| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Department of Pediatrics, Hôpital Sainte-Justine, Université de Montréal (N.G., C.D., G.V.V.), Québec, Canada H3T 1C5; and Department of Medical Genetics (J.P., G.V.) and Institut de Recherche Interdisciplinaire (G.V.), Université Libre de Bruxelles, 1070 Brussels, Belgium
Address all correspondence and requests for reprints to: Guy Van Vliet, Hôpital Sainte-Justine, 3175 Côte Sainte-Catherine, Montréal, Québec, Canada H3T 1C5. E-mail: vanvlieg{at}ere.umontreal.ca
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
|
| Case report |
|---|
|
|
|---|
| Methods |
|---|
|
|
|---|
Because sequencing revealed the possibility of a splicing mutation in one allele (see Results), the structure of TSH-R complementary DNA (cDNA) was also studied in the exons 47 region by RT-PCR. RT of peripheral leukocyte RNA was performed as described (3), and the segment of interest was amplified with fluorescent primers (forward: 5'ACATAGACCCTGATGCCCTC3'; reverse: 5'TGTCCCATTGAAAGCATATCC3'). The size of the resulting fluorescent PCR segments was determined by polyacrylamide gel electrophoresis on an ABI 373 sequencer (Perkin Elmer, Zaventem, Belgium). The cDNA segments were eluted from a preparative electrophoresis and sequenced by the dye terminator method (Dye Terminator Ready Kit (Applied Biosystems, Warrington, UK), ABI 373 sequencer: Perkin Elmer).
| Results |
|---|
|
|
|---|
C +3 IVS6) in one allele and a deletion of 2 bases of codon 655
in exon 10 (del AC 655) in the other allele. The mother of the
propositus harbors the G
C +3 IVS6 mutation in one allele, although
the other allele is normal. In the maternal great aunt and her parents,
no mutation was identified. This negative result in the great aunt was
confirmed on a second blood sample collected at a later date. The
mutational analysis of the pedigree is summarized in Fig. 1
|
C+3 IVS6 mutation was
explored by RT-PCR performed on messenger RNA (mRNA) from peripheral
leukocytes, as described by Sunthornthepvarakul et al. (3).
A cDNA segment encompassing exons 47 was amplified in the mother, the
propositus, and unrelated controls (Fig. 2
|
| Discussion |
|---|
|
|
|---|
In 1995, Sunthornthepvarakul et al. (3) described 3 sisters
presenting with hyperthyrotropinemia who were found to be compound
heterozygotes for inactivating mutations of the TSH-R. Since
then, inactivating mutations of the TSH-R have been reported
in 11 other patients from 8 unrelated families of different ethnic
backgrounds. Figure 3
represents all the
loss-of-function mutations reported to date. There does not seem to be
any hot spot for loss-of-function mutations: they have been identified
in exons 1, 4, 6, and 10 (exon 10 encodes the entire serpentine
structure). The phenotypic manifestations are variable and range from
asymptomatic hyperthyrotropinemia to severe congenital hypothyroidism
with absent 99mpertechnetate uptake on thyroid scintigraphy
in 2 siblings (4, 5, 6, 7) (Table 1
). Table 1
lists all the inactivating
mutations of the TSH-R described to date along with
clinical, biochemical, and scintigraphic evaluations. Our case is the
third described with apparent athyreosis on scintigraphy. There does
not seem to be any relationship between the mutated areas of the
TSH-R and the clinical and biochemical severity of the
phenotype.
|
C +3 IVS6 mutation found in the allele our patient inherited
from his mother is the first mutation described in an intron of the
TSH-R. A cytosine is found at position +3 in less than 3%
of intron donor sites (13). Alterations at the +3 position of a splice
donor site have been shown to disrupt normal mRNA processing and have
been incriminated as the cause of 14 other human genetic diseases (14).
In the present case, the consequence is the skipping of exon 6 (Fig. 2The value of plasma Tg measurements in the etiological diagnosis of neonatal hypothyroidism remains controversial; although some authors have suggested that a detectable Tg always indicates the presence of some eutopic or ectopic thyroid tissue (18), others have found normal Tg levels in up to 50% of newborns with apparent athyreosis on scintigraphy (19). These discrepancies may reflect, at least in part, the variable quality of nuclear medicine scans. In the three cases of TSH unresponsiveness and apparent athyreosis on scintigraphy (the two siblings reported in Ref. 7 and the propositus in the present study), plasma Tg levels were in the normal range for newborns and were in fact disproportionately high considering the small size of the patients thyroids. This discrepancy is what led us, in addition to the unusual family history, to search for mutations in the TSH-R. Absence of Tg in the colloid in thyroid tissue studies, initially reported by Stanbury et al. (9), was considered to be a diagnostic criterion for TSH insensitivity (20). However, our findings show that a detectable plasma Tg level does not rule out TSH unresponsiveness. The possible mechanisms for Tg secretion in the absence of TSH action have been discussed elsewhere (7).
The maternal great aunt of our patient had also been diagnosed with apparent athyreosis but carries no mutations in the coding region of the TSH-R. The occurrence of two cases of apparent athyreosis in the present pedigree remains unexplained and may result from chance alone. At the time of submission of this manuscript, the maternal great aunt had just delivered a euthyroid baby girl; the maternal great aunt is clearly still hypothyroid as evidenced by increased levothyroxine requirements to maintain normal TSH levels during pregnancy but is unavailable for repeat scintigraphy after treatment withdrawal. Severe TSH unresponsiveness with recessive inheritance (21) and mild TSH unresponsiveness with dominant inheritance (22), both with a normal TSH-R, have been described. In newborns with congenital hypothyroidism and absent uptake on scintigraphy, the differential diagnosis includes: true athyreosis, TSH-R antibodies passed transplacentally from the mother (23), acute iodine overload, and iodine transport defects [but these usually present with goiter (24, 25)]. Our findings in the propositus and those of Abramowicz et al. (7) in two siblings show that inactivating mutations of the TSH-R should also be considered in this setting.
As mentioned above, the transmission of TSH-R mutations appears to follow an autosomal recessive pattern of inheritance, based on its occurrence in siblings and the finding of heterozygote parents. This contrasts with the sporadic nature, with female predominance, of thyroid dysgenesis. However, this category of thyroid dysgenesis may itself be genetically heterogeneous. It is noteworthy that the sex ratios of hypothyroid newborns with ectopic tissue and athyreosis who were referred to our institution in the last 7.5 yr (Ref. 2 and our unpublished observations) are different: ectopic tissue, 41 females and 15 males; athyreosis, 5 females and 7 males. Thus, the grouping of patients with athyreosis and ectopic thyroid tissue under the same category of thyroid dysgenesis may require reevaluation. Furthermore, searching for linkage of familial congenital hypothyroidism to the TSH-R without prior clinical and scintigraphic classification of the patients, as recently reported (26), is unlikely to give positive results. We think that patients with ectopic thyroid tissue caused by defective migration of the thyroid anlage are not candidates for TSH-R mutations for the reasons stated above: TSH is not necessary for thyroid migration, and the condition is usually sporadic and has a female predominance. In patients with ectopic thyroid tissue, candidate genes include thyroid transcription factor-1 (TTF-1), TTF-2, and PAX-8. Whereas no germline mutation in TTF-1 was found in two large Italian series (27, 28), a preliminary report describes a PAX-8 mutation in one patient with ectopic thyroid out of 27 screened (29); somatic mutations in these genes occurring very early in development would be an alternative explanation for arrested thyroid migration (30), but have not yet been described. In contrast, our results indicate that germline TSH-R mutations may account for some cases of apparent athyreosis and should be suspected especially if plasma Tg levels are normal.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 N.G. an J.P. contributed equally to this work. ![]()
Received June 4, 1997.
Revised January 8, 1998.
Accepted January 16, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y. Tenenbaum-Rakover, H. Grasberger, S. Mamanasiri, U. Ringkananont, L. Montanelli, M. S. Barkoff, A. M.-H. Dahood, and S. Refetoff Loss-of-Function Mutations in the Thyrotropin Receptor Gene as a Major Determinant of Hyperthyrotropinemia in a Consanguineous Community J. Clin. Endocrinol. Metab., May 1, 2009; 94(5): 1706 - 1712. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sura-Trueba, C. Aumas, A. Carre, S. Durif, J. Leger, M. Polak, and N. de Roux An Inactivating Mutation within the First Extracellular Loop of the Thyrotropin Receptor Impedes Normal Posttranslational Maturation of the Extracellular Domain Endocrinology, February 1, 2009; 150(2): 1043 - 1050. [Abstract] [Full Text] [PDF] |
||||
![]() |
R J Perry, S Maroo, A C Maclennan, J H Jones, and M D C Donaldson Combined ultrasound and isotope scanning is more informative in the diagnosis of congenital hypothyroidism than single scanning Arch. Dis. Child., December 1, 2006; 91(12): 972 - 976. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Calebiro, T. de Filippis, S. Lucchi, C. Covino, S. Panigone, P. Beck-Peccoz, D. Dunlap, and L. Persani Intracellular entrapment of wild-type TSH receptor by oligomerization with mutants linked to dominant TSH resistance Hum. Mol. Genet., October 15, 2005; 14(20): 2991 - 3002. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Grasberger, A. Mimouni-Bloch, M.-C. Vantyghem, G. van Vliet, M. Abramowicz, D. L. Metzger, H. Abdullatif, C. Rydlewski, P. E. Macchia, N. H. Scherberg, et al. Autosomal Dominant Resistance to Thyrotropin as a Distinct Entity in Five Multigenerational Kindreds: Clinical Characterization and Exclusion of Candidate Loci J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4025 - 4034. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Eugene, A. Djemli, and G. Van Vliet Sexual Dimorphism of Thyroid Function in Newborns with Congenital Hypothyroidism J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 2696 - 2700. [Abstract] [Full Text] [PDF] |
||||
![]() |
S M Park and V K K Chatterjee Genetics of congenital hypothyroidism J. Med. Genet., May 1, 2005; 42(5): 379 - 389. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tonacchera, A. Perri, G. De Marco, P. Agretti, M. E. Banco, C. Di Cosmo, L. Grasso, P. Vitti, L. Chiovato, and A. Pinchera Low Prevalence of Thyrotropin Receptor Mutations in a Large Series of Subjects with Sporadic and Familial Nonautoimmune Subclinical Hypothyroidism J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5787 - 5793. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. De Felice and R. Di Lauro Thyroid Development and Its Disorders: Genetics and Molecular Mechanisms Endocr. Rev., October 1, 2004; 25(5): 722 - 746. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. De Felice, M. P. Postiglione, and R. Di Lauro Minireview: Thyrotropin Receptor Signaling in Development and Differentiation of the Thyroid Gland: Insights from Mouse Models and Human Diseases Endocrinology, September 1, 2004; 145(9): 4062 - 4067. [Full Text] [PDF] |
||||
![]() |
N. Jordan, N. Williams, J. W. Gregory, C. Evans, M. Owen, and M. Ludgate The W546X Mutation of the Thyrotropin Receptor Gene: Potential Major Contributor to Thyroid Dysfunction in a Caucasian Population J. Clin. Endocrinol. Metab., March 1, 2003; 88(3): 1002 - 1005. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Postiglione, R. Parlato, A. Rodriguez-Mallon, A. Rosica, P. Mithbaokar, M. Maresca, R. C. Marians, T. F. Davies, M. S. Zannini, M. De Felice, et al. Role of the thyroid-stimulating hormone receptor signaling in development and differentiation of the thyroid gland PNAS, November 26, 2002; 99(24): 15462 - 15467. [Abstract] [Full Text] [PDF] |
||||
![]() |
R J Perry, A S Hollman, A M Wood, and M D C Donaldson Ultrasound of the thyroid gland in the newborn: normative data Arch. Dis. Child. Fetal Neonatal Ed., November 1, 2002; 87(3): F209 - 211. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Perry, C. Heinrichs, P. Bourdoux, K. Khoury, F. Szots, J. H. Dussault, G. Vassart, and G. Van Vliet Discordance of Monozygotic Twins for Thyroid Dysgenesis: Implications for Screening and for Molecular Pathophysiology J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4072 - 4077. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Alberti, M. C. Proverbio, S. Costagliola, R. Romoli, B. Boldrighini, M. C. Vigone, G. Weber, G. Chiumello, P. Beck-Peccoz, and L. Persani Germline Mutations of TSH Receptor Gene as Cause of Nonautoimmune Subclinical Hypothyroidism J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2549 - 2555. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tonacchera, P. Agretti, G. De Marco, A. Perri, A. Pinchera, P. Vitti, and L. Chiovato Thyroid Resistance to TSH Complicated by Autoimmune Thyroiditis J. Clin. Endocrinol. Metab., September 1, 2001; 86(9): 4543 - 4546. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. E. Winter and M. R. Signorino Molecular Thyroidology Ann. Clin. Lab. Sci., July 1, 2001; 31(3): 221 - 244. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tonacchera, P. Agretti, A. Pinchera, V. Rosellini, A. Perri, P. Collecchi, P. Vitti, and L. Chiovato Congenital Hypothyroidism with Impaired Thyroid Response to Thyrotropin (TSH) and Absent Circulating Thyroglobulin: Evidence for a New Inactivating Mutation of the TSH Receptor Gene J. Clin. Endocrinol. Metab., March 1, 2000; 85(3): 1001 - 1008. [Abstract] [Full Text] |
||||
![]() |
H. Devos, C. Rodd, N. Gagné, R. Laframboise, and G. Van Vliet A Search for the Possible Molecular Mechanisms of Thyroid Dysgenesis: Sex Ratios and Associated Malformations J. Clin. Endocrinol. Metab., July 1, 1999; 84(7): 2502 - 2506. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |