| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Otsuka Department of Clinical and Molecular Nutrition, The University of Tokushima School of Medicine, 318-15, Kuramoto-cho, Tokushima-City, 770; Department of Neurosurgery, Toranomon Hospital (S.Y.), 22-2, Toranomon, Minato-ku, Tokyo, 105; and Department of Neurosurgery, Tokyo Medical College (H.N.), 67-1, Nishishinjuku, Shinjuku-ku, Tokyo, 160 Japan
Address all correspondence and requests for reprints to: Mitsuo Itakura, M.D., Ph.D., Otsuka Department of Clinical and Molecular Nutrition, The University of Tokushima School of Medicine, 318-15, Kuramoto-cho, Tokushima-City, 770, Japan. E-mail: itakura{at}nutr.med.tokushima-u.ac.jp
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
Clinical findings and LOH on 11q13 in GH-producing pituitary tumors in one pedigree of familial pituitary adenoma in the absence of MEN-1 with two affected brothers (cases 10 and 11 in this report) were previously reported (3). The 69-yr-old mother (case 12) in the second pedigree presented with acromegaly and diabetes. Endocrine studies showed increased basal serum levels of GH (37 ng/ml; normal range, <5 ng/ml), insulin-like growth factor I (640 ng/ml; female normal range, 24153 ng/ml), and PRL (29 ng/ml; female normal range, <20 ng/ml). The serum GH level was increased by TRH administration, but not by GnRH administration. Other anterior pituitary hormones were low normal. An acidophilic adenoma was removed by transsphenoidal surgery. The 37-yr-old daughter (case 13) in the second pedigree had transsphenoidal surgery for prolactinoma at the age of 25 yr. Both of the affected brothers (cases 14 and 15) in the third pedigree had GH-producing pituitary adenomas. The 61-yr-old elder brother presented with acromegaly and diabetes. The basal serum GH level was 15.7 ng/ml and was increased by TRH administration. Other anterior pituitary hormone levels were normal. An acidophilic adenoma was removed by the transsphenoidal surgery. The 53-yr-old younger brother also presented with acromegaly. The basal serum GH level was 9.6 ng/ml and was increased by TRH administration. An adenoma was removed by transsphenoidal surgery. Serum hormone levels in all of these cases (cases 1015) did not indicate the presence of MEN-1. All patients were studied with their informed consents.
Diagnostic criteria
The following diagnostic criteria were used. Familial MEN-1 should have at least two MEN-1 patients in a family. Sporadic MEN-1 should not have MEN-1 patients diagnosed by endocrine or radiographic evaluations in a family. Familial pituitary adenoma should have multiple patients with pituitary adenoma without associating other endocrine tumors in a family. FIHP was diagnosed for three cases (cases 1618), with hyperparathyroidism in 1 pedigree, as previously reported (12).
Tissue and blood samples, and extraction of DNA from tissues
Tissue samples were obtained at surgical operation or from
paraffin-embedded sections. Peripheral blood samples were collected at
surgical operation or retrospectively from these patients. Tissue and
blood samples were obtained from five cases of familial MEN-1, four
cases of sporadic MEN-1, six cases of familial pituitary adenoma, and
three cases of FIHP. DNA was isolated as previously described (13).
Clinical data on cases 1 (14), 2 and 3 (15), 8 (16), and 1618 (12) in
Tables 2
and 3
were previously reported.
|
|
Primers for PCR amplification were listed in Table 1
. The coding sequence, including 9
coding exons and 16 splice junctions of the MEN1 gene (9),
was first screened with PCR-SSCP (13). Three conditions of 8%
polyacrylamide gels, containing 0%, 5%, or 10% glycerol, were
routinely used for PCR-SSCP screening for each PCR product.
|
Assessment of allelic ratios
Allelic ratios in tumor DNA relative to leukocyte DNA were assessed with the previously reported method (13) in regard to five microsatellite markers on 11q13; D11S1883 (17),D11S457 (18), PYGM (19), D11S449 (18), and D11S1889 (17). The allelic ratio of the PYGM locus was examined with two sets of primers. One common 5'-primer was at nucleotides 176195 (ctagcagagtccacctactg) in GenBank accession no. M77201. Two 3'-primers included nucleotides 277297 (cacagagagagagagagagag), which amplified PYGM1 including 5'-CA repeats varying from 120130 bp, and nucleotides 332351 (gtcagttgctacctgacagc), which amplified PYGM2 including 5'-CA and 3'-GA repeats varying from 156190 bp (19).
RT-PCR procedure
Total ribonucleic acid (RNA) from tissue was prepared with
ISOGEN (Nippon Gene, Tokyo, Japan) and treated with DNase at 37 C for
1 h. Complementary DNA was synthesized from 2 µg total RNA with
random hexamers and Moloney murine leukemia virus reverse transcriptase
(Promega, Madison, WI) at 37 C for 1 h. The complementary DNA was
then amplified by PCR in 35 cycles with the primer pair listed in Table 1
with the initial denaturation at 95 C for 10 min, denaturation at 94
C for 1 min, annealing at 62 C for 1 min, and extension at 72 C for 1
min, followed by electrophoresis on an 8% polyacrylamide gel.
| Results |
|---|
|
|
|---|
|
TAG). The missense mutation in case 5 was a Pro to Leu
substitution at codon 320 (CCC
CTC). One splicing mutation from AG to
GG at the 3'-splice signal in intron 7 was detected in cases 2 and 3,
but not in unaffected subjects in this pedigree.
We detected abnormal splicing in RNA extracted from a parathyroid
tumor of case 2 with RT-PCR analysis. An 805-bp RT-PCR fragment (Fig. 2
, lane 3) amplified with a pair of
primers located in exons 7 and 9 (Table 1
) was longer than the 344-bp
wild-type fragment (Fig. 2
, lane 5) in contrast with the 1242-bp PCR
product from genomic DNA (Fig. 2
, lane 2). Sequencing of the 805-bp
fragment proved that intron 7 (461 bp) was not spliced out due to the
loss of the splicing acceptor AG sequence, and the inclusion of intron
7 produced a stop codon at the created codon 351.
|
We detected one synonymous polymorphism at codon 418 of GAC or GAT
(Fig. 1B
), with the former in 66% (12 of 18), and another polymorphism
at codon 541 of GCA or ACA encoding alanine or threonine, respectively,
with the former in 39% (7 of 18), in Japanese.
To determine whether the allelic loss is present on 11q13 in
tumor tissues, we assessed the allelic ratios for five microsatellite
markers using DNA samples of tumor tissues and leukocytes in five cases
in four pedigrees of familial MEN-1, four cases of sporadic MEN-1,
three cases in two pedigrees of familial pituitary adenoma, and three
cases in one pedigree of FIHP with PCR-based microsatellite analysis
(Fig. 3
). As summarized in Table 4
, LOH on 11q13 was detected in all five
tumors of familial MEN-1, all four tumors of sporadic MEN-1, and two
adenomas from two cases in one pedigree of familial pituitary adenoma,
but not in one pituitary adenoma of familial pituitary adenoma or all
three parathyroid adenomas of FIHP. Tumor DNA of three cases, including
cases 1315, were not available for microsatellite analysis.
|
|
| Discussion |
|---|
|
|
|---|
We did not find obvious correlation between the type of MEN1
gene mutations and the phenotypes of MEN-1 (Table 2
). The incidence of
polymorphism at codon 541 of GCA or ACA encoding alanine or threonine,
with the former in 39% (7 of 18), in Japanese in our study is higher
than the reported incidence of 4% (6 of 142) in Caucasians (10),
representing the racial difference.
Germ-line mutations in the RET protooncogene were detected in cases of familial medullary thyroid carcinomas as well as those of MEN-2A (20), suggesting that familial medullary thyroid carcinoma is genotypically similar to MEN-2A. Although familial pituitary adenoma without MEN-1 and FIHP could be variants of MEN-1, Benlian et al. recently reported that their cases with familial acromegaly were not linked to the MEN1 gene locus by segregation analysis (2). Three pedigrees with 6 cases of familial pituitary adenoma in our study, including 1 previously reported pedigree (cases 10 and 11) (3), against the total number of only 19 reported pedigrees afforded us an important opportunity to screen germ-line mutations of the MEN1 gene. Germ-line mutation in the MEN1 gene was not found in 3 pedigrees of familial pituitary adenoma unrelated to MEN-1. LOH on 11q13 was, however, detected in 2 familial pituitary adenomas in 2 cases (cases 10 and 11). We further examined somatic mutations of the MEN1 gene in their 2 pituitary adenomas and detected a somatic mutation in 1 pituitary tumor of case 11. Although methylation-dependent inactivation or mutations in the promoter, introns, or untranslated regions of the MEN1 gene were not excluded in our study, our results suggest that germ-line mutations in the coding regions of the MEN1 gene do not contribute to the pituitary tumorigenesis in familial pituitary adenoma without MEN-1. A somatic mutation of the MEN1 gene with LOH on 11q13 was, however, suggested to contribute to the pituitary tumorigenesis in a subgroup of familial pituitary adenoma without MEN-1. The predominance of GH-producing pituitary tumors in 5 of 6 cases of familial pituitary adenoma vs. that of prolactinoma in 3 of 5 cases of familial or sporadic MEN-1 in our study may suggest that another unidentified tumor-suppressor gene on 11q13 is etiological for familial pituitary adenoma.
Germ-line mutations of the MEN1 gene in its coding sequence were not detected in three cases of usually autosomal dominant FIHP (4, 6, 7). Hyperparathyroidism-jaw tumor syndrome is a related, but genetically distinct, state from MEN-1, and it was mapped to 1q21-q31 by Szabò et al. (5). Either linkage or exclusion of linkage of FIHP to 11q13 was reported (6, 7). We previously reported the absence of LOH on 11q13 in three parathyroid tumors (cases 1618) in a pedigree of FIHP (12) and did not find MEN1 germ-line mutations in these patients in this study. In addition, no MEN1 germ-line mutations were reported in five probands of familial hyperparathyroidism (10). These suggest that the germ-line mutation of the MEN1 gene is not etiological for FIHP.
The copresence of germ-line mutations of the MEN1 gene and LOH on 11q13 in endocrine tumors in all five familial and four sporadic cases of MEN-1 confirmed that the loss of function of menin is etiological for familial and sporadic MEN-1 (9, 10, 11). The absence of germ-line mutations of the MEN1 gene in its coding sequence or LOH on 11q13 in three cases of FIHP also confirmed that the germ-line mutation of the MEN1 gene is not etiological for this disorder (10). The copresence of LOH on 11q13 and a somatic mutation of the MEN1 gene in one of six cases in three separate pedigrees of familial pituitary adenoma, with another case in the same pedigree associated only with LOH on 11q13, proved that the loss of function of menin plays a role in pituitary tumorigenesis in a subset of familial pituitary adenoma unrelated to MEN-1. In the presence of LOH on 11q13, it is possible that the remaining single MEN1 gene can contribute to somatic mutation even if the familial susceptibility for somatic mutation is transmitted by a different gene on another chromosome. Based on these findings, it is concluded that the germ-line mutation of the coding sequence of the MEN1 gene is not etiological for familial pituitary adenoma without MEN-1.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received September 4, 1997.
Revised November 7, 1997.
Accepted November 14, 1997.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
X.-H. Jiang, J.-L. Lu, B. Cui, Y.-J. Zhao, W.-q. Wang, J.-M. Liu, W.-Q. Fang, Y.-N. Cao, Y. Ge, C.-x. Zhang, et al. MEN1 mutation analysis in Chinese patients with multiple endocrine neoplasia type 1 Endocr. Relat. Cancer, December 1, 2007; 14(4): 1073 - 1079. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Toledo, D. M. Lourenco Jr., B. Liberman, M. B. C. Cunha-Neto, M. G. Cavalcanti, C. B. Moyses, S. P. A. Toledo, and P. L. M. Dahia Germline Mutation in the Aryl Hydrocarbon Receptor Interacting Protein Gene in Familial Somatotropinoma J. Clin. Endocrinol. Metab., May 1, 2007; 92(5): 1934 - 1937. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. Howell, J. W. Cardinal, A.-L. Richardson, O. Gimm, B. G. Robinson, and D. J. Marsh Rapid Mutation Screening for HRPT2 and MEN1 Mutations Associated with Familial and Sporadic Primary Hyperparathyroidism J. Mol. Diagn., November 1, 2006; 8(5): 559 - 566. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Vierimaa, M. Georgitsi, R. Lehtonen, P. Vahteristo, A. Kokko, A. Raitila, K. Tuppurainen, T. M. L. Ebeling, P. I. Salmela, R. Paschke, et al. Pituitary Adenoma Predisposition Caused by Germline Mutations in the AIP Gene. Science, May 26, 2006; 312(5777): 1228 - 1230. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. S. Soares, K. Eguchi, and L. A. Frohman Tumor Deletion Mapping on Chromosome 11q13 in Eight Families with Isolated Familial Somatotropinoma and in 15 Sporadic Somatotropinomas J. Clin. Endocrinol. Metab., December 1, 2005; 90(12): 6580 - 6587. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Carrasco, A. A. Gonzalez, C. A. Carvajal, C. Campusano, E. Oestreicher, E. Arteaga, N. Wohllk, and C. E. Fardella Novel Intronic Mutation of MEN1 Gene Causing Familial Isolated Primary Hyperparathyroidism J. Clin. Endocrinol. Metab., August 1, 2004; 89(8): 4124 - 4129. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. F. Simonds, C. M. Robbins, S. K. Agarwal, G. N. Hendy, J. D. Carpten, and S. J. Marx Familial Isolated Hyperparathyroidism Is Rarely Caused by Germline Mutation in HRPT2, the Gene for the Hyperparathyroidism-Jaw Tumor Syndrome J. Clin. Endocrinol. Metab., January 1, 2004; 89(1): 96 - 102. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Cebrian, S Ruiz-Llorente, A Cascon, M Pollan, J J Diez, A Pico, D Telleria, J Benitez, and M Robledo Mutational and gross deletion study of the MEN1 gene and correlation with clinical features in Spanish patients J. Med. Genet., May 1, 2003; 40(5): e72 - 72. [Full Text] [PDF] |
||||
![]() |
B. Verges, F. Boureille, P. Goudet, A. Murat, A. Beckers, G. Sassolas, P. Cougard, B. Chambe, C. Montvernay, and A. Calender Pituitary Disease in MEN Type 1 (MEN1): Data from the France-Belgium MEN1 Multicenter Study J. Clin. Endocrinol. Metab., February 1, 2002; 87(2): 457 - 465. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Brandi, R. F. Gagel, A. Angeli, J. P. Bilezikian, P. Beck-Peccoz, C. Bordi, B. Conte-Devolx, A. Falchetti, R. G. Gheri, A. Libroia, et al. CONSENSUS: Guidelines for Diagnosis and Therapy of MEN Type 1 and Type 2 J. Clin. Endocrinol. Metab., December 1, 2001; 86(12): 5658 - 5671. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Guo and M. P. Sawicki Molecular and Genetic Mechanisms of Tumorigenesis in Multiple Endocrine Neoplasia Type-1 Mol. Endocrinol., October 1, 2001; 15(10): 1653 - 1664. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Abe, K. Yoshimoto, M. Taniyama, K. Hanakawa, H. Izumiyama, M. Itakura, and K. Matsumoto An Unusual Kindred of the Multiple Endocrine Neoplasia Type 1 (MEN1) in Japanese J. Clin. Endocrinol. Metab., March 1, 2000; 85(3): 1327 - 1330. [Full Text] |
||||
![]() |
M. R. Gadelha, K. N. Une, K. Rohde, M. Vaisman, R. D. Kineman, and L. A. Frohman Isolated Familial Somatotropinomas: Establishment of Linkage to Chromosome 11q13.1-11q13.3 and Evidence for a Potential Second Locus at Chromosome 2p16-12 J. Clin. Endocrinol. Metab., February 1, 2000; 85(2): 707 - 714. [Abstract] [Full Text] |
||||
![]() |
M. Kassem, T. A. Kruse, F. K. Wong, C. Larsson, and B. T. Teh Familial Isolated Hyperparathyroidism as a Variant of Multiple Endocrine Neoplasia Type 1 in a Large Danish Pedigree J. Clin. Endocrinol. Metab., January 1, 2000; 85(1): 165 - 167. [Abstract] [Full Text] |
||||
![]() |
P. L. M. Dahia and A. B. Grossman The Molecular Pathogenesis of Corticotroph Tumors Endocr. Rev., April 1, 1999; 20(2): 136 - 155. [Abstract] [Full Text] |
||||
![]() |
M. R. Gadelha, T. R. Prezant, K. N. Une, R. P. Glick, S. F. Moskal II, M. Vaisman, S. Melmed, R. D. Kineman, and L. A. Frohman Loss of Heterozygosity on Chromosome 11q13 in Two Families with Acromegaly/Gigantism Is Independent of Mutations of the Multiple Endocrine Neoplasia Type I Gene J. Clin. Endocrinol. Metab., January 1, 1999; 84(1): 249 - 256. [Abstract] [Full Text] |
||||
![]() |
C. Tanaka, T. Kimura, P. Yang, M. Moritani, T. Yamaoka, S. Yamada, T. Sano, K. Yoshimoto, and M. Itakura Analysis of Loss of Heterozygosity on Chromosome 11 and Infrequent Inactivation of the MEN1 Gene in Sporadic Pituitary Adenomas J. Clin. Endocrinol. Metab., August 1, 1998; 83(8): 2631 - 2634. [Abstract] [Full Text] |
||||
![]() |
B. Mayr, G. Brabant, and A. v. z. Mühlen Menin Mutations In MEN1 Patients J. Clin. Endocrinol. Metab., August 1, 1998; 83(8): 3004 - 3005. [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |