others. In addition, the high testosterone levels in this patient may inhibit the normal pubertal gonadotropin secretion by a negative feedback mechanism, which could result in deleterious effects in his future fertility. These possibilities will be resolved with continued follow-up of this patient.
Testicular size is useful in the differential diagnosis of precocious puberty in boys and reflects development of seminiferous tubules. Patients with gonadotropin-dependent precocious puberty have testes of pubertal size, probably caused by testicular stimulation by both gonadotropins. On the other hand, testes of prepubertal size usually indicate an extratesticular source of androgens, such as virilizing congenital adrenal hyperplasia or adrenal tumor. GIPP or testotoxicosis has been characterized by increased testicular size, although less than expected for the degree of virilization. Patient 1 demonstrates that normal prepubertal testicular size can occur in patients with GIPP.
This study also identified the previously described Ala568Val mutation in the third intracellular loop of the LHR in a Brazilian black boy with GIPP. His normal prepubertal sister carried the same mutation in the LHR gene, suggesting an inherited form of precocious puberty in this boy. Previous studies demonstrated that this mutant receptor produced increased levels of basal cAMP, consistent with constitutive activation of the hLHR (7). Interestingly, the Ala568Val mutation was found only in two Brazilian natives of African descent, but not in 40 families previously published (2, 4, 7). The previously studied boy with Ala568Val was adopted, and it is unclear at this time whether these Brazilian kindreds share a common ancestral origin and thus, it might represent a founder effect of the LHR gene mutation in Brazil.
In summary, we have identified two point mutations, one within helix III and one in the third cytoplasmic loop, of the hLHR that are responsible for constitutive activation of testicular Leydig cells and consequent sexual precocity in these Brazilian boys. We conclude that the third transmembrane helix is a potential area for activating mutations of the hLHR that cause GIPP. Further studies on these and other activating mutations of the hLHR should provide valuable insights into the mechanism of action of the glycoprotein hormone receptors.
| Note Added In Proof |
|---|
|
|
|---|
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Supported by NIH Grant HD22196. ![]()
Received January 22, 1998.
Revised January 31, 1998.
Accepted April 8, 1998.
| References |
|---|
|
|
|---|
1-adrenergic receptor subtypes identify critical
residues that modulate active state isomerization. J Biol Chem. 271:79567964.
1b-adrenergic receptor is initiated by disruption of an
interhelical salt bridge constraint. J Biol Chem. 271:2831828323.This article has been cited by other articles:
![]() |
M. Zhang, Y.-X. Tao, G. L. Ryan, X. Feng, F. Fanelli, and D. L. Segaloff Intrinsic Differences in the Response of the Human Lutropin Receptor Versus the Human Follitropin Receptor to Activating Mutations J. Biol. Chem., August 31, 2007; 282(35): 25527 - 25539. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Nurwakagari, A. Breit, C. Hess, H. Salman-Livny, D. Ben-Menahem, and T. Gudermann A conformational contribution of the luteinizing hormone-receptor ectodomain to receptor activation J. Mol. Endocrinol., February 1, 2007; 38(2): 259 - 275. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Galet and M. Ascoli A Constitutively Active Mutant of the Human Lutropin Receptor (hLHR-L457R) Escapes Lysosomal Targeting and Degradation Mol. Endocrinol., November 1, 2006; 20(11): 2931 - 2945. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zhang, D. Mizrachi, F. Fanelli, and D. L. Segaloff The Formation of a Salt Bridge Between Helices 3 and 6 Is Responsible for the Constitutive Activity and Lack of Hormone Responsiveness of the Naturally Occurring L457R Mutation of the Human Lutropin Receptor J. Biol. Chem., July 15, 2005; 280(28): 26169 - 26176. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hirakawa and M. Ascoli A Constitutively Active Somatic Mutation of the Human Lutropin Receptor Found in Leydig Cell Tumors Activates the Same Families of G Proteins as Germ Line Mutations Associated with Leydig Cell Hyperplasia Endocrinology, September 1, 2003; 144(9): 3872 - 3878. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Shinozaki, V. Butnev, Y.-X. Tao, K. L. Ang, M. Conti, and D. L. Segaloff Desensitization of Gs-Coupled Receptor Signaling by Constitutively Active Mutants of the Human Lutropin/Choriogonadotropin Receptor J. Clin. Endocrinol. Metab., March 1, 2003; 88(3): 1194 - 1204. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ascoli, F. Fanelli, and D. L. Segaloff The Lutropin/Choriogonadotropin Receptor, A 2002 Perspective Endocr. Rev., April 1, 2002; 23(2): 141 - 174. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hirakawa, C. Galet, and M. Ascoli MA-10 Cells Transfected with the Human Lutropin/Choriogonadotropin Receptor (hLHR): A Novel Experimental Paradigm to Study the Functional Properties of the hLHR Endocrinology, March 1, 2002; 143(3): 1026 - 1035. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Shinozaki, F. Fanelli, X. Liu, J. Jaquette, K. Nakamura, and D. L. Segaloff Pleiotropic Effects of Substitutions of a Highly Conserved Leucine in Transmembrane Helix III of the Human Lutropin/Choriogonadotropin Receptor with Respect to Constitutive Activation and Hormone Responsiveness Mol. Endocrinol., June 1, 2001; 15(6): 972 - 984. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Latronico, H. Shinozaki, G. Guerra Jr., M. A. A. Pereira, S. H. V. Lemos Marini, M. T. M. Baptista, I. J. P. Arnhold, F. Fanelli, B. B. Mendonca, and D. L. Segaloff Gonadotropin-Independent Precocious Puberty Due to Luteinizing Hormone Receptor Mutations in Brazilian Boys: A Novel Constitutively Activating Mutation in the First Transmembrane Helix J. Clin. Endocrinol. Metab., December 1, 2000; 85(12): 4799 - 4805. [Abstract] [Full Text] |
||||
![]() |
L. Min and M. Ascoli Effect of Activating and Inactivating Mutations on the Phosphorylation and Trafficking of the Human Lutropin/Choriogonadotropin Receptor Mol. Endocrinol., November 1, 2000; 14(11): 1797 - 1810. [Abstract] [Full Text] |
||||
![]() |
A. P. N. Themmen and I. T. Huhtaniemi Mutations of Gonadotropins and Gonadotropin Receptors: Elucidating the Physiology and Pathophysiology of Pituitary-Gonadal Function Endocr. Rev., October 1, 2000; 21(5): 551 - 583. [Abstract] [Full Text] |
||||
![]() |
Y.-X. Tao, A. N. Abell, X. Liu, K. Nakamura, and D. L. Segaloff Constitutive Activation of G Protein-Coupled Receptors as a Result of Selective Substitution of a Conserved Leucine Residue in Transmembrane Helix III Mol. Endocrinol., August 1, 2000; 14(8): 1272 - 1282. [Abstract] [Full Text] |
||||
![]() |
K. Nakamura, M. d. F. M. Lazari, S. Li, C. Korgaonkar, and M. Ascoli Role of the Rate of Internalization of the Agonist-Receptor Complex on the Agonist-Induced Down-Regulation of the Lutropin/ Choriogonadotropin Receptor Mol. Endocrinol., August 1, 1999; 13(8): 1295 - 1304. [Abstract] [Full Text] |
||||
![]() |
K.-S. Min, X. Liu, J. Fabritz, J. Jaquette, A. N. Abell, and M. Ascoli Mutations That Induce Constitutive Activation and Mutations That Impair Signal Transduction Modulate the Basal and/or Agonist-stimulated Internalization of the Lutropin/Choriogonadotropin Receptor J. Biol. Chem., December 25, 1998; 273(52): 34911 - 34919. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Abell, D. J. McCormick, and D. L. Segaloff Certain Activating Mutations within Helix 6 of the Human Luteinizing Hormone Receptor May Be Explained by Alterations That Allow Transmembrane Regions to Activate Gs Mol. Endocrinol., December 1, 1998; 12(12): 1857 - 1869. [Abstract] [Full Text] |
||||
![]() |
L. Min, C. Galet, and M. Ascoli The Association of Arrestin-3 with the Human Lutropin/Choriogonadotropin Receptor Depends Mostly on Receptor Activation Rather than on Receptor Phosphorylation J. Biol. Chem., January 4, 2002; 277(1): 702 - 710. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |