help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gagné, N.
Right arrow Articles by Van Vliet, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gagné, N.
Right arrow Articles by Van Vliet, G.
The Journal of Clinical Endocrinology & Metabolism Vol. 83, No. 5 1771-1775
Copyright © 1998 by The Endocrine Society


Original Studies

Apparent Congenital Athyreosis Contrasting with Normal Plasma Thyroglobulin Levels and Associated with Inactivating Mutations in the Thyrotropin Receptor Gene: Are Athyreosis and Ectopic Thyroid Distinct Entities?1

N. Gagné2, J. Parma2, C. Deal, G. Vassart and G. Van Vliet

Department of Pediatrics, Hôpital Sainte-Justine, Université de Montréal (N.G., C.D., G.V.V.), Québec, Canada H3T 1C5; and Department of Medical Genetics (J.P., G.V.) and Institut de Recherche Interdisciplinaire (G.V.), Université Libre de Bruxelles, 1070 Brussels, Belgium

Address all correspondence and requests for reprints to: Guy Van Vliet, Hôpital Sainte-Justine, 3175 Côte Sainte-Catherine, Montréal, Québec, Canada H3T 1C5. E-mail: vanvlieg{at}ere.umontreal.ca


    Abstract
 Top
 Abstract
 Introduction
 Case report
 Methods
 Results
 Discussion
 References
 
Loss-of-function mutations in the TSH receptor gene (TSH-R), usually leading to asymptomatic hyperthyrotropinemia, have been reported since 1995 in a total of eight pedigrees, with a pattern of transmission suggesting autosomal recessive inheritance. Although normal TSH secretion and action are not necessary for normal migration of the thyroid anlage, they are essential for normal thyroid growth and function. In keeping with this concept, we report a severely hypothyroid boy with a normally located but very hypoplastic and hypofunctional thyroid caused by TSH-R loss-of-function mutations. The propositus’ maternal great aunt also had apparent athyreosis. The propositus had undetectable uptake on 99mpertechnetate scintigraphy but normal plasma thyroglobulin at 15 days of age. He was found to be a compound heterozygote for TSH-R mutations, with the maternal allele carrying a splicing mutation (G to C transversion at position +3 of the donor site of intron 6) and the other allele a deletion of two nucleotides (2 bases of codon 655 in exon 10). The great aunt’s TSH-R was normal. We also report the sex ratio of hypothyroid newborns referred to our center since 1989 with apparent athyreosis (5 girls, 7 boys) and with ectopic thyroid tissue (41 girls, 15 boys). We conclude that different genetic and nongenetic mechanisms for athyreosis and ectopic thyroid are likely, and that these two distinct entities are themselves heterogeneous. Our results further show that inactivating mutations in TSH-R may account for some cases of apparent congenital athyreosis and should be suspected, especially if plasma thyroglobulin levels are normal.


    Introduction
 Top
 Abstract
 Introduction
 Case report
 Methods
 Results
 Discussion
 References
 
IN iodine-sufficient areas, congenital hypothyroidism is caused by either thyroid dysgenesis (a category in which ectopic thyroid tissue and athyreosis are generally considered together) or metabolic blocks causing goiter. Although thyroid dysgenesis is considered sporadic, metabolic blocks are inherited as autosomal recessive traits (1, 2). More recently, resistance to TSH caused by loss-of-function mutations of the TSH-receptor gene (TSH-R) have been described: the phenotype has varied from asymptomatic hyperthyrotropinemia (3, 4, 5, 6) to severe congenital hypothyroidism in two siblings (7) (Table 1Go). Current evidence favors an autosomal recessive mode of inheritance. We describe a boy who presented with severe congenital hypothyroidism, undetectable uptake on 99mpertechnetate scintigraphy, normal plasma thyroglobulin (Tg), and who was found to be a compound heterozygote for loss-of-function TSH-R mutations.


View this table:
[in this window]
[in a new window]
 
Table 1. Published patients with TSH-R loss-of-function mutations

 

    Case report
 Top
 Abstract
 Introduction
 Case report
 Methods
 Results
 Discussion
 References
 
The patient is the first child of a nonconsanguineous French-Canadian couple and was referred because of a TSH level on neonatal screening at day 3 of life of 119 mIU/L (N < 15 mIU/L). The family history revealed that a maternal great aunt, now aged 20 yr, has congenital hypothyroidism attributed to athyreosis and is in good health on levothyroxine treatment. The propositus was born at term, following an uncomplicated pregnancy and delivery, with a weight of 3.150 kg. The immediate postnatal period was uneventful but the baby, when seen by us at 15 days of age, was found to be severely hypothyroid: he had persistent jaundice, a myxedematous facies, a large posterior fontanelle, and an umbilical hernia. No thyroid tissue was palpable. Plasma TSH was 1390 mIU/L, free T4 was < 2.5 pmol/L (N = 9–27 pmol/L), and Tg was 86 µg/L [N = 34–700 µg/L (8)]. The ossification centers of the knee were absent on x-ray, indicating a severe hypothyroid state (2). Thyroid scintigraphy with 99mpertechnetate did not reveal any functional thyroid tissue in the lingual, cervical, or mediastinal area. The mother was clinically and biochemically euthyroid, and neither she nor the baby had antithyroperoxidase antibodies. On the day of first evaluation, the baby was started on levothyroxine at a dose of 37.5 µg/day. His plasma TSH initially normalized but increased again at 9 months of age, indicating that hypothyroidism is permanent. Clinical assessment to date reveals normal growth and development at the age of 17 months. At the last visit, a neck ultrasound revealed two paratracheal hypoechogenic structures of 4 mm in diameter, compatible with a very hypoplastic thyroid gland (7). Because of the unusual positive family history of athyreosis and of the detectable Tg, we hypothesized that this child had a TSH-R mutation.


    Methods
 Top
 Abstract
 Introduction
 Case report
 Methods
 Results
 Discussion
 References
 
Genomic DNA was isolated from peripheral blood leukocytes of the propositus and his mother (the father was unavailable), as well as from the great aunt and her parents. All 10 exons of the TSH-R gene, together with their flanking intronic segments were amplified by PCR and sequenced as described previously (7).

Because sequencing revealed the possibility of a splicing mutation in one allele (see Results), the structure of TSH-R complementary DNA (cDNA) was also studied in the exons 4–7 region by RT-PCR. RT of peripheral leukocyte RNA was performed as described (3), and the segment of interest was amplified with fluorescent primers (forward: 5'ACATAGACCCTGATGCCCTC3'; reverse: 5'TGTCCCATTGAAAGCATATCC3'). The size of the resulting fluorescent PCR segments was determined by polyacrylamide gel electrophoresis on an ABI 373 sequencer (Perkin Elmer, Zaventem, Belgium). The cDNA segments were eluted from a preparative electrophoresis and sequenced by the dye terminator method (Dye Terminator Ready Kit (Applied Biosystems, Warrington, UK), ABI 373 sequencer: Perkin Elmer).


    Results
 Top
 Abstract
 Introduction
 Case report
 Methods
 Results
 Discussion
 References
 
The propositus was found to be a compound heterozygote, harboring a G to C transversion at position +3 of the splice donor site in intron 6 (G->C +3 IVS6) in one allele and a deletion of 2 bases of codon 655 in exon 10 (del AC 655) in the other allele. The mother of the propositus harbors the G->C +3 IVS6 mutation in one allele, although the other allele is normal. In the maternal great aunt and her parents, no mutation was identified. This negative result in the great aunt was confirmed on a second blood sample collected at a later date. The mutational analysis of the pedigree is summarized in Fig. 1Go.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 1. Mutational analysis of pedigree.

 
The frameshift mutation is expected to cause premature termination of translation at codon 656, within the third extracellular loop of the receptor. The functional consequences of the G->C+3 IVS6 mutation was explored by RT-PCR performed on messenger RNA (mRNA) from peripheral leukocytes, as described by Sunthornthepvarakul et al. (3). A cDNA segment encompassing exons 4–7 was amplified in the mother, the propositus, and unrelated controls (Fig. 2Go): in both the mother and propositus, a 176-bp segment was amplified in addition to the expected 254-bp normal segment; whereas the sequence of the 254-bp segment displayed the expected junctions between exons 5, 6, and 7, the 176-bp segment displayed an abnormal exon 5-exon 7 junction, with complete absence of exon 6. Skipping of exon 6 (78 bp) does not modify the reading frame. A nonspecific 201-bp segment, with no relation to the TSH-R, was also observed in all samples (Fig. 2Go).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 2. Abnormal splicing of TSH-R mRNA encoded by maternal allele. A schematic representation of exons 4–7 region of cDNA is represented on the left, with indication of expected sizes of normal 254-bp (top) and abnormal 176-bp (bottom) segments amplified by RT-PCR (see Methods). a, Genescan analysis of PCR segments in a normal subject (top) and in propositus (bottom); sample from mother gave a similar picture (not shown). b, Illustration of normal junctions between exons 5, 6, and 7 present in 254-bp segment (top) and of abnormal exon 5-exon 7 junction present in 176-bp segment; 201-bp segment corresponds to a nonspecific product of RT-PCR, unrelated to TSH-R.

 

    Discussion
 Top
 Abstract
 Introduction
 Case report
 Methods
 Results
 Discussion
 References
 
TSH is not required for the development and migration of the thyroid anlage but is essential for thyroid growth and function; thus, TSH deficiency or insensitivity results in a hypoplastic and hypofunctional but normally located thyroid gland. The hypothesis that TSH unresponsiveness could cause congenital hypothyroidism was proposed by Stanbury et al. in 1968 (9). With the cloning of the cDNA for the human TSH-R, a seven-transmembrane domain, G protein-coupled receptor (10, 11), it became possible to screen for both activating and inactivating mutations of the TSH-R (12).

In 1995, Sunthornthepvarakul et al. (3) described 3 sisters presenting with hyperthyrotropinemia who were found to be compound heterozygotes for inactivating mutations of the TSH-R. Since then, inactivating mutations of the TSH-R have been reported in 11 other patients from 8 unrelated families of different ethnic backgrounds. Figure 3Go represents all the loss-of-function mutations reported to date. There does not seem to be any hot spot for loss-of-function mutations: they have been identified in exons 1, 4, 6, and 10 (exon 10 encodes the entire serpentine structure). The phenotypic manifestations are variable and range from asymptomatic hyperthyrotropinemia to severe congenital hypothyroidism with absent 99mpertechnetate uptake on thyroid scintigraphy in 2 siblings (4, 5, 6, 7) (Table 1Go). Table 1Go lists all the inactivating mutations of the TSH-R described to date along with clinical, biochemical, and scintigraphic evaluations. Our case is the third described with apparent athyreosis on scintigraphy. There does not seem to be any relationship between the mutated areas of the TSH-R and the clinical and biochemical severity of the phenotype.



View larger version (58K):
[in this window]
[in a new window]
 
Figure 3. Schematic representation of TSH receptor, with indication of residues implicated in loss-of-function mutations.

 
The G->C +3 IVS6 mutation found in the allele our patient inherited from his mother is the first mutation described in an intron of the TSH-R. A cytosine is found at position +3 in less than 3% of intron donor sites (13). Alterations at the +3 position of a splice donor site have been shown to disrupt normal mRNA processing and have been incriminated as the cause of 14 other human genetic diseases (14). In the present case, the consequence is the skipping of exon 6 (Fig. 2Go), which results in the absence of one leucine-rich motif from the aminoterminal hormone binding domain of the receptor (15). This is expected to have a dramatic negative effect on the recognition of TSH by the receptor (16). The other mutated allele in our patient (del AC 655) encodes a truncated receptor lacking part of the third extracellular loop, the seventh transmembrane segment, and the intracytoplasmic tail. From all available data on G protein-coupled receptors, it is clear that this mutation will make the receptor nonfunctional and prevent its normal insertion in the plasma membrane (17).

The value of plasma Tg measurements in the etiological diagnosis of neonatal hypothyroidism remains controversial; although some authors have suggested that a detectable Tg always indicates the presence of some eutopic or ectopic thyroid tissue (18), others have found normal Tg levels in up to 50% of newborns with apparent athyreosis on scintigraphy (19). These discrepancies may reflect, at least in part, the variable quality of nuclear medicine scans. In the three cases of TSH unresponsiveness and apparent athyreosis on scintigraphy (the two siblings reported in Ref. 7 and the propositus in the present study), plasma Tg levels were in the normal range for newborns and were in fact disproportionately high considering the small size of the patients’ thyroids. This discrepancy is what led us, in addition to the unusual family history, to search for mutations in the TSH-R. Absence of Tg in the colloid in thyroid tissue studies, initially reported by Stanbury et al. (9), was considered to be a diagnostic criterion for TSH insensitivity (20). However, our findings show that a detectable plasma Tg level does not rule out TSH unresponsiveness. The possible mechanisms for Tg secretion in the absence of TSH action have been discussed elsewhere (7).

The maternal great aunt of our patient had also been diagnosed with apparent athyreosis but carries no mutations in the coding region of the TSH-R. The occurrence of two cases of apparent athyreosis in the present pedigree remains unexplained and may result from chance alone. At the time of submission of this manuscript, the maternal great aunt had just delivered a euthyroid baby girl; the maternal great aunt is clearly still hypothyroid as evidenced by increased levothyroxine requirements to maintain normal TSH levels during pregnancy but is unavailable for repeat scintigraphy after treatment withdrawal. Severe TSH unresponsiveness with recessive inheritance (21) and mild TSH unresponsiveness with dominant inheritance (22), both with a normal TSH-R, have been described. In newborns with congenital hypothyroidism and absent uptake on scintigraphy, the differential diagnosis includes: true athyreosis, TSH-R antibodies passed transplacentally from the mother (23), acute iodine overload, and iodine transport defects [but these usually present with goiter (24, 25)]. Our findings in the propositus and those of Abramowicz et al. (7) in two siblings show that inactivating mutations of the TSH-R should also be considered in this setting.

As mentioned above, the transmission of TSH-R mutations appears to follow an autosomal recessive pattern of inheritance, based on its occurrence in siblings and the finding of heterozygote parents. This contrasts with the sporadic nature, with female predominance, of thyroid dysgenesis. However, this category of thyroid dysgenesis may itself be genetically heterogeneous. It is noteworthy that the sex ratios of hypothyroid newborns with ectopic tissue and athyreosis who were referred to our institution in the last 7.5 yr (Ref. 2 and our unpublished observations) are different: ectopic tissue, 41 females and 15 males; athyreosis, 5 females and 7 males. Thus, the grouping of patients with athyreosis and ectopic thyroid tissue under the same category of thyroid dysgenesis may require reevaluation. Furthermore, searching for linkage of familial congenital hypothyroidism to the TSH-R without prior clinical and scintigraphic classification of the patients, as recently reported (26), is unlikely to give positive results. We think that patients with ectopic thyroid tissue caused by defective migration of the thyroid anlage are not candidates for TSH-R mutations for the reasons stated above: TSH is not necessary for thyroid migration, and the condition is usually sporadic and has a female predominance. In patients with ectopic thyroid tissue, candidate genes include thyroid transcription factor-1 (TTF-1), TTF-2, and PAX-8. Whereas no germline mutation in TTF-1 was found in two large Italian series (27, 28), a preliminary report describes a PAX-8 mutation in one patient with ectopic thyroid out of 27 screened (29); somatic mutations in these genes occurring very early in development would be an alternative explanation for arrested thyroid migration (30), but have not yet been described. In contrast, our results indicate that germline TSH-R mutations may account for some cases of apparent athyreosis and should be suspected especially if plasma Tg levels are normal.


    Acknowledgments
 
We thank Mr. J. Paquette, Ms. J. Schetagne, and Ms. M. Nguyen for expert technical assistance; Dr. L. Duprez for her help; and Dr. D. Monnier for recent information on the great aunt of the propositus.


    Footnotes
 
1 This work was supported by the Belgian Programme on University Poles of Attraction initiated by the Belgian State, Prime Minister’s office, Service for Sciences, Technology and Culture. Also supported by grants from the Fonds de la Recherche Scientifque Médicale, the Fonds Nationale de la Recherche Scientifique, Télévie, the European Union (Biomed), Association Belge contre le Cancer, and Association de Recherche Biomédicale et de Diagnostic. Clinical research in pediatric thyroid diseases at the Sainte-Justine Hospital is supported by its Research Center and by the Blouin Macbain Foundation. Back

2 N.G. an J.P. contributed equally to this work. Back

Received June 4, 1997.

Revised January 8, 1998.

Accepted January 16, 1998.


    References
 Top
 Abstract
 Introduction
 Case report
 Methods
 Results
 Discussion
 References
 

  1. Foley Jr TP. 1996 Congenital hypothyroidism. In: Braverman LE, Utiger RD, eds. Werner and Ingbar’s the thyroid: a fundamental and clinical text, 7th ed. Philadelphia: Lippincott-Raven; 988–994.
  2. Dubuis JM, Glorieux J, Richer F, Deal CL, Dussault JH, Van Vliet G. 1996 Outcome of severe congenital hypothyroidism: closing the developmental gap with early high dose levothyroxine treatment. J Clin Endocrinol Metab. 81:222–227.[Abstract]
  3. Sunthornthepvarakul T, Gottschalk M, Hayashi Y, Refetoff S. 1995 Brief report: resistance to thyrotropin caused by mutations in the thyrotropin-receptor gene. N Engl J Med. 332:155–60.[Free Full Text]
  4. De Roux N, Misrahi R, Brauner R, et al. 1996 Four families with loss-of-function mutations of the thyrotropin receptor. J Clin Endocrinol Metab. 81:4229–4235.[Abstract]
  5. Biebermann H, Schöneberg T, Krude H, Schultz G, Gudermann T, Grüters A. 1997 Mutations of the human thyrotropin receptor gene causing thyroid hypoplasia and persistent congenital hypothyroidism. J Clin Endocrinol Metab. 82:3471–3480.[Abstract/Free Full Text]
  6. Clifton-Bligh RJ, Gregory JW, Ludgate M, et al. 1997 Two novel mutations in the thyrotropin (TSH) receptor gene in a child with resistance to TSH. J Clin Endocrinol Metab. 82:1094–1100.[Abstract/Free Full Text]
  7. Abramovicz MJ, Duprez L, Parma J, Vassart G, Heinrichs C. 1997 Familial congenital hypothyroidism due to inactivating mutation of the thyrotropin receptor causing profound hypoplasia of the thyroid gland. J Clin Invest. 99:3018–3024.[Medline]
  8. Ilicki A, Ericsson U-B, Larsson A, Mortensson W, Thorell J. 1990 The value of neonatal serum thyroglobulin determinations in the follow-up of patients with congenital hypothyroidism. Acta Pediatr Scand. 79:769–775.[Medline]
  9. Stanbury JB, Rocmans P, Buhler UK, and Ochi Y. 1968 Congenital hypothyroidism with impaired thyroid response to thyrotropin. N Engl J Med. 279:1132–1136.
  10. Libert F, Lefort A, Gerard C, et al. 1989 Cloning, sequencing and expression of the human thyrotropin (TSH) receptor: evidence for binding of autoantibodies. Biochem Biophys Res Commun. 165:1250–1255.[CrossRef][Medline]
  11. Nagayama Y, Kaufman KD, Seto P, Rapoport B. 1989 Molecular cloning, sequence and functional expression of the cDNA for the human thyrotropin receptor. Biochem Biophys Res Commun. 165:1184–1190.[CrossRef][Medline]
  12. Van Sande J, Parma J, Tonacchera M, Swillens S, Dumont J, Vassart G. 1995 Somatic and germline mutations of the TSH receptor gene in thyroid diseases. J Clin Endocrinol Metab. 80:2577–2585.[CrossRef][Medline]
  13. Senapathy S, Shapiro MB, Harris NL. 1990 Splice junctions, branch point sites, and exons: sequence statistics, identification, and applications to the genome project. Methods Enzymol. 183:252–283.[Medline]
  14. Trifiro MA, Lumbroso R, Beitel LK, et al. 1997 Altered mRNA expression due to insertion or substitution of thymine at position +3 of two splice donor-sites in the androgen receptor gene. Eur J Hum Genet. 5:50–58.[Medline]
  15. Kajava AV, Vassart G, and Wodak SJ. 1995 Modeling of the three-dimensional structure of proteins with the typical leucine-rich repeats. Structure. 3:867–877.[Medline]
  16. Nagayama Y, Rapoport B. 1992 The thyrotropin receptor 25 years after its discovery: new insight after its molecular cloning. Mol Endocrinol. 6:145–156.[Abstract/Free Full Text]
  17. Strader CD, Fong TM, Tota MR, Underwood D. 1994 Structure and function of G protein-coupled receptors. Ann Rev Biochem. 63:101–132.[CrossRef][Medline]
  18. Czernichow P, Schlumberger M, Pomarede R, Fragu P. 1983 Plasma thyroglobulin measurements help determine the type of thyroid defect in congenital hypothyroidism. J Clin Endocrinol Metab. 56:242–245.[Abstract/Free Full Text]
  19. Mitchell ML, Hermos RJ. 1995 Measurement of thyroglobulin in newborn screening specimens from normal and hypothyroid infants. Clin Endocrinol (Oxf). 42:523–527.[Medline]
  20. Vassart G, Dumont JE, Refetoff S. 1995 Thyroid Disorders. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic and molecular basis of inherited disease, 7th ed. New York: McGraw-Hill; 2883–2928.
  21. Takeshita A, Nagayama Y, Yamashita S, et al. 1994 Sequence analysis of the thyrotropin (TSH) receptor gene in congenital primary hypothyroidism associated with TSH unresponsiveness. Thyroid. 4:255–259.[Medline]
  22. Xie J, Pannain S, Pohlenz J, et al. 1997 Resistance to thyrotropin (TSH) in three families is not associated with mutations in the TSH receptor or TSH. J Clin Endocrinol Metab. 82:3933–3940.[Abstract/Free Full Text]
  23. Connors MH, Styne DM. 1986 Transient neonatal "athyreosis" resulting from thyrotropin-binding inhibitory immunoglobulins. Pediatrics. 78:287–290.[Abstract/Free Full Text]
  24. Matsuda A, Kosugi S. 1997 A homozygous missense mutation of the sodium/iodide symporter gene causing iodide transport defect. J Clin Endocrinol Metab. 82:3966–3971.[Abstract/Free Full Text]
  25. Grüters A, Finke R, Krude H, Meinhold H. 1994 Etiological grouping of permanent congenital hypothyroidism with a thyroid gland in situ. Horm Res. 41:3–9.[Medline]
  26. Ahlbom BD, Yaqoob M, Larsson A, Ilicki A, Anneren G, Wadelius C. 1997 Genetic and linkage analysis of familial congenital hypothyroidism: exclusion of linkage to the TSH receptor gene. Hum Genet. 99:186–190.[CrossRef][Medline]
  27. Perna MG, Civitareale D, De Filippis, Sacco M, Cisternino C, Tassi V. 1997 Absence of mutations in the gene encoding thyroid transcription factor-1 (TTF-1) in patients with thyroid dysgenesis. Thyroid. 7:377–382.[Medline]
  28. Lapi P, Macchia PE, Chiovato L, et al. 1997 Mutations in the gene encoding thyroid transcription factor-1 (TTF-1) are not a frequent cause of congenital hypothyroidism (CH) with thyroid dysgenesis. Thyroid. 7:383–387.[Medline]
  29. Macchia PE, Lapi P, Chiovato L, Busslinger M, Fenzi GF, Di Lauro R. 1997 Identification of a mutation in the PAX-8 gene in a patient with thyroid ectopy. J Endocrinol Invest. 20[Suppl to no. 5]:84 (Abstract).
  30. Abramowicz M, Vassart G, Refetoff S. 1997 Probing the cause of thyroid dysgenesis (editorial). Thyroid. 7:325–326.[Medline]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
Y. Tenenbaum-Rakover, H. Grasberger, S. Mamanasiri, U. Ringkananont, L. Montanelli, M. S. Barkoff, A. M.-H. Dahood, and S. Refetoff
Loss-of-Function Mutations in the Thyrotropin Receptor Gene as a Major Determinant of Hyperthyrotropinemia in a Consanguineous Community
J. Clin. Endocrinol. Metab., May 1, 2009; 94(5): 1706 - 1712.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Sura-Trueba, C. Aumas, A. Carre, S. Durif, J. Leger, M. Polak, and N. de Roux
An Inactivating Mutation within the First Extracellular Loop of the Thyrotropin Receptor Impedes Normal Posttranslational Maturation of the Extracellular Domain
Endocrinology, February 1, 2009; 150(2): 1043 - 1050.
[Abstract] [Full Text] [PDF]


Home page
Arch. Dis. Child.Home page
R J Perry, S Maroo, A C Maclennan, J H Jones, and M D C Donaldson
Combined ultrasound and isotope scanning is more informative in the diagnosis of congenital hypothyroidism than single scanning
Arch. Dis. Child., December 1, 2006; 91(12): 972 - 976.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
D. Calebiro, T. de Filippis, S. Lucchi, C. Covino, S. Panigone, P. Beck-Peccoz, D. Dunlap, and L. Persani
Intracellular entrapment of wild-type TSH receptor by oligomerization with mutants linked to dominant TSH resistance
Hum. Mol. Genet., October 15, 2005; 14(20): 2991 - 3002.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. Grasberger, A. Mimouni-Bloch, M.-C. Vantyghem, G. van Vliet, M. Abramowicz, D. L. Metzger, H. Abdullatif, C. Rydlewski, P. E. Macchia, N. H. Scherberg, et al.
Autosomal Dominant Resistance to Thyrotropin as a Distinct Entity in Five Multigenerational Kindreds: Clinical Characterization and Exclusion of Candidate Loci
J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4025 - 4034.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. Eugene, A. Djemli, and G. Van Vliet
Sexual Dimorphism of Thyroid Function in Newborns with Congenital Hypothyroidism
J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 2696 - 2700.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S M Park and V K K Chatterjee
Genetics of congenital hypothyroidism
J. Med. Genet., May 1, 2005; 42(5): 379 - 389.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Tonacchera, A. Perri, G. De Marco, P. Agretti, M. E. Banco, C. Di Cosmo, L. Grasso, P. Vitti, L. Chiovato, and A. Pinchera
Low Prevalence of Thyrotropin Receptor Mutations in a Large Series of Subjects with Sporadic and Familial Nonautoimmune Subclinical Hypothyroidism
J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5787 - 5793.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
M. De Felice and R. Di Lauro
Thyroid Development and Its Disorders: Genetics and Molecular Mechanisms
Endocr. Rev., October 1, 2004; 25(5): 722 - 746.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. De Felice, M. P. Postiglione, and R. Di Lauro
Minireview: Thyrotropin Receptor Signaling in Development and Differentiation of the Thyroid Gland: Insights from Mouse Models and Human Diseases
Endocrinology, September 1, 2004; 145(9): 4062 - 4067.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
N. Jordan, N. Williams, J. W. Gregory, C. Evans, M. Owen, and M. Ludgate
The W546X Mutation of the Thyrotropin Receptor Gene: Potential Major Contributor to Thyroid Dysfunction in a Caucasian Population
J. Clin. Endocrinol. Metab., March 1, 2003; 88(3): 1002 - 1005.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. P. Postiglione, R. Parlato, A. Rodriguez-Mallon, A. Rosica, P. Mithbaokar, M. Maresca, R. C. Marians, T. F. Davies, M. S. Zannini, M. De Felice, et al.
Role of the thyroid-stimulating hormone receptor signaling in development and differentiation of the thyroid gland
PNAS, November 26, 2002; 99(24): 15462 - 15467.
[Abstract] [Full Text] [PDF]


Home page
Arch. Dis. Child. Fetal Neonatal Ed.Home page
R J Perry, A S Hollman, A M Wood, and M D C Donaldson
Ultrasound of the thyroid gland in the newborn: normative data
Arch. Dis. Child. Fetal Neonatal Ed., November 1, 2002; 87(3): F209 - 211.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. Perry, C. Heinrichs, P. Bourdoux, K. Khoury, F. Szots, J. H. Dussault, G. Vassart, and G. Van Vliet
Discordance of Monozygotic Twins for Thyroid Dysgenesis: Implications for Screening and for Molecular Pathophysiology
J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4072 - 4077.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. Alberti, M. C. Proverbio, S. Costagliola, R. Romoli, B. Boldrighini, M. C. Vigone, G. Weber, G. Chiumello, P. Beck-Peccoz, and L. Persani
Germline Mutations of TSH Receptor Gene as Cause of Nonautoimmune Subclinical Hypothyroidism
J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2549 - 2555.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Tonacchera, P. Agretti, G. De Marco, A. Perri, A. Pinchera, P. Vitti, and L. Chiovato
Thyroid Resistance to TSH Complicated by Autoimmune Thyroiditis
J. Clin. Endocrinol. Metab., September 1, 2001; 86(9): 4543 - 4546.
[Abstract] [Full Text] [PDF]


Home page
Annals of Clinical & Laboratory ScienceHome page
W. E. Winter and M. R. Signorino
Molecular Thyroidology
Ann. Clin. Lab. Sci., July 1, 2001; 31(3): 221 - 244.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Tonacchera, P. Agretti, A. Pinchera, V. Rosellini, A. Perri, P. Collecchi, P. Vitti, and L. Chiovato
Congenital Hypothyroidism with Impaired Thyroid Response to Thyrotropin (TSH) and Absent Circulating Thyroglobulin: Evidence for a New Inactivating Mutation of the TSH Receptor Gene
J. Clin. Endocrinol. Metab., March 1, 2000; 85(3): 1001 - 1008.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
H. Devos, C. Rodd, N. Gagné, R. Laframboise, and G. Van Vliet
A Search for the Possible Molecular Mechanisms of Thyroid Dysgenesis: Sex Ratios and Associated Malformations
J. Clin. Endocrinol. Metab., July 1, 1999; 84(7): 2502 - 2506.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gagné, N.
Right arrow Articles by Van Vliet, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gagné, N.
Right arrow Articles by Van Vliet, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals