help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tanaka, C.
Right arrow Articles by Itakura, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tanaka, C.
Right arrow Articles by Itakura, M.
Right arrowPubmed/NCBI databases
*OMIM*Protein
*Compound via MeSH
*Substance via MeSH
*Genetics Home Reference
The Journal of Clinical Endocrinology & Metabolism Vol. 83, No. 3 960-965
Copyright © 1998 by The Endocrine Society


Original Studies

Absence of Germ-Line Mutations of the Multiple Endocrine Neoplasia Type 1 (MEN1) Gene in Familial Pituitary Adenoma in Contrast to MEN1 in Japanese1

Chisato Tanaka, Katsuhiko Yoshimoto, Shozo Yamada, Hiroshi Nishioka, Setsuko Ii, Maki Moritani, Takashi Yamaoka and Mitsuo Itakura

Otsuka Department of Clinical and Molecular Nutrition, The University of Tokushima School of Medicine, 3–18-15, Kuramoto-cho, Tokushima-City, 770; Department of Neurosurgery, Toranomon Hospital (S.Y.), 2–2-2, Toranomon, Minato-ku, Tokyo, 105; and Department of Neurosurgery, Tokyo Medical College (H.N.), 6–7-1, Nishishinjuku, Shinjuku-ku, Tokyo, 160 Japan

Address all correspondence and requests for reprints to: Mitsuo Itakura, M.D., Ph.D., Otsuka Department of Clinical and Molecular Nutrition, The University of Tokushima School of Medicine, 3–18-15, Kuramoto-cho, Tokushima-City, 770, Japan. E-mail: itakura{at}nutr.med.tokushima-u.ac.jp


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Germ-line mutations of the MEN1 gene were analyzed in five cases of familial and four cases of sporadic multiple endocrine neoplasia type 1 (MEN-1), six cases in three independent pedigrees of familial pituitary adenoma without MEN-1, and three cases of familial isolated primary hyperparathyroidism (FIHP) in Japanese. Eight different types of germ-line mutations in all nine cases of MEN-1 were distributed in exons 2, 3, 7, and 10 and intron 7 of the MEN1 gene. Loss of heterozygosity (LOH) on 11q13 was detected in all nine tumors of these cases with microsatellite analysis. No germ-line mutation of the MEN1 gene was detected in three pedigrees of familial pituitary adenoma and three cases of FIHP. LOH on 11q13 was detected in two cases in one pedigree of familial pituitary adenoma, and one of them showed a heterozygous somatic mutation of the MEN1 gene. No LOH on 11q13 was detected in three cases of FIHP. Based on these, we conclude that the loss of function of menin is etiological for familial or sporadic MEN-1, but not for FIHP or most familial pituitary adenoma without MEN-1.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
MULTIPLE endocrine neoplasia type 1 (MEN-1) is a hereditary disorder characterized by multiple endocrine tumors of the parathyroid gland, anterior pituitary gland, and pancreatic endocrine tissue (1). The genetic background of familial pituitary adenoma without MEN-1 and familial isolated primary hyperparathyroidism (FIHP), which are presented as possible subtypes of MEN-1, remains unknown (2, 3, 4, 5, 6, 7). The MEN1 gene on chromosome 11q13 (8, 9) contains 10 exons and encodes a ubiquitously expressed 2.8-kilobase transcript. The predicted 610-amino acid protein product, menin, exhibits no apparent similarities to any previously known proteins. Germ-line mutations of the MEN1 gene were detected at high frequency in both familial and sporadic cases of MEN-1 in Caucasians (9, 10, 11). We had 1 reported (3) and 2 additional pedigrees of familial pituitary adenoma, with 6 cases in total, which comprise a significant number compared to 19 pedigrees with 43 cases in the literature (3). We analyzed germ-line mutations of the MEN1 gene and loss of heterozygosity (LOH) on 11q13 in endocrine tumors in 5 cases of familial MEN-1 in 4 pedigrees, 4 cases of sporadic MEN-1, 6 cases of familial pituitary adenoma without MEN-1 in 3 pedigrees, and 3 cases of FIHP in 1 pedigree in Japanese. In tumors showing LOH on 11q13, somatic mutations of the MEN1 gene were further examined.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Case presentation of familial pituitary adenoma

Clinical findings and LOH on 11q13 in GH-producing pituitary tumors in one pedigree of familial pituitary adenoma in the absence of MEN-1 with two affected brothers (cases 10 and 11 in this report) were previously reported (3). The 69-yr-old mother (case 12) in the second pedigree presented with acromegaly and diabetes. Endocrine studies showed increased basal serum levels of GH (37 ng/ml; normal range, <5 ng/ml), insulin-like growth factor I (640 ng/ml; female normal range, 24–153 ng/ml), and PRL (29 ng/ml; female normal range, <20 ng/ml). The serum GH level was increased by TRH administration, but not by GnRH administration. Other anterior pituitary hormones were low normal. An acidophilic adenoma was removed by transsphenoidal surgery. The 37-yr-old daughter (case 13) in the second pedigree had transsphenoidal surgery for prolactinoma at the age of 25 yr. Both of the affected brothers (cases 14 and 15) in the third pedigree had GH-producing pituitary adenomas. The 61-yr-old elder brother presented with acromegaly and diabetes. The basal serum GH level was 15.7 ng/ml and was increased by TRH administration. Other anterior pituitary hormone levels were normal. An acidophilic adenoma was removed by the transsphenoidal surgery. The 53-yr-old younger brother also presented with acromegaly. The basal serum GH level was 9.6 ng/ml and was increased by TRH administration. An adenoma was removed by transsphenoidal surgery. Serum hormone levels in all of these cases (cases 10–15) did not indicate the presence of MEN-1. All patients were studied with their informed consents.

Diagnostic criteria

The following diagnostic criteria were used. Familial MEN-1 should have at least two MEN-1 patients in a family. Sporadic MEN-1 should not have MEN-1 patients diagnosed by endocrine or radiographic evaluations in a family. Familial pituitary adenoma should have multiple patients with pituitary adenoma without associating other endocrine tumors in a family. FIHP was diagnosed for three cases (cases 16–18), with hyperparathyroidism in 1 pedigree, as previously reported (12).

Tissue and blood samples, and extraction of DNA from tissues

Tissue samples were obtained at surgical operation or from paraffin-embedded sections. Peripheral blood samples were collected at surgical operation or retrospectively from these patients. Tissue and blood samples were obtained from five cases of familial MEN-1, four cases of sporadic MEN-1, six cases of familial pituitary adenoma, and three cases of FIHP. DNA was isolated as previously described (13). Clinical data on cases 1 (14), 2 and 3 (15), 8 (16), and 16–18 (12) in Tables 2Go and 3Go were previously reported.


View this table:
[in this window]
[in a new window]
 
Table 2. Clinical findings and MEN1 germline mutations in familial and sporadic MEN-1

 

View this table:
[in this window]
[in a new window]
 
Table 3. Clinical findings and MEN1 germline mutations in familial pituitary adenoma and FIHP

 
PCR-single strand conformation polymorphism (SSCP) and DNA sequencing

Primers for PCR amplification were listed in Table 1Go. The coding sequence, including 9 coding exons and 16 splice junctions of the MEN1 gene (9), was first screened with PCR-SSCP (13). Three conditions of 8% polyacrylamide gels, containing 0%, 5%, or 10% glycerol, were routinely used for PCR-SSCP screening for each PCR product.


View this table:
[in this window]
[in a new window]
 
Table 1. PCR primer pairs for the coding region and splice junctions of the MEN1 gene and for RT-PCR with their product sizes

 
Aberrantly shifted bands detected with PCR-SSCP analysis were excised from a polyacrylamide gel eluted in distilled water at 55 C for more than 30 min and cloned into the pCR II vector with a TA cloning kit (Invitrogen, San Diego, CA). DNA sequences of at least six clones that were amplified in more than two separate experiments were determined as previously described (13) in sense and antisense directions. In cases where mutated bands were not separable with PCR-SSCP analysis, sequences were determined for the cloned PCR products in at least one patient in each pedigree.

Assessment of allelic ratios

Allelic ratios in tumor DNA relative to leukocyte DNA were assessed with the previously reported method (13) in regard to five microsatellite markers on 11q13; D11S1883 (17),D11S457 (18), PYGM (19), D11S449 (18), and D11S1889 (17). The allelic ratio of the PYGM locus was examined with two sets of primers. One common 5'-primer was at nucleotides 176–195 (ctagcagagtccacctactg) in GenBank accession no. M77201. Two 3'-primers included nucleotides 277–297 (cacagagagagagagagagag), which amplified PYGM1 including 5'-CA repeats varying from 120–130 bp, and nucleotides 332–351 (gtcagttgctacctgacagc), which amplified PYGM2 including 5'-CA and 3'-GA repeats varying from 156–190 bp (19).

RT-PCR procedure

Total ribonucleic acid (RNA) from tissue was prepared with ISOGEN (Nippon Gene, Tokyo, Japan) and treated with DNase at 37 C for 1 h. Complementary DNA was synthesized from 2 µg total RNA with random hexamers and Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI) at 37 C for 1 h. The complementary DNA was then amplified by PCR in 35 cycles with the primer pair listed in Table 1Go with the initial denaturation at 95 C for 10 min, denaturation at 94 C for 1 min, annealing at 62 C for 1 min, and extension at 72 C for 1 min, followed by electrophoresis on an 8% polyacrylamide gel.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mutations of the MEN1 gene were screened for 12 overlapping PCR products with the corresponding primer sets covering the entire coding region and splice junctions (Table 1Go). PCR-SSCP analysis of leukocyte or normal tissue DNA from 5 familial and 4 sporadic cases of MEN-1 detected aberrantly shifted bands in 6 cases, including 5 cases of familial (cases 1–5) and 1 case of sporadic (case 9) MEN-1 of 9 cases of MEN-1 (Fig. 1Go). PCR-SSCP of DNA from tumor tissues and leukocytes of these 6 cases exhibited the identical SSCP patterns, showing that aberrantly shifted bands are common to tumor and leukocyte DNA (data not shown). DNA sequences of the MEN1 gene in 3 cases of sporadic MEN-1 (cases 6–8) in which mutated bands were not separable with PCR-SSCP analysis were determined with sequencing, and mutations were similarly detected in these 3 cases.



View larger version (53K):
[in this window]
[in a new window]
 
Figure 1. PCR-SSCP analysis of the MEN1 gene in familial and sporadic MEN-1. Lane numbers are the same as case numbers in Table 2Go. A, Germ-line mutations detected with PCR-SSCP. a, SSCP patterns of exon 2B in six representative samples. Aberrantly shifted bands were observed in cases 1 and 9. b, SSCP patterns of exon 2C in three representative samples. An aberrantly shifted band was observed in case 4. c, SSCP patterns of exon 7 in four representative samples. An aberrantly shifted band was observed in case 5. d, SSCP patterns of exon 8 in five representative samples. Aberrantly shifted bands were observed in cases 2 and 3. B, SSCP patterns of polymorphic changes at codon 418 of GAC or GAT. The aberrantly shifted bands represent GAC (upper band), GAT (middle band), and GAC and GAT (lower band), respectively. Lane C, Control DNA as a template. Lane N, Template free.

 
Of eight different types of mutations in the cases summarized in Table 2Go, five frameshift mutations caused amino acid changes and the premature stop codon formation. The nonsense mutation in case 6 was a Gln to stop substitution at codon 166 (CAG->TAG). The missense mutation in case 5 was a Pro to Leu substitution at codon 320 (CCC->CTC). One splicing mutation from AG to GG at the 3'-splice signal in intron 7 was detected in cases 2 and 3, but not in unaffected subjects in this pedigree.

We detected abnormal splicing in RNA extracted from a parathyroid tumor of case 2 with RT-PCR analysis. An 805-bp RT-PCR fragment (Fig. 2Go, lane 3) amplified with a pair of primers located in exons 7 and 9 (Table 1Go) was longer than the 344-bp wild-type fragment (Fig. 2Go, lane 5) in contrast with the 1242-bp PCR product from genomic DNA (Fig. 2Go, lane 2). Sequencing of the 805-bp fragment proved that intron 7 (461 bp) was not spliced out due to the loss of the splicing acceptor AG sequence, and the inclusion of intron 7 produced a stop codon at the created codon 351.



View larger version (112K):
[in this window]
[in a new window]
 
Figure 2. RT-PCR detection of transcripts of the MEN1 gene. Total RNA was reverse transcribed, and PCR products were amplified with primers located in exons 7 and 9 were electrophoresed on a polyacrylamide gel and stained with ethidium bromide. M, øX174 HaeIII-digested DNA fragments used as molecular markers; lane 1, template free; lane 2, genome DNA from case 2 as a template; lane 3, RT treatment of RNA from a parathyroid tumor of case 2 as a template; lane 4, no RT treatment of RNA from a parathyroid tumor of case number 2 as a template; lane 5, RT treatment of RNA from a normal tissue as a template; lane 6, no RT treatment of RNA from a normal tissue as a template.

 
Germ-line mutations of the MEN1 gene were also analyzed with PCR-SSCP for leukocyte DNA in six cases (two each) in three pedigrees of familial pituitary adenoma and three cases in one pedigree of FIHP, but aberrantly shifted bands were not detected (Table 3Go). In addition, no germ-line mutations of the MEN1 gene were detected with sequencing PCR-amplified leukocyte DNA covering the entire coding exons and splice junctions in four cases in three pedigrees of familial pituitary adenoma. In addition to germ-line mutations, somatic mutations of the MEN1 gene were screened for two pituitary adenomas of cases 11 and 12, because they showed LOH on 11q13 (see below). A somatic mutation of menin that deleted the second letter A of codon 556 (GAG) resulted in a stop codon at codon 558 in the pituitary adenoma of case 11.

We detected one synonymous polymorphism at codon 418 of GAC or GAT (Fig. 1BGo), with the former in 66% (12 of 18), and another polymorphism at codon 541 of GCA or ACA encoding alanine or threonine, respectively, with the former in 39% (7 of 18), in Japanese.

To determine whether the allelic loss is present on 11q13 in tumor tissues, we assessed the allelic ratios for five microsatellite markers using DNA samples of tumor tissues and leukocytes in five cases in four pedigrees of familial MEN-1, four cases of sporadic MEN-1, three cases in two pedigrees of familial pituitary adenoma, and three cases in one pedigree of FIHP with PCR-based microsatellite analysis (Fig. 3Go). As summarized in Table 4Go, LOH on 11q13 was detected in all five tumors of familial MEN-1, all four tumors of sporadic MEN-1, and two adenomas from two cases in one pedigree of familial pituitary adenoma, but not in one pituitary adenoma of familial pituitary adenoma or all three parathyroid adenomas of FIHP. Tumor DNA of three cases, including cases 13–15, were not available for microsatellite analysis.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 3. Representative examples of microsatellite patterns of D11S1883, D11S457, PYGM, D11S449, and D11S1889 in familial or sporadic MEN-1 patients. Results for cases 1 and 6 are shown in A and B, respectively. DNAs from leukocytes (WBC) and tumor tissue (tumor) were analyzed in each case. Arrowheads denote smaller allele product peaks in tumor DNA compared to leukocyte DNA. R, Retention of both alleles; ni, noninformative.

 

View this table:
[in this window]
[in a new window]
 
Table 4. Loss of heterozygosity in affected tumors on 11q13 in familial and sporadic MEN-1, familial pituitary adenoma, and FIHP

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Diverse mutations in the MEN1 gene were reported in 47 of 50 probands or in all 9 cases of familial MEN-1 and in 8 of 11 cases of sporadic MEN-1 in Caucasians (10, 11). In this study, we detected germ-line mutations in all 5 cases in 4 independent pedigrees of familial MEN-1 and in all 4 cases of sporadic MEN-1 in Japanese. The common feature of detected mutations in our study is the loss of function of menin due to frameshift mutations producing a stretch of frameshifted amino acids followed by a stop codon (cases 1–4 and 7–9) or an immediate nonsense mutation (case 6). We also detected LOH on 11q13 in tumors of all 5 familial and 4 sporadic cases of MEN-1.

We did not find obvious correlation between the type of MEN1 gene mutations and the phenotypes of MEN-1 (Table 2Go). The incidence of polymorphism at codon 541 of GCA or ACA encoding alanine or threonine, with the former in 39% (7 of 18), in Japanese in our study is higher than the reported incidence of 4% (6 of 142) in Caucasians (10), representing the racial difference.

Germ-line mutations in the RET protooncogene were detected in cases of familial medullary thyroid carcinomas as well as those of MEN-2A (20), suggesting that familial medullary thyroid carcinoma is genotypically similar to MEN-2A. Although familial pituitary adenoma without MEN-1 and FIHP could be variants of MEN-1, Benlian et al. recently reported that their cases with familial acromegaly were not linked to the MEN1 gene locus by segregation analysis (2). Three pedigrees with 6 cases of familial pituitary adenoma in our study, including 1 previously reported pedigree (cases 10 and 11) (3), against the total number of only 19 reported pedigrees afforded us an important opportunity to screen germ-line mutations of the MEN1 gene. Germ-line mutation in the MEN1 gene was not found in 3 pedigrees of familial pituitary adenoma unrelated to MEN-1. LOH on 11q13 was, however, detected in 2 familial pituitary adenomas in 2 cases (cases 10 and 11). We further examined somatic mutations of the MEN1 gene in their 2 pituitary adenomas and detected a somatic mutation in 1 pituitary tumor of case 11. Although methylation-dependent inactivation or mutations in the promoter, introns, or untranslated regions of the MEN1 gene were not excluded in our study, our results suggest that germ-line mutations in the coding regions of the MEN1 gene do not contribute to the pituitary tumorigenesis in familial pituitary adenoma without MEN-1. A somatic mutation of the MEN1 gene with LOH on 11q13 was, however, suggested to contribute to the pituitary tumorigenesis in a subgroup of familial pituitary adenoma without MEN-1. The predominance of GH-producing pituitary tumors in 5 of 6 cases of familial pituitary adenoma vs. that of prolactinoma in 3 of 5 cases of familial or sporadic MEN-1 in our study may suggest that another unidentified tumor-suppressor gene on 11q13 is etiological for familial pituitary adenoma.

Germ-line mutations of the MEN1 gene in its coding sequence were not detected in three cases of usually autosomal dominant FIHP (4, 6, 7). Hyperparathyroidism-jaw tumor syndrome is a related, but genetically distinct, state from MEN-1, and it was mapped to 1q21-q31 by Szabò et al. (5). Either linkage or exclusion of linkage of FIHP to 11q13 was reported (6, 7). We previously reported the absence of LOH on 11q13 in three parathyroid tumors (cases 16–18) in a pedigree of FIHP (12) and did not find MEN1 germ-line mutations in these patients in this study. In addition, no MEN1 germ-line mutations were reported in five probands of familial hyperparathyroidism (10). These suggest that the germ-line mutation of the MEN1 gene is not etiological for FIHP.

The copresence of germ-line mutations of the MEN1 gene and LOH on 11q13 in endocrine tumors in all five familial and four sporadic cases of MEN-1 confirmed that the loss of function of menin is etiological for familial and sporadic MEN-1 (9, 10, 11). The absence of germ-line mutations of the MEN1 gene in its coding sequence or LOH on 11q13 in three cases of FIHP also confirmed that the germ-line mutation of the MEN1 gene is not etiological for this disorder (10). The copresence of LOH on 11q13 and a somatic mutation of the MEN1 gene in one of six cases in three separate pedigrees of familial pituitary adenoma, with another case in the same pedigree associated only with LOH on 11q13, proved that the loss of function of menin plays a role in pituitary tumorigenesis in a subset of familial pituitary adenoma unrelated to MEN-1. In the presence of LOH on 11q13, it is possible that the remaining single MEN1 gene can contribute to somatic mutation even if the familial susceptibility for somatic mutation is transmitted by a different gene on another chromosome. Based on these findings, it is concluded that the germ-line mutation of the coding sequence of the MEN1 gene is not etiological for familial pituitary adenoma without MEN-1.


    Acknowledgments
 
We thank Drs. Akira Yoshida, Yoshihide Fujimoto, Hiroshi Sarui, Hiroko Yasuda, Yuichi Fujinaka, Teruhiko Hattori, and Masaru Tsuyuguchi for providing tumors. We thank Professor Emeritus of Shiro Saito, the president of the University of Tokushima, for his continuous support.


    Footnotes
 
1 This work was supported in part by a grant from Otsuka Pharmaceutical Factory Inc., for Otsuka Department of Clinical and Molecular Nutrition, The University of Tokushima School of Medicine. Back

Received September 4, 1997.

Revised November 7, 1997.

Accepted November 14, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ballard HS, Frame B, Hartsock RJ. 1964 Familial multiple endocrine adenoma-peptic ulcer complex. Medicine. 43:481–516.[CrossRef][Medline]
  2. Benlian P, Giraud S, Lahlou N, et al. 1995 Familial acromegaly: a specific clinical entity–further evidence from the genetic study of a three-generation family. Eur J Endocrinol. 133:451–456.[Abstract/Free Full Text]
  3. Yamada S, Yoshimoto K, Sano T, et al. 1997 Inactivation of the tumor suppressor gene on 11q13 in brothers with familial acrogigantism without multiple endocrine neoplasia type 1. J Clin Endocrinol Metab. 82:239–242.[Abstract/Free Full Text]
  4. Mallette LE. 1994 The functional and pathologic spectrum of parathyroid abnormalities in hyperparathyroidism. In: Bilezikian JP, Marcus R, Levine MA, eds. The parathyroids. New York: Raven Press; 423–455.
  5. Szabò J, Heath B, Hill VM, et al. 1995 Hereditary hyperparathyroidism-jaw tumor syndrome: the endocrine tumor gene HRPT2 maps to chromosome 1q21–q31. Am J Hum Genet. 56:944–950.[Medline]
  6. Wassif WS, Moniz CF, Friedman E, et al. 1993 Familial isolated hyperparathyroidism: a distinct genetic entity with an increased risk of parathyroid cancer. J Clin Endocrinol Metab. 77:1485–1489.[Abstract]
  7. Kassem M, Zhang X, Brask S, Eriksen EF, Mosekilde L, Kruse TA. 1994 Familial isolated primary hyperparathyroidism. Clin Endocrinol (Oxf). 41:415–420.[Medline]
  8. Larsson C, Skogseid B, Öberg K, Nakamura Y, Nordenskjöld M. 1988 Multiple endocrine neoplasia type 1 gene maps to chromosome 11 and is lost in insulinoma. Nature. 332:85–87.[CrossRef][Medline]
  9. Chandrasekharappa SC, Guru SC, Manickam P, et al. 1997 Positional cloning of the gene for multiple endocrine neoplasia-type 1. Science. 276:404–407.[Abstract/Free Full Text]
  10. Agarwal SK, Kester MB, Debelenko LV, et al. 1997 Germline mutations of the MEN1 gene in familial multiple endocrine neoplasia type 1 and related states. Hum Mol Genet. 6:1169–1175.[Abstract/Free Full Text]
  11. Lemmens I, Van de Ven WJM, Kas K, et al. 1997 Identification of the multiple endocrine neoplasia type 1 (MEN1) gene. Hum Mol Genet. 6:1177–1183.[Abstract/Free Full Text]
  12. Yoshimoto K, Endo H, Tsuyuguchi M, et al. Familial isolated primary hyperparathyroidism with parathyroid carcinomas: clinical and molecular features. Clin Endocrinol (Oxf). In press.
  13. Tanaka C, Yoshimoto K, Yang P, et al. 1997 Infrequent mutations of p27Kip1 gene and trisomy 12 in a subset of human pituitary adenomas. J Clin Endocrinol Metab. 82:3141–3147.[Abstract/Free Full Text]
  14. Shintani Y, Yoshimoto K, Horie H, et al. 1995 Two different pituitary adenomas in a patient with multiple endocrine neoplasia type 1 associated with growth hormone-releasing hormone-producing pancreatic tumor: clinical and genetic features. Endocrinol J. 42:331–340.
  15. Yoshimoto K, Iwahana H, Kubo K, Saito S, Itakura M. 1991 Allele loss on chromosome 11 in a pituitary tumor from a patient with multiple endocrine neoplasia type 1. Jpn J Cancer Res. 82:886–889.[CrossRef][Medline]
  16. Sarui H, Yoshimoto K, Okumura S, et al. 1997 Cystic glucagonoma with loss of heterozygosity on chromosome 11 in multiple endocrine neoplasia type 1. Clin Endocrinol (Oxf). 46:511–516.[CrossRef][Medline]
  17. Dib C, Fauré S, Fizames C, et al. 1996 A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature. 380:152–154.[CrossRef][Medline]
  18. Gyapay G, Morissette J, Vignal A, et al. 1994 The 1993–94 Généthon human genetic linkage map. Nat Genet. 7:246–339.[CrossRef][Medline]
  19. Iwasaki H, Stewart PW, Dilley WG, et al. 1992 A minisatellite and a microsatellite polymorphism within 1.5 kb at the human muscle glycogen phosphorylase (PYGM) locus can be amplified by PCR and have combined informativeness of PIC 0.95. Genomics. 13:7–15.[CrossRef][Medline]
  20. Xue F, Yu H, Maurer LH, et al. 1994 Germline RET mutations in MEN 2A and FMTC and their detection by simple DNA diagnostic tests. Hum Mol Genet. 3:635–638.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Endocr Relat CancerHome page
X.-H. Jiang, J.-L. Lu, B. Cui, Y.-J. Zhao, W.-q. Wang, J.-M. Liu, W.-Q. Fang, Y.-N. Cao, Y. Ge, C.-x. Zhang, et al.
MEN1 mutation analysis in Chinese patients with multiple endocrine neoplasia type 1
Endocr. Relat. Cancer, December 1, 2007; 14(4): 1073 - 1079.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. A. Toledo, D. M. Lourenco Jr., B. Liberman, M. B. C. Cunha-Neto, M. G. Cavalcanti, C. B. Moyses, S. P. A. Toledo, and P. L. M. Dahia
Germline Mutation in the Aryl Hydrocarbon Receptor Interacting Protein Gene in Familial Somatotropinoma
J. Clin. Endocrinol. Metab., May 1, 2007; 92(5): 1934 - 1937.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
V. M. Howell, J. W. Cardinal, A.-L. Richardson, O. Gimm, B. G. Robinson, and D. J. Marsh
Rapid Mutation Screening for HRPT2 and MEN1 Mutations Associated with Familial and Sporadic Primary Hyperparathyroidism
J. Mol. Diagn., November 1, 2006; 8(5): 559 - 566.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
O. Vierimaa, M. Georgitsi, R. Lehtonen, P. Vahteristo, A. Kokko, A. Raitila, K. Tuppurainen, T. M. L. Ebeling, P. I. Salmela, R. Paschke, et al.
Pituitary Adenoma Predisposition Caused by Germline Mutations in the AIP Gene.
Science, May 26, 2006; 312(5777): 1228 - 1230.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. S. Soares, K. Eguchi, and L. A. Frohman
Tumor Deletion Mapping on Chromosome 11q13 in Eight Families with Isolated Familial Somatotropinoma and in 15 Sporadic Somatotropinomas
J. Clin. Endocrinol. Metab., December 1, 2005; 90(12): 6580 - 6587.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. A. Carrasco, A. A. Gonzalez, C. A. Carvajal, C. Campusano, E. Oestreicher, E. Arteaga, N. Wohllk, and C. E. Fardella
Novel Intronic Mutation of MEN1 Gene Causing Familial Isolated Primary Hyperparathyroidism
J. Clin. Endocrinol. Metab., August 1, 2004; 89(8): 4124 - 4129.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
W. F. Simonds, C. M. Robbins, S. K. Agarwal, G. N. Hendy, J. D. Carpten, and S. J. Marx
Familial Isolated Hyperparathyroidism Is Rarely Caused by Germline Mutation in HRPT2, the Gene for the Hyperparathyroidism-Jaw Tumor Syndrome
J. Clin. Endocrinol. Metab., January 1, 2004; 89(1): 96 - 102.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
A Cebrian, S Ruiz-Llorente, A Cascon, M Pollan, J J Diez, A Pico, D Telleria, J Benitez, and M Robledo
Mutational and gross deletion study of the MEN1 gene and correlation with clinical features in Spanish patients
J. Med. Genet., May 1, 2003; 40(5): e72 - 72.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. Verges, F. Boureille, P. Goudet, A. Murat, A. Beckers, G. Sassolas, P. Cougard, B. Chambe, C. Montvernay, and A. Calender
Pituitary Disease in MEN Type 1 (MEN1): Data from the France-Belgium MEN1 Multicenter Study
J. Clin. Endocrinol. Metab., February 1, 2002; 87(2): 457 - 465.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. L. Brandi, R. F. Gagel, A. Angeli, J. P. Bilezikian, P. Beck-Peccoz, C. Bordi, B. Conte-Devolx, A. Falchetti, R. G. Gheri, A. Libroia, et al.
CONSENSUS: Guidelines for Diagnosis and Therapy of MEN Type 1 and Type 2
J. Clin. Endocrinol. Metab., December 1, 2001; 86(12): 5658 - 5671.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. S. Guo and M. P. Sawicki
Molecular and Genetic Mechanisms of Tumorigenesis in Multiple Endocrine Neoplasia Type-1
Mol. Endocrinol., October 1, 2001; 15(10): 1653 - 1664.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
T. Abe, K. Yoshimoto, M. Taniyama, K. Hanakawa, H. Izumiyama, M. Itakura, and K. Matsumoto
An Unusual Kindred of the Multiple Endocrine Neoplasia Type 1 (MEN1) in Japanese
J. Clin. Endocrinol. Metab., March 1, 2000; 85(3): 1327 - 1330.
[Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
M. R. Gadelha, K. N. Une, K. Rohde, M. Vaisman, R. D. Kineman, and L. A. Frohman
Isolated Familial Somatotropinomas: Establishment of Linkage to Chromosome 11q13.1-11q13.3 and Evidence for a Potential Second Locus at Chromosome 2p16-12
J. Clin. Endocrinol. Metab., February 1, 2000; 85(2): 707 - 714.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Kassem, T. A. Kruse, F. K. Wong, C. Larsson, and B. T. Teh
Familial Isolated Hyperparathyroidism as a Variant of Multiple Endocrine Neoplasia Type 1 in a Large Danish Pedigree
J. Clin. Endocrinol. Metab., January 1, 2000; 85(1): 165 - 167.
[Abstract] [Full Text]


Home page
Endocr. Rev.Home page
P. L. M. Dahia and A. B. Grossman
The Molecular Pathogenesis of Corticotroph Tumors
Endocr. Rev., April 1, 1999; 20(2): 136 - 155.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
M. R. Gadelha, T. R. Prezant, K. N. Une, R. P. Glick, S. F. Moskal II, M. Vaisman, S. Melmed, R. D. Kineman, and L. A. Frohman
Loss of Heterozygosity on Chromosome 11q13 in Two Families with Acromegaly/Gigantism Is Independent of Mutations of the Multiple Endocrine Neoplasia Type I Gene
J. Clin. Endocrinol. Metab., January 1, 1999; 84(1): 249 - 256.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
C. Tanaka, T. Kimura, P. Yang, M. Moritani, T. Yamaoka, S. Yamada, T. Sano, K. Yoshimoto, and M. Itakura
Analysis of Loss of Heterozygosity on Chromosome 11 and Infrequent Inactivation of the MEN1 Gene in Sporadic Pituitary Adenomas
J. Clin. Endocrinol. Metab., August 1, 1998; 83(8): 2631 - 2634.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
B. Mayr, G. Brabant, and A. v. z. Mühlen
Menin Mutations In MEN1 Patients
J. Clin. Endocrinol. Metab., August 1, 1998; 83(8): 3004 - 3005.
[Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tanaka, C.
Right arrow Articles by Itakura, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tanaka, C.
Right arrow Articles by Itakura, M.
Right arrowPubmed/NCBI databases
*OMIM*Protein
*Compound via MeSH
*Substance via MeSH
*Genetics Home Reference


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals