help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Namnoum, A. B.
Right arrow Articles by Levine, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Namnoum, A. B.
Right arrow Articles by Levine, M. A.
The Journal of Clinical Endocrinology & Metabolism Vol. 83, No. 3 824-829
Copyright © 1998 by The Endocrine Society


From the Clinical Research Centers

Reproductive Dysfunction in Women with Albright’s Hereditary Osteodystrophy1

Anne B. Namnoum, George R. Merriam, Arnold M. Moses and Michael A. Levine

Departments of Gynecology and Obstetrics (A.B.N.) and Medicine (M.A.L.), The Johns Hopkins University School of Medicine, Baltimore, Maryland 21287; VA Puget Sound Health Care System and Divisions of Metabolism, Endocrinology and Nutrition, and Reproductive Endocrinology, University of Washington, Seattle, Washington 98195 (G.R.M.); Department of Medicine (A.M.M.), the State University Hospital, Syracuse, New York 13210

Address all correspondence and requests for reprints to: Michael A. Levine, M.D., Division of Endocrinology and Metabolism, The Johns Hopkins University School of Medicine, 863 Ross Research Building, 720 Rutland Avenue, Baltimore, Maryland 21205. E-mail: mlevine{at}welchlink.welch.jhu.edu


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Most individuals with Albright’s hereditary osteodystrophy (AHO) have deficient expression or function of Gs{alpha}, the alpha subunit of the guanine nucleotide binding protein that stimulates adenylyl cyclase, and are resistant to parathyroid hormone (PTH) and other hormones that act via stimulation of adenylyl cyclase. To determine the incidence and etiology of ovarian dysfunction in women with AHO, we examined the reproductive history and hypothalamic-pituitary-ovarian axis in 17 affected women aged 17–43 yr. All patients had typical PTH resistance and an approximately 50% reduction in erythrocyte Gs{alpha} activity. (0.43 ± 0.03 vs. 0.92 ± 0.08 for normal control subjects, P < 0.001). Fourteen of the 17 patients (76%) were oligomenorrheic or amenorrheic, more than half had delayed or incomplete sexual development, and only two had a history of earlier pregnancy. Most women were mildly hypoestrogenic, with normal to slightly elevated serum gonadotropin levels. Computer analysis of 24° LH measurement showed that the frequency of LH peaks/24 h in AHO women varied widely, but as a group they were not statistically different from a group of normal women studied in the early follicular phase. Administration of 100 µg synthetic GnRH produced normal FSH and LH responses. We conclude that reproductive dysfunction is common in women with AHO and probably represents partial resistance to gonadotropins.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
ALBRIGHT’S hereditary osteodystrophy (AHO) is an inherited metabolic disorder characterized by an unusual constellation of somatic and developmental defects, including short stature, brachydactyly, obesity, subcutaneous ossifications (1), and deficient expression or function of the {alpha} subunit of the guanine nucleotide regulatory protein (Gs{alpha}) that stimulates adenylyl cyclase (2, 3). In addition, most patients with AHO show resistance to multiple hormones (e.g. parathyroid hormone, thyroid stimulating hormone, and glucagon) that bind to receptors that require Gs{alpha} for activation of adenylyl cyclase (AC). This condition has been termed pseudohypoparathyroidism type 1a (PHP 1a) (4). By contrast, some affected subjects appear to have normal endocrine responsiveness despite Gs{alpha} deficiency, a condition that has been termed pseudopseudohypoparathyroidism (PPHP) (5).

Although several case reports and clinical studies (4, 6, 7) have alluded to menstrual irregularities and hypogonadism in women with AHO, the cause and significance of female reproductive dysfunction in AHO remains unknown. If the basis of hypogonadism is ovarian resistance to stimulation by follicle stimulating hormone (FSH) and luteinizing hormone (LH), similar to the target tissue resistance to PTH and TSH, one would expect the clinical picture of hypogonadism to be accompanied by elevated levels of plasma gonadotropins. This mechanism is supported by the description by Wolfsdorf et al. (7) of a woman with AHO and PHP type 1a who was oligomenorrheic and had elevated basal levels of gonadotropins. By contrast, other reports have described women with AHO who have ovarian dysfunction and apparently normal gonadotropin levels (8). To determine the incidence, mechanism, and natural history of reproductive dysfunction in women with AHO, we evaluated the reproductive history and hypothalamic-pituitary-ovarian axis in women with AHO and PHP type 1a.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Patients

Seventeen women (aged 17–43 yr) with PHP type 1a were evaluated, but some women did not undergo all tests. All met criteria for AHO including brachydactyly, unilateral or bilateral, involving hands or feet, short stature, and decreased Gs{alpha} activity. Subcutaneous ossifications were present in 11 of the women. All of the women were normocalcemic on vitamin D and calcium supplementation, and all were euthyroid at the time of testing. The control group consisted of 13 normal adult women who had regular menstrual cycles. Menstrual histories, Tanner developmental stages, and peripheral blood cell karyotypes were obtained. Body mass index (BMI) was derived from measurements of height and weight. Clinical information including menstrual history, pregnancy history, and history of hormonal use was obtained for the period of time up to 10 yr after the initial studies. Written informed consent was obtained from all patients and controls.

Hormone assays

Basal plasma levels of reproductive hormones were determined by radioimmunoassay (Hazelton Laboratories, Vienna, VA), including estradiol (E2), progesterone (P), prolactin, LH, FSH, 17-hydroxy progesterone, testosterone, androstenedione, and dehydroepiandrosterone. In women with regular menses, blood samples were obtained during the early follicular phase of the cycle. As it was not possible to determine the phase of the cycle in oligomenorrheic or amenorrheic women, blood samples were drawn randomly in these women. In some women, pelvic ultrasonographic examination was performed to evaluate ovarian structure and size.

LH pulsatility

Eleven women had blood samples drawn from an indwelling catheter at 20-min intervals during a 24-h period for gonadotropin measurement and analysis of LH pulsatility. Testing was conducted at the Clinical Center of the National Institutes of Health. The pattern of LH peaks was analyzed with the Pulsar program (Pharmacia Peptide Hormones, Stockholm, Sweden), which scores LH peaks by height and duration from a smoothed local baseline, using the dose-dependent radioimmunoassay variance as a scale factor (9, 10). For these studies cutoffs were 3.8, 2.6, 1.9, 1.5, and 1.2 SD for peaks 1–5 points in duration, respectively. The intrassay coefficient of variation for LH measurements averaged 5.3% over the range of values studied. Results were compared with those obtained from a group of normally cycling women sampled at the same frequency who were studied in the early- to mid-follicular phase.

Provocative tests

Eight patients underwent gonadotropin releasing hormone (GnRH) stimulation tests with 100 µg synthetic GnRH. Samples were drawn at 0, 15, 30, 60, and 120 min for measurement of LH and FSH levels. In some patients, progestin-induced withdrawal bleeding was tested by the administration of a single intramuscular injection of progesterone in oil (200 mg). In other patients, medroxyprogesterone (5 mg) was given daily for the last 10 days of a month in which they also took estrogen (e.g. conjugated equine estrogens 0.625 mg) daily. The onset of uterine bleeding within 10 days of administration of progestin was considered evidence of a positive response.

Determination of erythrocyte Gs{alpha} Activity

The biological activity of Gs{alpha} was determined using a complementation assay (3, 11) based on the ability of solubilized extracts of erythrocyte membranes to reconstitute the responsiveness of adenylyl cyclase in membranes prepared from S49 cyc- murine lymphoma cells, which genetically lack Gs{alpha} protein (12). Blood was obtained from patients and from control subjects by venipuncture and anticoagulated with acid citrate dextrose. Erythrocyte membranes were prepared as previously described (3), and soluble extracts were obtained by treatment with 0.2% (wt/vol) Lubrol PX (ICN Biomedicals, Aurora, OH).

Soluble extracts were assayed for Gs{alpha} activity using S49 cyc- membranes, essentially as previously described (13). The assay for Gs{alpha} activity is linear with respect to the amount of extract protein added. Results of assays were expressed as a percentage of the activity of a standard membrane preparation consisting of pooled erythrocytes from five normal persons, and they represent the mean of at least three separate determinations.

Ovarian histology and Gs{alpha} messenger RNA (mRNA) analysis

One patient who underwent total abdominal hysterectomy and bilateral salpingo-oophorectomy for unrelated reasons had ovarian tissue submitted for histological evaluation and Gs{alpha} mRNA analysis. Total cellular RNA was isolated from ovarian tissue by the guanidinium isothiocyanate-cesium chloride technique (14). First-strand complementary DNA (cDNA) was synthesized from 5 µg RNA in a 20-µL reaction mixture containing 100 pmol of random hexamer primers and 200 units Moloney murine leukemia virus reverse transcriptase (BRL, Gaithersburg, MD) (15). Aliquots of cDNA served as templates for in vitro amplification by PCR (16), in patient 5, of a 600 bp fragment of G{alpha}s cDNA using synthetic oligonucleotides that flank the known GNAS1 missense mutation (R165C) (17). The primers were designed using the MELTMAP 87 program (generously provided by Dr. L. S. Lerman, MIT, Cambridge, MA) to optimize analysis by denaturing gel electrophoresis (DGGE); to increase the sensitivity of DGGE one oligonucleotide of the pair was synthesized with a 5' GC-rich clamp. Oligonucleotide primers were synthesized by phosphoramidite chemistry, using a Milligen/Biosearch Cyclone Plus DNA Synthesizer (Burlington, MA). Reactions contained 3 µL first-strand cDNA in 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin, 0.5 µM of each primer(sense primer located in exon 5, 5'GACTTCCCTCCCGAATTCTATGAG; antisense primer located in exon 9, 5'GCGCCCGGCGCCGCCCGCCGGCGCGGCCCGCCCGCGGG-CGAAGCACTGGATCCACTTGCGGCG), 0.25 mM each dATP, dCTP, dGTP, dTTP, and 2.0 units of Taq polymerase (Perkin Elmer-Cetus Corp., Norwalk, CT). After an initial denaturation for 4 min at 94 C, the samples underwent 40 amplification cycles consisting of denaturation for 1 min at 94 C, annealing for 1 min at 55 C, and extension for 2 min at 72 C, with a final extension of 10 min.

Amplified DNA samples were analyzed by DGGE as previously described (17, 18). Briefly, samples (15–30 µL) were electrophoresed at 60 C for 16 h at 85 volts in 6.5% polyacrylamide gels containing a denaturant gradient (40–80%) parallel to the direction of electrophoresis (100% denaturant = 7 M urea and 40% formamide). After electrophoresis, gels were stained with ethidium bromide (1 µg/mL) and photographed by UV transillumination with Polaroid type-55 film (Rochester, NY).

Statistical analysis

Data were analyzed with the Student t test for unpaired samples. The 95% confidence interval was used for testing significance. Unless otherwise stated, results are expressed as mean ± 1 SD.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Gs{alpha} levels and clinical profiles

Patients with PHP type 1a had a reduction of approximately 50% in erythrocyte Gs{alpha} activity (0.43 ± 0.03 vs. 0.92 ± 0.08 P < 0.001) (Table 1Go). There was no relationship between the level of Gs{alpha} activity and any clinical or reproductive endocrine parameters.


View this table:
[in this window]
[in a new window]
 
Table 1. Hormonal function in AHO females

 
Menstrual histories of the 17 women with AHO and PHP type 1a were obtained (Table 2Go). Four of these women had regular menses, 4 had primary amenorrhea, 1 had secondary amenorrhea, and 8 had oligomenorrhea. Two of the women with oligomenorrhea had prior pregnancies. Physical examination revealed incomplete development of secondary sexual characteristics (Tanner III-IV) in the majority of patients. Mild hirsutism was noted in 3 patients. The mean height was 145 cm, the mean weight was 66.6 kg, and the mean BMI was 31.7.


View this table:
[in this window]
[in a new window]
 
Table 2. Clinical characteristics of patients studied

 
Karyotypes were normal (46XX) in all patients except patient number 12, who had a chromosomal translocation (46XXt) (13, 14, 15). Pelvic ultrasonography was performed in 9 cases and showed small- to normal-sized ovaries in all patients examined. Small follicular cysts, evidence of follicular activity, were noted in only 5 of the 9 patients. Failure to observe follicular activity in the remaining patients may have been the result of random timing of ultrasonography in the oligomenorrheic patients.

Basal hormonal profile

Mean basal hormone levels in the PHP type 1a patients are presented in Table 1Go. Plasma estradiol levels were less than 50 pg/mL in 14 of the 17 women, similar to levels present during the normal early follicular phase. Plasma concentrations of progesterone were low, similar to levels present in the follicular phase, in all patients. Serum concentrations of gonadotropins FSH and LH were normal to slightly elevated. Prolactin levels were normal in all except patient number 14, whose prolactin level was minimally elevated. Serum concentrations of androgens were normal in all women tested.

Because of dysfunctional uterine bleeding, patient number 5 later underwent hysterectomy with bilateral salpingo-oophorectomy and subsequently developed markedly elevated levels of serum gonadotropins that were appropriate for a postmenopausal female.

LH Pulsatility

Pulsar analysis of plasma LH values obtained during the 24-h sampling (Table 1Go) showed that the frequency of LH peaks per 24° in the PHP type 1A group was not statistically different from that of a group of normal women studied in the early follicular phase. (11.8 ± 4.9 vs. 12 ± 5.2). Some women, however, had high (subjects 2, 3, and 10) or low (subjects 1 and 11) pulse frequencies.

GnRH stimulation tests

LH responses (Fig. 1Go) and FSH responses (Fig. 2Go) to GnRH stimulation were similar to controls, with the exception of patient number 4, who was perimenopausal. However, given that the AHO patients were hypoestrogenic at the time of testing, these responses may underestimate responsiveness of the pituitary to GnRH.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 1. Serum LH responses to administration of GnRH. Serum concentrations of LH are presented before and after the iv injection of 100 µg GnRH at time zero. The shaded area represents LH values corresponding to one standard deviation above and below the mean for normal women who were studied on day 5 of their menstrual cycle. Symbols denote values for patients described in the text.

 


View larger version (25K):
[in this window]
[in a new window]
 
Figure 2. Serum FSH responses to administration of GnRH. Serum concentrations of FSH are presented before and after the iv injection of 100 µg GnRH at time zero. The shaded area represents FSH values corresponding to one standard deviation above and below the mean for normal women who were studied on day 5 of their menstrual cycle. Symbols denote values for patients described in the text.

 
Ovarian histology and Gs{alpha} mRNA expression

Gross examination and histological analysis of the resected ovarian tissue from patient number 5 revealed multiple follicular cysts that measured up to 1 cm. Several atretic scars were present, but no corpora lutea were identified.

PCR-amplified Gs{alpha} cDNA synthesized from ovarian mRNA was analyzed by denaturing gradient gel electrophoresis and showed an abnormal pattern. In addition to a DNA fragment corresponding to a wild type Gs{alpha} allele, a more slowly migrating fragment that contained an R165C missense mutation (1072) was also observed (Fig. 3Go). The two, more slowly migrating DNA fragments represent heteroduplexes formed between normal and abnormal DNA strands during PCR.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 3. Analysis of Gs{alpha} cDNA by denaturing gradient gel electrophoresis. An aliquot of total RNA isolated from ovarian tissue of patient 5 was reverse-transcribed, and the cDNA was amplified by PCR, as described in the text. The resulting DNA fragments were resolved by denaturing gradient gel electrophoresis, and the gel was stained with ethidium bromide. The two slowly migrating fragments represent heteroduplexes between the wild type and mutant (R165C) DNA fragments formed during the PCR; the mutant DNA homoduplex migrates more slowly than the wild-type DNA homoduplex.

 
Natural history

Long-term information on reproductive function was obtained from eight women, with a mean follow-up length of 8.6 yr. All women who had regular menses at the time of the initial study continued to have regular menses. Most women with 1° amenorrhea continued to be amenorrheic, but one woman reported the spontaneous onset of menses at age 28. Women with 2° amenorrhea and oligomenorrhea remained amenorrheic or had occasional spontaneous menses. None of these eight women had subsequent pregnancies despite unprotected intercourse. Estrogen and/or progestin therapy was given to approximately half of the women. Most patients had a weak response or no response to progestin withdrawal unless estrogen was also given.


    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Gonadal function is affected in several syndromes that involve abnormal function or activity of G proteins. In part, this may be due to the presence of multiple G protein-coupled signaling pathways that are involved in gonadotropin action, including both the adenylyl cyclase and the phospholipase C pathways (19, 20, 21). Children with McCune-Albright syndrome, a disorder in which somatic mutation of the GNAS1 gene results in mosaic distribution of cells containing an activated form of Gs{alpha} (22, 23), commonly have precocious puberty as well as autonomous hyperfunction of other endocrine glands (24). Iiri et al. (25) recently described two males with both precocious puberty and PHP type 1a. These two unrelated boys had identical GNAS1 gene mutations that resulted in a temperature-sensitive Gs{alpha} that is constitutively activated in the cooler environment of the testis, while being rapidly degraded in other tissues at normal body temperature. These studies indicate that gonadal function is highly influenced by the activity of Gs{alpha}.

Deficient activity of Gs{alpha} also has profound effects on reproductive function. In our series, three fourths of the AHO females with Gs{alpha} deficiency (PHP type 1a) were oligomenorrheic or amenorrheic, and 9 out of 12 had delayed puberty or incomplete sexual development. Reproductive dysfunction in these patients was not complete, however; some women had normal menstrual cycles, and two women with irregular menses had had full-term pregnancies in the past.

If ovarian dysfunction occurs via a mechanism of hormone resistance that is similar to that which accounts for TSH and PTH resistance in the thyroid and kidney, respectively, decreased secretion of estrogen would be expected to be accompanied by elevated gonadotropin levels, as in the single AHO patient described by Wolfsdorf et al. (7), and subsequently shown by us to have Gs{alpha} deficiency (patient 2b, ref 26). Therefore, we were surprised that serum gonadotropin levels were either normal or only slightly elevated in the women in our study, despite the fact that most of them were hypoestrogenic, as confirmed by scant or absent withdrawal bleeding after progestin administration. Although these results are consistent with a pattern of chronic anovulation of central etiology, several lines of evidence argue against this mechanism as the primary basis for reproductive dysfunction. First, most patients showed normal or increased LH pulsatility. Second, serum levels of gonadotropins were appropriately elevated in AHO females who were perimenopausal (patient 4) or postmenopausal (patient 5). Third, GnRH receptors are not directly coupled to the cAMP pathway, and thus a deficiency of Gs{alpha} should not have a significant effect on GnRH responsiveness. One mechanism to explain these clinical and biochemical findings is partial resistance of the theca and granulosa cells of the ovary to gonadotropins due to deficient Gs{alpha} activity. We found that one half of the Gs{alpha} mRNA in ovarian tissue from patient 5 was transcribed from the defective GNAS1 gene, consistent with a 50% reduction in levels of Gs{alpha} protein (not shown). Because both LH and FSH receptors are coupled to Gs{alpha} in the ovary, deficient expression or activity of Gs{alpha} might lead to a state of partial responsiveness to gonadotropins. Responsiveness might be sufficient to promote some degree of follicular development and steroid secretion, but might be insufficient to induce ovulation. Specifically, the estradiol levels may be adequate to exert negative feedback on gonadotropins (resulting in normal to slightly elevated gonadotropin levels), but may be inadequate to trigger the midcycle LH surge (i.e. positive feedback). Sonographic and histological findings of limited follicular development in these patients support this hypothesis.

Further evidence in support of the premise that partial ovarian resistance occurs in AHO is provided by the patient described by Wolfsdorf et al. (7), who was treated in order to induce ovulation. Administration of clomiphene citrate failed to induce ovulation, as might be expected in a hypoestrogenic patient. Despite elevated basal levels of FSH and LH, administration of human menopausal gonadotropins (hMG) stimulated an appropriate rise in serum estradiol to more than 500 pg/mL, indicating that, in at least some cases, partial ovarian resistance can be overcome by very high levels of gonadotropins. Despite the notable differences in basal gonadotropin levels between the patient described by Wolfsdorf et al. (7) and the patients we have described in this study, the similar molecular pathophysiology of Gs{alpha} deficiency in all these patients implicates a common mechanism of reproductive dysfunction.

Reduced expression or function of Gs{alpha} likely accounts for hormone resistance and reproductive dysfunction in women with PHP type 1a. By contrast, reproductive function is generally normal in women with pseudoPHP despite Gs{alpha} deficiency and GNAS1 mutations, which are indistinguishable from relatives with PHP type 1a. The basis for variable penetrance of hormone resistance in AHO is unknown. The observation that maternal transmission of Gs{alpha} deficiency leads to PHP type Ia, whereas paternal transmission of the defect leads to pseudoPHP (13, 27, 28), has implicated paternal imprinting as a possible explanation for the different phenotypes of identical GNAS1 gene defects (28, 29). Imprinting of this locus would be consistent with the chromosomal localization of GNAS1 at 20q13.11 (30), a region showing syntenic homology with the imprinted murine region 2E1–2H3 (31, 32). Indeed, recent studies have demonstrated genomic imprinting of the murine Gnas gene in fetal mouse tissues (33). Interestingly, both maternal and paternal Gnas alleles are expressed in a wide range of tissues, although only the paternal allele is expressed within the renal glomerulus (33). The restricted pattern of tissue- (or cell-) specific imprinting of the Gnas gene in murine embryos at late gestation is consistent with previous studies showing transcription of both GNAS1 gene alleles in tissues from human fetuses (34). In the present study we found that ovarian tissue from patient number 5 contained equivalent amounts of both wild type and mutant Gs{alpha} transcripts (Fig. 3Go), indicating than both GNAS alleles are expressed in the preponderant cell types, i.e. theca and granulosa cells, present in the adult ovary. These results support our clinical findings that levels of LH and FSH are not markedly elevated in women with AHO and are consistent with the hypothesis that ovarian resistance to gonadotropins is incomplete.

We conclude that reproductive dysfunction is common in women with PHP type 1a and likely involves partial resistance to gonadotropins in the granulosa and theca cells of the ovary. The resistance to gonadotropins in women with PHP type 1a is more subtle than the resistance that occurs to some hormones (e.g. PTH, TSH) but is more significant than the resistance that occurs to other hormones (e.g. glucagon, vasopressin). Further studies will likely reveal whether these differences in hormone responsiveness relate to cell-specific differences in the imprinting of the GNAS1 genes.


    Acknowledgments
 
The authors are indebted to the staff of the NIH Clinical Center (8-West) for skillful assistance with the clinical protocols. The authors gratefully acknowledge the assistance of Dr. Norman Beaudry with radioimmunoassays, and we thank Mr. Eric Libre and Mr. Stephen Galt for help with statistical analyses. We are grateful to Dr. Ana Murphy for reviewing the manuscript. Dr. Allen M. Spiegel assisted in the early planning of the study.


    Footnotes
 
1 This work was supported in part by NIH Grants DK-34281 (to M.A.L) and RR-00052 to the Outpatient General Clinical Research Center. Back

Received July 9, 1997.

Revised September 16, 1997.

Accepted November 20, 1997.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Albright F, Burnett CH, Smith PH. 1942 Pseudohypoparathyroidism: an example of "Seabright-Bantam syndrome". Endocrinology. 30:922–932.
  2. Farfel Z, Brickman AS, Kaslow HR, Brothers VM, Bourne HR. 1980 Defect of receptor-cyclase coupling protein in pseudohypoparathyroidism. N Engl J Med. 303:237–242.[Abstract]
  3. Levine MA, Downs Jr RW, Singer Jr MJ, Marx SJ, Aurbach GD, Spiegel AM. 1980 Deficient activity of guanine nucleotide regulatory protein in erythrocytes from patients with pseudohypoparathyroidism. Biochem Biophys Res Commun. 94:1319–1324.[CrossRef][Medline]
  4. Levine MA, Downs Jr RW, Moses AM, et al. 1983 Resistance to multiple hormones in patients with pseudohypoparathyroidism. Association with deficient activity of guanine nucleotide regulatory protein. Am J Med. 74:545–556.[CrossRef][Medline]
  5. Albright F, Forbes AP, Henneman PH. 1952 Pseudopseudohypoparathyroidism. Trans Assoc Am Physicians. 65:337–350.[Medline]
  6. Halal F, Van Dop C, Lord J. 1985 Differential diagnosis in young women with oligmenorrhea and the pseudo-pseudohypoparathyroidism variant of Albright’s hereditary osteodystrophy. Am J Med Genet. 21:551–568.[CrossRef][Medline]
  7. Wolfsdorf JI, Rosenfield RL, Fang VS, et al. 1978 Partial gonadotrophin-resistance in pseudohypoparathyroidism. Acta Endocrinol. 88:321–328.
  8. Faull CM, Welbury RR, Paul B, Kendall Taylor P. 1991 Pseudohypoparathyroidism: its phenotypic variability and associated disorders in a large family. Q J Med. 78:251–264.[Abstract/Free Full Text]
  9. Brody SA, McAtee NM, Wachter KW, Merriam GR, Loriaux DL. 1982 The progression of 24-hour plasma gonadotropin patterns in the normal menstrual cycle: a longitudinal study. Clin Res. 39:684 (Abstract).
  10. Merriam GR, Wachter KW. 1982 Algorithms for the study of episodic hormone secretion. Am J Physiol. 243:E310–318.
  11. Levine MA, Eil C, Downs RW, Jr, Spiegel AM. 1983 Deficient guanine nucleotide regulatory unit activity in cultured fibroblast membranes from patients with pseudohypoparathyroidism type I. A cause of impaired synthesis of 3':5'-cyclic AMP by intact and broken cells. J Clin Invest. 72:316–324.
  12. Harris BA, Robishaw JD, Mumby SM, Gilman AG. 1985 Molecular cloning of complementary DNA for the alpha subunit of the G protein that stimulates adenylate cyclase. Science. 229:1274–1277.[Abstract/Free Full Text]
  13. Levine MA, Jap TS, Mauseth RS, Downs RW, Spiegel AM. 1986 Activity of the stimulatory guanine nucleotide-binding protein is reduced in erythrocytes from patients with pseudohypoparathyroidism and pseudopseudohypoparathyroidism: biochemical, endocrine, and genetic analysis of Albright’s hereditary osteodystrophy in six kindreds. J Clin Endocrinol Metab. 62:497–502.[Abstract/Free Full Text]
  14. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ. 1979 Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry. 18:5294–5299.[CrossRef][Medline]
  15. Kawasaki ES. 1990 Amplification of RNA. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. San Diego: Academic Press; p 21–17.
  16. Saiki RK, Gelfand DH, Stoffel S, et al. 1988 Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239:487–491.[Abstract/Free Full Text]
  17. Miric A, Vechio JD, Levine MA. 1993 Heterogeneous mutations in the gene encoding the alpha subunit of the stimulatory G protein of adenylyl cyclase in Albright hereditary osteodystrophy. J Clin Endocrinol Metab. 76:1560–1568.[Abstract]
  18. Miric A, Levine MA. 1992 Analysis of the preproPTH gene by denaturing gradient gel electrophoresis in familial isolated hypoparathyroidism. J Clin Endocrinol Metab. 74:509–516.[Abstract]
  19. Zhu X, Gilbert S, Birnbaumer M, Birnbaumer L. 1994 Dual signaling potential is common among Gs-coupled receptors and dependent on receptor density. Mol Pharmacol. 46:460–469.[Abstract]
  20. Gudermann T, Birnbaumer M, Birnbaumer L. 1992 Evidence for dual coupling of the murine luteinizing hormone receptor to adenylyl cyclase and phosphoinositide breakdown and Ca2+ mobilization. Studies with the cloned murine luteinizing hormone receptor expressed in L cells. J Biol Chem. 267:4479–4488.[Abstract/Free Full Text]
  21. Gudermann T, Nichols C, Levy FO, Birnbaumer M, Birnbaumer L. 1992 Ca2+ mobilization by the LH receptor expressed in Xenopus oocytes independent of 3',5'-cyclic adenosine monophosphate formation: evidence for parallel activation of two signaling pathways. Mol Endocrinol. 6:272–278.[Abstract/Free Full Text]
  22. Schwindinger WF, Francomano CA, Levine MA. 1992 Identification of a mutation in the gene encoding the alpha subunit of the stimulatory G protein of adenylyl cyclase in McCune-Albright syndrome. Proc Natl Acad Sci USA. 89:5152–5156.[Abstract/Free Full Text]
  23. Weinstein LS, Shenker A, Gejman PV, Merino MJ, Friedman E, Spiegel AM. 1991 Activating mutations of the stimulatory G protein in the McCune-Albright syndrome. N Engl J Med. 325:1688–1695.[Abstract]
  24. Shenker A, Weinstein LS, Moran A, et al. 1993 Severe endocrine and nonendocrine manifestations of the McCune-Albright syndrome associated with activating mutations of stimulatory G protein GS. J Pediatr. 123:509–518.[CrossRef][Medline]
  25. Iiri T, Herzmark P, Nakamoto JM, Van Dop C, Bourne HR. 1994 Rapid GDP release from Gs{alpha} in patients with gain and loss of function. Nature. 371:164–168.[CrossRef][Medline]
  26. Levine MA, Ahn TG, Klupt SF, et al. 1988 Genetic deficiency of the alpha subunit of the guanine nucleotide-binding protein Gs as the molecular basis for Albright hereditary osteodystrophy. Proc Natl Acad Sci USA. 85:617–621.[Abstract/Free Full Text]
  27. Wilson LC, Oude Luttikhuis ME, Clayton PT, Fraser WD, Trembath RC. 1994 Parental origin of Gs alpha gene mutations in Albright’s hereditary osteodystrophy. J Med Genet. 31:835–839.[Abstract/Free Full Text]
  28. Davies SJ, Hughes HE. 1993 Imprinting in Albright’s hereditary osteodystrophy. J Med Genet. 30:101–103.[Abstract/Free Full Text]
  29. Wilson LC, Trembath RC. 1994 Albright’s hereditary osteodystrophy. (Review). J Med Genet. 31:779–784.[Free Full Text]
  30. Levine MA, Modi WS, O’Brien SJ. 1991 Mapping of the gene encoding the alpha subunit of the stimulatory G protein of adenylyl cyclase (GNAS1) to 20q13.2->q13.3 in human by in situ hybridization. Genomics. 11:478–479.[Medline]
  31. Cattanach BM, Kirk M. 1985 Differential activity of maternally and paternally derived chromosome regions in mice. Nature. 315:496–498.[CrossRef][Medline]
  32. Cattanach BM, Beechey CV. 1990 Autosomal and X-chromosome imprinting. Development Suppl:63–72.
  33. Williamson CM, Schofield J, Dutton ER, et al. 1996 Glomerular-specific imprinting of the mouse Gs{alpha} gene: How does this relate to hormone resistance in Albright hereditary osteodystrophy? Genomics. 36:280–287.[CrossRef][Medline]
  34. Campbell R, Gosden CM, Bonthron DT. 1994 Parental origin of transcription from the human GNAS1 gene. J Med Genet. 31:607–614.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Eur J EndocrinolHome page
A.-S. Balavoine, M. Ladsous, F.-L. Velayoudom, V. Vlaeminck, C. Cardot-Bauters, M. d'Herbomez, and J.-L. Wemeau
Hypothyroidism in patients with pseudohypoparathyroidism type Ia: clinical evidence of resistance to TSH and TRH
Eur. J. Endocrinol., October 1, 2008; 159(4): 431 - 437.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
S. Krechowec and A. Plagge
Physiological Dysfunctions Associated with Mutations of the Imprinted Gnas Locus
Physiology, August 1, 2008; 23(4): 221 - 229.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
A. Plagge, G. Kelsey, and E. L Germain-Lee
Physiological functions of the imprinted Gnas locus and its protein variants G{alpha}s and XL{alpha}s in human and mouse
J. Endocrinol., February 1, 2008; 196(2): 193 - 214.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. L. Germain-Lee, W. Schwindinger, J. L. Crane, R. Zewdu, L. S. Zweifel, G. Wand, D. L. Huso, M. Saji, M. D. Ringel, and M. A. Levine
A Mouse Model of Albright Hereditary Osteodystrophy Generated by Targeted Disruption of Exon 1 of the Gnas Gene
Endocrinology, November 1, 2005; 146(11): 4697 - 4709.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. Liu, B. Erlichman, and L. S. Weinstein
The Stimulatory G Protein {alpha}-Subunit Gs{alpha} Is Imprinted in Human Thyroid Glands: Implications for Thyroid Function in Pseudohypoparathyroidism Types 1A and 1B
J. Clin. Endocrinol. Metab., September 1, 2003; 88(9): 4336 - 4341.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Linglart, J. C. Carel, M. Garabedian, T. Le, E. Mallet, and M. L. Kottler
GNAS1 Lesions in Pseudohypoparathyroidism Ia and Ic: Genotype Phenotype Relationship and Evidence of the Maternal Transmission of the Hormonal Resistance
J. Clin. Endocrinol. Metab., January 1, 2002; 87(1): 189 - 197.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
L. S. Weinstein, S. Yu, D. R. Warner, and J. Liu
Endocrine Manifestations of Stimulatory G Protein {alpha}-Subunit Mutations and the Role of Genomic Imprinting
Endocr. Rev., October 1, 2001; 22(5): 675 - 705.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W.-I. Wu, W. F. Schwindinger, L. F. Aparicio, and M. A. Levine
Selective Resistance to Parathyroid Hormone Caused by a Novel Uncoupling Mutation in the Carboxyl Terminus of Galpha s. A CAUSE OF PSEUDOHYPOPARATHYROIDISM TYPE Ib
J. Biol. Chem., January 5, 2001; 276(1): 165 - 171.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Namnoum, A. B.
Right arrow Articles by Levine, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Namnoum, A. B.
Right arrow Articles by Levine, M. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals