| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Department of Obstetrics and Gynecology, Helsinki University Central Hospital (A.S., E.M.R.); Department of Pathology, University of Helsinki (P.H.); and Department of Clinical Chemistry, Helsinki University Central Hospital (S.L.), Helsinki, Finland
Address all correspondence and requests for reprints to: Anna Salmi, The Research Laboratory of the Department of Obstetrics and Gynecology, Helsinki University Central Hospital, Haartmaninkatu 2, FIN-00290, Helsinki, Finland
| Abstract |
|---|
|
|
|---|
From our data we conclude that 1) c-jun mRNA is differentially expressed in endometrial epithelial and stromal cells; 2) c-jun mRNA is cyclically regulated in the human endometrial epithelium; 3) c-jun mRNA expression is temporally related to epithelial proliferation in the endometrium; and 4) c-Jun protein is present in the human endometrium throughout the menstrual cycle.
| Introduction |
|---|
|
|
|---|
In whole rat uterus, c-jun has been shown to be induced by estrogen, and this activation was not abolished by the protein synthesis inhibitor cycloheximide, suggesting that c-Jun activation is a primary response to estrogen (4). In a later study with polyclonal antibodies to c-Jun protein, the most intensive staining was located in rat endometrial epithelial cells after 17ß-estradiol stimulation (6). In contrast to the data of this immunohistochemical study, 17ß-estradiol has been reported to repress c-jun messenger RNA (mRNA) expression in endometrial epithelial cells of ovariectomized rats (7, 8), and progesterone was able to block this estrogen effect. In ovariectomized mice, both 17ß-estradiol and estriol increase the expression of c-jun mRNA and its protein product in endometrial glandular epithelium (9).
We previously demonstrated by Northern blotting that the human c-jun gene is strongly expressed in proliferative to midsecretory phase endometrium and nearly lacking in early and term pregnancy decidua (10, 11). No cyclic changes in endometrial c-jun expression were detected during the normal menstrual cycle, although the great difference between the pregnant and nonpregnant state supports the idea of hormonal regulation. To gain insight into the physiological role of c-jun, we now used in situ hybridization and immunohistochemistry to localize c-jun mRNA and its protein product in human endometrial cells during the menstrual cycle and pregnancy and in relation to the proliferation marker Ki-67.
| Materials and Methods |
|---|
|
|
|---|
Tissue specimens were collected at the Department of Obstetrics and Gynecology, Helsinki University Central Hospital. A total of 47 samples of normal endometrium, 25 samples of secretory endometrium, and 22 samples of proliferative endometrium were obtained from women undergoing endometrial biopsy or hysterectomy for benign conditions (leiomyomas, adenomyosis, uterine prolapse). None of the patients had any hormonal treatment. Four decidual samples were taken from patients who underwent legal abortion for social reasons, and four decidual samples were taken at elective cesarean sections. None of the women had any medication before surgery. All the specimens were fixed in formalin and embedded in paraffin for further processing. The study was performed with the approval of the hospital ethical committee.
Probes
Single-strand RNA probes were used. Probes were prepared complementary to c-jun mRNA (antisense probe) or in sense orientation (control). The nucleotide sequence of the antisense (AS) primer was 5' GTAAAATCTGCCACCAATTC 3', and that of the sense (S) primer was 5' TACTCCCCTAACCTCTTTTC 3', based on the previously published sequence of the c-jun gene (12). The primers produce a fragment of 411 bp. Single-strand complementary DNA (cDNA) was synthesized from 1 µg of the total RNA isolated from normal human endometrium by guanidium-thiocyanate-phenol-chloroform extraction (13), using Moloney murine leukemia virus reverse transcriptase according to the manufacturers recommendations (GIBCO BRL, Gaithersburg, MD) and the above-mentioned specific AS primer for c-jun. The cDNA product was diluted in TE buffer (Tris-HCl 10 mM, pH 8.0, EDTA 1.0 mM) (1:5). The cDNA was amplified by PCR. Typically, 50 µL of reaction mixture consisted of 1x PCR buffer (DyNAzyme, Finnenzymes, Finland), 0.2 mM deoxynucleotide triphosphate, 20 pmol of both primers, 1.0 U DNA polymerase (DyNAzyme), and 5 µL of cDNA. The amplification profile consisted of denaturation at 94 C for 1 min, annealing at 55 C for 1 min, extension at 72 C for 1 min, with final extension at 72 C for 15 min. Thirty-five cycles were run. The product (12 µL) was electrophoresed on a 1.5% agarose gel and visualized by the ethidium bromide staining. DNA was cloned into a pCRII plasmid vector (TA Cloning version 2.3, Invitrogen Corp., NV Leek, The Netherlands). PCRs were run from the clones, and clones with PCR products of the correct size (411 bp) were chosen for DNA extraction. Recombinant DNAs were extracted (Wizard Minipreps, DNA Purification System, Promega, Madison, WI) and sequenced with 40 Universal M13 Sequencing Primer, using a Thermo Sequenase kit (Amersham, Buckinghamshire, U.K.). Thereafter, the plasmid was linearized with an appropriate restriction enzyme, i.e. BamHI (Promega) for the AS probe and XbaI (GIBCO BRL) for the S probe, and the labeled RNA probes were synthesized with SP6 (for S) or T7 (for AS) RNA polymerases using digoxigenin-labeled uridine-triphosphate (DIG RNA Labeling Kit, Boehringer Mannheim, Mannheim, Germany). The labeled probes were stored at -80 C.
In situ hybridization
All reagents, solutions, and equipment used in prehybridization and hybridization were RNase-free. Silane-coated slides and 6-µm sectioning were used for in situ hybridization. In addition, one slide of each tissue was stained by Herowici staining for dating the endometrium. Paraffin-embedded tissue sections were dewaxed with xylene and rehydrated by sequential incubation in ethanol. The sections were then incubated twice for 5 min in PBS (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4), then in PBS containing 100 mM glycine, twice for 5 min, and in PBS containing 0.3% Triton-X-100 for 15 min. After washing with PBS twice for 5 min, the sections were permeabilized at 37 C with 100 mM Tris-HCl, 50 mM EDTA, pH 8.0, containing 10 µg RNase-free proteinase K/mL (Boehringer Mannheim). Sections were post-fixed at 4 C for 8 min with PBS containing 4% paraformaldehyde and washed with PBS two times for 10 min. To prevent nonspecific binding of the probe, the sections were acetylated with 0.1 M triethanolamine buffer, pH 8.0, containing 0.25% acetic anhydride (Sigma Chemical Co., St. Louis, MO), twice for 5 min. Prehybridization of the sections was carried out at 37 C for 20 min with 4x SSC (1x SSC is 150 mM NaCl, 15 mM sodium citrate, pH 7.2) containing 50% deionized formamide. The sections were hybridized at 42 C for 24 h in hybridization buffer containing 40% deionized formamide, 10% dextran sulfate, 1x Denharts solution (0.02% Ficoll, 0.02% polyvinylpyrrolidone, 10 mg RNase-free BSA/mL), 4x SSC, 10 mM dithiothreitol, 1 mg yeast transfer RNA/mL (Boehringer Mannheim), 1 mg salmon sperm DNA/mL (GIBCO BRL), and 20 ng digoxigenin-labeled RNA probe/100 µL (sense and antisense slide for each tissue). The sections were washed for 10 min at room temperature and at 37 C (for 2 x 15 min) with 2x SSC, with 1x SSC (for 2 x 15 min), and with 0.1x SSC (for 2 x 30 min). In immunological detection, the sections were first washed for 10 min with buffer 1 (100 mM Tris-HCl, pH 7.5, 150 mM NaCl). The sections were blocked for 30 min with buffer 1 containing 4% normal goat serum (Vector Labs., Burlingame, CA). Thereafter, the sections were incubated at 37 C for 1 h with buffer 1 containing 2% normal goat serum and anti-DIG-alkaline phosphatase Fab fragments (1.5 U/mL) (Boehringer Mannheim). The sections were washed for 2 x 10 min with buffer 1 and for 10 min with buffer 2 (100 mM Tris-HCl, pH 9.5, 100 mM NaCl, 50 mM M9Cl2). The color reaction was created with 2-methyl-4-chlorobenzenediazoniumtetrachlorozincate (Fast Red Tablets, Boehringer Mannheim) diluted in 0.1 M Tris-HCl, pH 8.0. The reaction was stopped after 30 min by incubating the sections in TE-buffer. The slides were washed with distilled water and counterstained with diluted hematoxylin.
Immunohistochemistry of Ki-67 and c-Jun proteins
The detection of Ki-67 was carried out with monoclonal mouse antihuman antibody to Ki-67 (Pharmingen, San Diego, CA). The ABC immunoperoxidase staining was carried out by using commercial kit (Vector Labs.). The formaline-fixed, paraffin wax-embedded tissue sections (5 µm) were deparaffinized in xylene and rehydrated by sequential incubation in ethanol. The deparaffinized tissue sections were pretreated with 10 mM citric acid, pH 6.0, in a microwave oven for 2 x 5 min and left in the buffer at room temperature for 60 min before the staining procedure. All washings were performed using 10 mM PBS, pH 7.4. The sections were treated with 0.06% hydrogen peroxide in methanol for 10 min to quench the endogenous peroxidase activity, and blocked with normal horse serum (1:20) (Vector Labs.) for 30 min to reduce nonspecific binding of antibodies. A primary antibody diluted in PBS (1.7 µg/mL) was added, and the sections were incubated overnight at 4 C. After rinsing, biotinylated second-step rabbit antimouse immunoglobulins (Dako, Glostrup, Denmark) were added (5.5 µg/mL) for 30 min, followed by an ABC reagent for 30 min. The sites of antibody binding were demonstrated by developing the peroxidase reaction with 3-amino-9-ethyl-carbazole in 50 mM acetate buffer, pH 5.0, containing 0.03% hydrogen peroxide, for 15 min. The sections were rinsed with water and counterstained with diluted hematoxylin. For each tissue section, a negative control was stained by replacing the first antibody with an inappropriate monoclonal antibody of the same immunoglobulin class as the monoclonal antibody to Ki-67.
The detection of c-Jun was carried out with polyclonal rabbit antibody to c-jun/AP-1 (Ab-1) (Calbiochem, Gambridge, MA). The immunoperoxidase staining was carried out by using commercial kit (EnVision + System, Peroxidase, Rabbit, AEG/Dako). The pretreatment of tissue sections was identical with the protocol of Ki-67. The sections were treated with 0.06% hydrogen peroxide in water for 10 min to quench the endogenous peroxidase activity, and blocking serum was not needed. A primary antibody diluted in PBS (1 µg/mL) was added, and the sections were incubated overnight at 4 C. After rinsing, second-step immunoglobulins (Dako) were added for 30 min. The peroxidase reaction and staining were carried out, as described above. For each tissue section, a negative control was stained by replacing the first antibody with nonimmune rabbit IgG.
Data analysis
The dating, according to the criteria of Noyes et al. (14, 15), and evaluation of the cellular expression of c-jun mRNA and immunostaining were carried out by two independent observers and confirmed by the pathologist (P.H.). The cellular hybridization signal intensity and Ki-67 staining were scored from + to +++, where + = weak expression, ++ = moderate expression, and +++ = strong expression.
| Results |
|---|
|
|
|---|
The cellular localization of c-jun mRNA expression in
human endometrium at different phases of the menstrual cycle and in
pregnancy is shown in Tables 1
and 2
. In 10 early proliferative endometria,
c-jun mRNA was strongly expressed in the luminal and
glandular epithelium, as well as in fibroblast-like stromal cells (Fig. 1B
, b). In 12 midproliferative endometria,
the hybridization pattern did not differ from that during early
proliferation (Fig. 1D
, d). In early secretory phase endometria (days
1516), intense hybridization signals were still detected in all
endometrial compartments (Fig. 1F
). In mid- and late secretory
endometria, c-jun mRNA expression was weak in the luminal
epithelium and also diminished in the glandular epithelium, compared
with that in the proliferative phase endometrium (Fig. 1
, F,f and H,h).
In stromal cells, hybridization remained unchanged, and the strongest
signals were identified beneath the luminal epithelium and were also
detectable in the predecidualized stromal cells. In all cycling
endometria, strong hybridization signals were observed in vascular
endothelial cells, both in the endometrium itself and the myometrium
(Figs. 1D
and 2B
). Low but constant
c-jun mRNA expression was also detectable in myometrial
muscle cells throughout the menstrual cycle (Fig. 2B
).
|
|
|
|
c-Jun protein immunohistochemistry
The localization of c-Jun protein was studied in 28 cycling (15
proliferative, 13 secretory) endometrial tissue samples and in 8
pregnancy decidua. Nuclear immunostaining of c-Jun was detected in
luminal and glandular epithelial cells as well as in stromal cells
throughout the menstrual cycle (Fig. 3
, B, b, D, d, F, f, H, h). Staining intensity seemed to be weaker in
early- and midsecretory phase endometria (Fig. 3D
, d), especially in the
luminal epithelium, but the sample-to-sample differences were bigger
than phase-to-phase differences, and no strict cyclicity in the
c-Jun expression could be found. In pregnancy decidua, the nuclear
staining was predominantly negative in all cell types, but the
cytoplasm of some decidual cells showed strong immunoreactivity (Fig. 3
H,h).
|
Ki-67 antigen was analyzed by immunohistochemistry in nine
proliferative and six secretory endometria as well as in eight
pregnancy decidua (Table 3
). Throughout
the follicular phase, Ki-67-positive nuclei were detected in the
luminal epithelial cells and in the glandular and stromal cells of the
stratum functionalis (Fig. 4B
).
In the stratum basalis, hardly any positive staining was identified.
Ki-67-positive cells diminished in the luminal and glandular epithelium
during the early luteal phase (Fig. 4D
) and vanished in the same cells
in the late luteal phase. In the stroma, positive nuclei were detected
in the stratum functionalis throughout the secretory phase (Fig. 4D
).
Stratum basalis also was negative for Ki-67 in the luteal phase. During
early gestation, Ki-67-positive cells were sparsely scattered in the
decidua (Fig. 4F
), and at term pregnancy, hardly any positive nuclei
were detected (Fig. 4H
).
|
|
| Discussion |
|---|
|
|
|---|
Interestingly, regulation of c-jun expression appears to differ between rats and humans. In two studies on rats, clear depression of c-jun mRNA levels was noticed in endometrial epithelial cells after estrogen stimulation (7, 8), and c-jun mRNA depression and epithelial cell proliferation were suggested to be linked (8). In the present study, the connection between epithelial cell proliferation and c-jun activation seemed strikingly evident in humans. Our results also speak in favor of the role of estrogen as a positive regulator of c-jun in human endometrial epithelium, as the presence and disappearance of estrogen receptors parallel c-jun mRNA expression (11, 17, 18). Alternatively, c-jun mRNA expression might be regulated by progesterone receptor (PR) in human endometrium, because Bamberger and co-workers (19) showed that unliganded PR stimulates AP-1 activity in endometrial adenocarcinoma cells, and that the addition of progesterone reverses this effect. In accordance, c-jun mRNA expression was strongest in epithelial cells during the follicular phase, when the amount of PRs is most abundant and progesterone is lacking (16, 17, 18). During the early- to midluteal phase, when circulating progesterone levels are increasing and PRs decreasing (20), c-jun expression diminished in epithelial cells. Although the remarkably increased progesterone secretion during pregnancy also could account for the suppression of the c-jun mRNA in the stromal cells, the constant expression of the mRNA throughout the menstrual cycle suggests that the regulation of c-jun is different in endometrial epithelial and stromal cells. In decidua, other pregnancy-associated factors may be responsible for c-jun inhibition as well.
In contrast to the gene expression, no cyclicity was detected in nuclear immunostaining of c-Jun protein in the endometrium. The positive staining throughout the menstrual cycle also suggests that posttranscriptional factors are involved in the regulation of c-Jun protein production, and that this protein is likely to have divergent roles in the proliferative and secretory phase endometrium. Nonspecific immunoreactivity may account for the intense staining in the cytoplasm of some decidualized cells in pregnancy endometrium, in the absence of nuclear staining and c-jun mRNA expression.
Several investigators have shown myometrial c-jun mRNA induction by estrogen in ovariectomized rats (6, 7, 8). In one study on human tissues using RT-PCR, myometrial c-jun mRNA levels were reported to be significantly higher in the follicular phase of the menstrual cycle than in the luteal phase (21). In our study, although focused on the endometrium, no cyclic changes of c-jun expression were noticed in human myometrium during the menstrual cycle.
Constant hybridization of c-jun mRNA was also detected in human endometrial and myometrial endothelial cells. Earlier, a number of investigators using various endothelial cell lines have shown that c-jun can be induced by several growth factors (22, 23, 24). It is likely that in the human uterus endothelial cell c-jun expression is regulated by local factors or by circulating factors other than ovarian steroid hormones, because no cyclicity of expression was noticed and because no steroid receptors have been proven to exist in endothelial cells with certainty. In our study, c-jun mRNA was located in trophoblast cells during early gestation, in keeping with previously published Northern blot data on the human placenta (25).
In conclusion, we demonstrated that c-jun mRNA is cyclically expressed in the human endometrial epithelium. Based on the temporal association between c-jun expression and proliferation of epithelial cells, we suggest that c-jun is an important mediator of estrogen action in human endometrial epithelial cell proliferation, either directly or through unliganded PR. These results also call for further studies on pathological endometrium; both in malignant conditions and disorders of bleeding.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received March 4, 1997.
Revised October 22, 1997.
Revised January 12, 1998.
Accepted January 29, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. Shazand, S. Baban, C. Prive, B. Malette, P. Croteau, M. Lagace, J.-B. Racine, and P. Hugo FOXO1 and c-jun transcription factors mRNA are modulated in endometriosis Mol. Hum. Reprod., December 1, 2004; 10(12): 871 - 877. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Li, H. Abe, K. Ueki, K. Kumagai, R. Araki, and Y. Otsuki Identification of c-Jun as bcl-2 Transcription Factor in Human Uterine Endometrium J. Histochem. Cytochem., December 1, 2003; 51(12): 1601 - 1609. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-J. Tsai, M.-H. Wu, H.-M. Chen, P.-C. Chuang, and L.-Y. C. Wing Fibroblast Growth Factor-9 Is an Endometrial Stromal Growth Factor Endocrinology, July 1, 2002; 143(7): 2715 - 2721. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. E. Hale, C. L. Hughes, and J. M. Cline Endometrial Cancer: Hormonal Factors, the Perimenopausal ""Window of Risk,"" and Isoflavones J. Clin. Endocrinol. Metab., January 1, 2002; 87(1): 3 - 15. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Hurskainen, A. Salmi, J. Paavonen, J. Teperi, and E.-M. Rutanen Expression of sex steroid receptors and Ki-67 in the endometria of menorrhagic women: effects of intrauterine levonorgestrel Mol. Hum. Reprod., November 1, 2000; 6(11): 1013 - 1018. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |