| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
From the Clinical Research Centers |
Departments of Gynecology and Obstetrics (A.B.N.) and Medicine (M.A.L.), The Johns Hopkins University School of Medicine, Baltimore, Maryland 21287; VA Puget Sound Health Care System and Divisions of Metabolism, Endocrinology and Nutrition, and Reproductive Endocrinology, University of Washington, Seattle, Washington 98195 (G.R.M.); Department of Medicine (A.M.M.), the State University Hospital, Syracuse, New York 13210
Address all correspondence and requests for reprints to: Michael A. Levine, M.D., Division of Endocrinology and Metabolism, The Johns Hopkins University School of Medicine, 863 Ross Research Building, 720 Rutland Avenue, Baltimore, Maryland 21205. E-mail: mlevine{at}welchlink.welch.jhu.edu
 |
Abstract |
|---|
 Top Abstract IntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
, the alpha
subunit of the guanine nucleotide binding protein that stimulates
adenylyl cyclase, and are resistant to parathyroid hormone (PTH) and
other hormones that act via stimulation of adenylyl cyclase. To
determine the incidence and etiology of ovarian dysfunction in women
with AHO, we examined the reproductive history and
hypothalamic-pituitary-ovarian axis in 17 affected women aged 17–43
yr. All patients had typical PTH resistance and an approximately 50%
reduction in erythrocyte Gs activity. (0.43 ± 0.03
vs. 0.92 ± 0.08 for normal control subjects,
P < 0.001). Fourteen of the 17 patients (76%)
were oligomenorrheic or amenorrheic, more than half had delayed or
incomplete sexual development, and only two had a history of earlier
pregnancy. Most women were mildly hypoestrogenic, with normal to
slightly elevated serum gonadotropin levels. Computer analysis of 24°
LH measurement showed that the frequency of LH peaks/24 h in AHO women
varied widely, but as a group they were not statistically different
from a group of normal women studied in the early follicular phase.
Administration of 100 µg synthetic GnRH produced normal FSH and LH
responses. We conclude that reproductive dysfunction is common in women
with AHO and probably represents partial resistance to gonadotropins. |
Introduction |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
subunit of the guanine
nucleotide regulatory protein (Gs) that stimulates
adenylyl cyclase (2, 3). In addition, most patients with AHO show
resistance to multiple hormones (e.g. parathyroid hormone,
thyroid stimulating hormone, and glucagon) that bind to receptors that
require Gs for activation of adenylyl cyclase (AC). This
condition has been termed pseudohypoparathyroidism type 1a (PHP 1a)
(4). By contrast, some affected subjects appear to have normal
endocrine responsiveness despite Gs deficiency, a
condition that has been termed pseudopseudohypoparathyroidism (PPHP)
(5). Although several case reports and clinical studies (4, 6, 7) have alluded to menstrual irregularities and hypogonadism in women with AHO, the cause and significance of female reproductive dysfunction in AHO remains unknown. If the basis of hypogonadism is ovarian resistance to stimulation by follicle stimulating hormone (FSH) and luteinizing hormone (LH), similar to the target tissue resistance to PTH and TSH, one would expect the clinical picture of hypogonadism to be accompanied by elevated levels of plasma gonadotropins. This mechanism is supported by the description by Wolfsdorf et al. (7) of a woman with AHO and PHP type 1a who was oligomenorrheic and had elevated basal levels of gonadotropins. By contrast, other reports have described women with AHO who have ovarian dysfunction and apparently normal gonadotropin levels (8). To determine the incidence, mechanism, and natural history of reproductive dysfunction in women with AHO, we evaluated the reproductive history and hypothalamic-pituitary-ovarian axis in women with AHO and PHP type 1a.
|
Subjects and Methods |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Seventeen women (aged 17–43 yr) with PHP type 1a were
evaluated, but some women did not undergo all tests. All met criteria
for AHO including brachydactyly, unilateral or bilateral, involving
hands or feet, short stature, and decreased Gs activity.
Subcutaneous ossifications were present in 11 of the women. All of the
women were normocalcemic on vitamin D and calcium supplementation, and
all were euthyroid at the time of testing. The control group consisted
of 13 normal adult women who had regular menstrual cycles. Menstrual
histories, Tanner developmental stages, and peripheral blood cell
karyotypes were obtained. Body mass index (BMI) was derived from
measurements of height and weight. Clinical information including
menstrual history, pregnancy history, and history of hormonal use was
obtained for the period of time up to 10 yr after the initial studies.
Written informed consent was obtained from all patients and
controls.
Hormone assays
Basal plasma levels of reproductive hormones were determined by radioimmunoassay (Hazelton Laboratories, Vienna, VA), including estradiol (E2), progesterone (P), prolactin, LH, FSH, 17-hydroxy progesterone, testosterone, androstenedione, and dehydroepiandrosterone. In women with regular menses, blood samples were obtained during the early follicular phase of the cycle. As it was not possible to determine the phase of the cycle in oligomenorrheic or amenorrheic women, blood samples were drawn randomly in these women. In some women, pelvic ultrasonographic examination was performed to evaluate ovarian structure and size.
LH pulsatility
Eleven women had blood samples drawn from an indwelling catheter at 20-min intervals during a 24-h period for gonadotropin measurement and analysis of LH pulsatility. Testing was conducted at the Clinical Center of the National Institutes of Health. The pattern of LH peaks was analyzed with the Pulsar program (Pharmacia Peptide Hormones, Stockholm, Sweden), which scores LH peaks by height and duration from a smoothed local baseline, using the dose-dependent radioimmunoassay variance as a scale factor (9, 10). For these studies cutoffs were 3.8, 2.6, 1.9, 1.5, and 1.2 SD for peaks 1–5 points in duration, respectively. The intrassay coefficient of variation for LH measurements averaged 5.3% over the range of values studied. Results were compared with those obtained from a group of normally cycling women sampled at the same frequency who were studied in the early- to mid-follicular phase.
Provocative tests
Eight patients underwent gonadotropin releasing hormone (GnRH) stimulation tests with 100 µg synthetic GnRH. Samples were drawn at 0, 15, 30, 60, and 120 min for measurement of LH and FSH levels. In some patients, progestin-induced withdrawal bleeding was tested by the administration of a single intramuscular injection of progesterone in oil (200 mg). In other patients, medroxyprogesterone (5 mg) was given daily for the last 10 days of a month in which they also took estrogen (e.g. conjugated equine estrogens 0.625 mg) daily. The onset of uterine bleeding within 10 days of administration of progestin was considered evidence of a positive response.
Determination of erythrocyte Gs Activity
The biological activity of Gs was determined
using a complementation assay (3, 11) based on the ability of
solubilized extracts of erythrocyte membranes to reconstitute the
responsiveness of adenylyl cyclase in membranes prepared from S49
cyc- murine lymphoma cells, which genetically lack
Gs protein (12). Blood was obtained from patients and
from control subjects by venipuncture and anticoagulated with acid
citrate dextrose. Erythrocyte membranes were prepared as previously
described (3), and soluble extracts were obtained by treatment with
0.2% (wt/vol) Lubrol PX (ICN Biomedicals, Aurora, OH).
Soluble extracts were assayed for Gs activity using S49
cyc- membranes, essentially as previously described (13).
The assay for Gs activity is linear with respect to the
amount of extract protein added. Results of assays were expressed as a
percentage of the activity of a standard membrane preparation
consisting of pooled erythrocytes from five normal persons, and they
represent the mean of at least three separate determinations.
Ovarian histology and Gs messenger RNA (mRNA)
analysis
One patient who underwent total abdominal hysterectomy and
bilateral salpingo-oophorectomy for unrelated reasons had ovarian
tissue submitted for histological evaluation and Gs mRNA
analysis. Total cellular RNA was isolated from ovarian tissue by the
guanidinium isothiocyanate-cesium chloride technique (14). First-strand
complementary DNA (cDNA) was synthesized from 5 µg RNA in a 20-µL
reaction mixture containing 100 pmol of random hexamer primers and 200
units Moloney murine leukemia virus reverse transcriptase (BRL,
Gaithersburg, MD) (15). Aliquots of cDNA served as templates for
in vitro amplification by PCR (16), in patient 5, of a 600
bp fragment of Gs cDNA using synthetic oligonucleotides
that flank the known GNAS1 missense mutation (R165C) (17). The primers
were designed using the MELTMAP 87 program (generously provided by Dr.
L. S. Lerman, MIT, Cambridge, MA) to optimize analysis by
denaturing gel electrophoresis (DGGE); to increase the sensitivity of
DGGE one oligonucleotide of the pair was synthesized with a 5' GC-rich
clamp. Oligonucleotide primers were synthesized by phosphoramidite
chemistry, using a Milligen/Biosearch Cyclone Plus DNA Synthesizer
(Burlington, MA). Reactions contained 3 µL first-strand cDNA in 10
mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5
mM MgCl2, 0.01% gelatin, 0.5 µM
of each primer(sense primer located in exon 5,
5'GACTTCCCTCCCGAATTCTATGAG; antisense primer located in exon 9,
5'GCGCCCGGCGCCGCCCGCCGGCGCGGCCCGCCCGCGGG-CGAAGCACTGGATCCACTTGCGGCG),
0.25 mM each dATP, dCTP, dGTP, dTTP, and 2.0 units of
Taq polymerase (Perkin Elmer-Cetus Corp., Norwalk, CT).
After an initial denaturation for 4 min at 94 C, the samples underwent
40 amplification cycles consisting of denaturation for 1 min at 94 C,
annealing for 1 min at 55 C, and extension for 2 min at 72 C, with a
final extension of 10 min.
Amplified DNA samples were analyzed by DGGE as previously described (17, 18). Briefly, samples (15–30 µL) were electrophoresed at 60 C for 16 h at 85 volts in 6.5% polyacrylamide gels containing a denaturant gradient (40–80%) parallel to the direction of electrophoresis (100% denaturant = 7 M urea and 40% formamide). After electrophoresis, gels were stained with ethidium bromide (1 µg/mL) and photographed by UV transillumination with Polaroid type-55 film (Rochester, NY).
Statistical analysis
Data were analyzed with the Student t test for unpaired samples. The 95% confidence interval was used for testing significance. Unless otherwise stated, results are expressed as mean ± 1 SD.
|
Results |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
levels and clinical profiles
Patients with PHP type 1a had a reduction of approximately 50% in
erythrocyte Gs activity (0.43 ± 0.03
vs. 0.92 ± 0.08 P < 0.001) (Table 1
). There was no relationship between the
level of Gs activity and any clinical or reproductive
endocrine parameters.
|
). Four of these women
had regular menses, 4 had primary amenorrhea, 1 had secondary
amenorrhea, and 8 had oligomenorrhea. Two of the women with
oligomenorrhea had prior pregnancies. Physical examination revealed
incomplete development of secondary sexual characteristics (Tanner
III-IV) in the majority of patients. Mild hirsutism was noted in 3
patients. The mean height was 145 cm, the mean weight was 66.6 kg, and
the mean BMI was 31.7.
|
Basal hormonal profile
Mean basal hormone levels in the PHP type 1a patients are
presented in Table 1
. Plasma estradiol levels were less than 50 pg/mL
in 14 of the 17 women, similar to levels present during the normal
early follicular phase. Plasma concentrations of progesterone were low,
similar to levels present in the follicular phase, in all patients.
Serum concentrations of gonadotropins FSH and LH were normal to
slightly elevated. Prolactin levels were normal in all except patient
number 14, whose prolactin level was minimally elevated. Serum
concentrations of androgens were normal in all women tested.
Because of dysfunctional uterine bleeding, patient number 5 later underwent hysterectomy with bilateral salpingo-oophorectomy and subsequently developed markedly elevated levels of serum gonadotropins that were appropriate for a postmenopausal female.
LH Pulsatility
Pulsar analysis of plasma LH values obtained during the 24-h
sampling (Table 1) showed that the frequency of LH peaks per 24° in
the PHP type 1A group was not statistically different from that of a
group of normal women studied in the early follicular phase. (11.8
± 4.9 vs. 12 ± 5.2). Some women, however, had high
(subjects 2, 3, and 10) or low (subjects 1 and 11) pulse
frequencies.
GnRH stimulation tests
LH responses (Fig. 1) and FSH
responses (Fig. 2) to GnRH stimulation
were similar to controls, with the exception of patient number 4, who
was perimenopausal. However, given that the AHO patients were
hypoestrogenic at the time of testing, these responses may
underestimate responsiveness of the pituitary to GnRH.
|
|
mRNA expressionGross examination and histological analysis of the resected ovarian tissue from patient number 5 revealed multiple follicular cysts that measured up to 1 cm. Several atretic scars were present, but no corpora lutea were identified.
PCR-amplified Gs cDNA synthesized from ovarian mRNA was
analyzed by denaturing gradient gel electrophoresis and showed an
abnormal pattern. In addition to a DNA fragment corresponding to a wild
type Gs allele, a more slowly migrating fragment that
contained an R165C missense mutation (1072) was also observed (Fig. 3). The two, more slowly migrating DNA
fragments represent heteroduplexes formed between normal and abnormal
DNA strands during PCR.
|
Long-term information on reproductive function was obtained from eight women, with a mean follow-up length of 8.6 yr. All women who had regular menses at the time of the initial study continued to have regular menses. Most women with 1° amenorrhea continued to be amenorrheic, but one woman reported the spontaneous onset of menses at age 28. Women with 2° amenorrhea and oligomenorrhea remained amenorrheic or had occasional spontaneous menses. None of these eight women had subsequent pregnancies despite unprotected intercourse. Estrogen and/or progestin therapy was given to approximately half of the women. Most patients had a weak response or no response to progestin withdrawal unless estrogen was also given.
|
Discussion |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
(22, 23), commonly have precocious
puberty as well as autonomous hyperfunction of other endocrine glands
(24). Iiri et al. (25) recently described two males with
both precocious puberty and PHP type 1a. These two unrelated boys had
identical GNAS1 gene mutations that resulted in a temperature-sensitive
Gs that is constitutively activated in the cooler
environment of the testis, while being rapidly degraded in other
tissues at normal body temperature. These studies indicate that gonadal
function is highly influenced by the activity of Gs.
Deficient activity of Gs also has profound effects on
reproductive function. In our series, three fourths of the AHO females
with Gs deficiency (PHP type 1a) were oligomenorrheic or
amenorrheic, and 9 out of 12 had delayed puberty or incomplete sexual
development. Reproductive dysfunction in these patients was not
complete, however; some women had normal menstrual cycles, and two
women with irregular menses had had full-term pregnancies in the
past.
If ovarian dysfunction occurs via a mechanism of hormone resistance
that is similar to that which accounts for TSH and PTH resistance in
the thyroid and kidney, respectively, decreased secretion of estrogen
would be expected to be accompanied by elevated gonadotropin levels, as
in the single AHO patient described by Wolfsdorf et al. (7),
and subsequently shown by us to have Gs deficiency
(patient 2b, ref 26). Therefore, we were surprised that serum
gonadotropin levels were either normal or only slightly elevated in the
women in our study, despite the fact that most of them were
hypoestrogenic, as confirmed by scant or absent withdrawal bleeding
after progestin administration. Although these results are consistent
with a pattern of chronic anovulation of central etiology, several
lines of evidence argue against this mechanism as the primary basis for
reproductive dysfunction. First, most patients showed normal or
increased LH pulsatility. Second, serum levels of gonadotropins were
appropriately elevated in AHO females who were perimenopausal (patient
4) or postmenopausal (patient 5). Third, GnRH receptors are not
directly coupled to the cAMP pathway, and thus a deficiency of
Gs should not have a significant effect on GnRH
responsiveness. One mechanism to explain these clinical and biochemical
findings is partial resistance of the theca and granulosa cells of the
ovary to gonadotropins due to deficient Gs activity. We
found that one half of the Gs mRNA in ovarian tissue
from patient 5 was transcribed from the defective GNAS1 gene,
consistent with a 50% reduction in levels of Gs protein
(not shown). Because both LH and FSH receptors are coupled to
Gs in the ovary, deficient expression or activity of
Gs might lead to a state of partial responsiveness to
gonadotropins. Responsiveness might be sufficient to promote some
degree of follicular development and steroid secretion, but might be
insufficient to induce ovulation. Specifically, the estradiol levels
may be adequate to exert negative feedback on gonadotropins (resulting
in normal to slightly elevated gonadotropin levels), but may be
inadequate to trigger the midcycle LH surge (i.e. positive
feedback). Sonographic and histological findings of limited follicular
development in these patients support this hypothesis.
Further evidence in support of the premise that partial ovarian
resistance occurs in AHO is provided by the patient described by
Wolfsdorf et al. (7), who was treated in order to induce
ovulation. Administration of clomiphene citrate failed to induce
ovulation, as might be expected in a hypoestrogenic patient. Despite
elevated basal levels of FSH and LH, administration of human menopausal
gonadotropins (hMG) stimulated an appropriate rise in serum estradiol
to more than 500 pg/mL, indicating that, in at least some cases,
partial ovarian resistance can be overcome by very high levels of
gonadotropins. Despite the notable differences in basal gonadotropin
levels between the patient described by Wolfsdorf et al. (7)
and the patients we have described in this study, the similar molecular
pathophysiology of Gs deficiency in all these patients
implicates a common mechanism of reproductive dysfunction.
Reduced expression or function of Gs likely accounts for
hormone resistance and reproductive dysfunction in women with PHP type
1a. By contrast, reproductive function is generally normal in women
with pseudoPHP despite Gs deficiency and GNAS1
mutations, which are indistinguishable from relatives with PHP type 1a.
The basis for variable penetrance of hormone resistance in AHO is
unknown. The observation that maternal transmission of
Gs deficiency leads to PHP type Ia, whereas paternal
transmission of the defect leads to pseudoPHP (13, 27, 28), has
implicated paternal imprinting as a possible explanation for the
different phenotypes of identical GNAS1 gene defects (28, 29).
Imprinting of this locus would be consistent with the chromosomal
localization of GNAS1 at 20q13.11 (30), a region showing syntenic
homology with the imprinted murine region 2E1–2H3 (31, 32). Indeed,
recent studies have demonstrated genomic imprinting of the murine
Gnas gene in fetal mouse tissues (33). Interestingly, both
maternal and paternal Gnas alleles are expressed in a wide
range of tissues, although only the paternal allele is expressed within
the renal glomerulus (33). The restricted pattern of tissue- (or cell-)
specific imprinting of the Gnas gene in murine embryos at
late gestation is consistent with previous studies showing
transcription of both GNAS1 gene alleles in tissues from human fetuses
(34). In the present study we found that ovarian tissue from patient
number 5 contained equivalent amounts of both wild type and mutant
Gs transcripts (Fig. 3), indicating than both GNAS
alleles are expressed in the preponderant cell types, i.e.
theca and granulosa cells, present in the adult ovary. These results
support our clinical findings that levels of LH and FSH are not
markedly elevated in women with AHO and are consistent with the
hypothesis that ovarian resistance to gonadotropins is incomplete.
We conclude that reproductive dysfunction is common in women with PHP type 1a and likely involves partial resistance to gonadotropins in the granulosa and theca cells of the ovary. The resistance to gonadotropins in women with PHP type 1a is more subtle than the resistance that occurs to some hormones (e.g. PTH, TSH) but is more significant than the resistance that occurs to other hormones (e.g. glucagon, vasopressin). Further studies will likely reveal whether these differences in hormone responsiveness relate to cell-specific differences in the imprinting of the GNAS1 genes.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received July 9, 1997.
Revised September 16, 1997.
Accepted November 20, 1997.
|
References |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
in patients with gain and
loss of function. Nature. 371:164–168.[CrossRef][Medline]
q13.3 in human by in
situ hybridization. Genomics. 11:478–479.[Medline]
gene: How does this
relate to hormone resistance in Albright hereditary osteodystrophy? Genomics. 36:280–287.[CrossRef][Medline]
This article has been cited by other articles:
 |
|
 |
|
  A.-S. Balavoine, M. Ladsous, F.-L. Velayoudom, V. Vlaeminck, C. Cardot-Bauters, M. d'Herbomez, and J.-L. Wemeau Hypothyroidism in patients with pseudohypoparathyroidism type Ia: clinical evidence of resistance to TSH and TRH Eur. J. Endocrinol., October 1, 2008; 159(4): 431 - 437. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Krechowec and A. Plagge Physiological Dysfunctions Associated with Mutations of the Imprinted Gnas Locus Physiology, August 1, 2008; 23(4): 221 - 229. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Plagge, G. Kelsey, and E. L Germain-Lee Physiological functions of the imprinted Gnas locus and its protein variants G{alpha}s and XL{alpha}s in human and mouse J. Endocrinol., February 1, 2008; 196(2): 193 - 214. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. L. Germain-Lee, W. Schwindinger, J. L. Crane, R. Zewdu, L. S. Zweifel, G. Wand, D. L. Huso, M. Saji, M. D. Ringel, and M. A. Levine A Mouse Model of Albright Hereditary Osteodystrophy Generated by Targeted Disruption of Exon 1 of the Gnas Gene Endocrinology, November 1, 2005; 146(11): 4697 - 4709. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Liu, B. Erlichman, and L. S. Weinstein The Stimulatory G Protein {alpha}-Subunit Gs{alpha} Is Imprinted in Human Thyroid Glands: Implications for Thyroid Function in Pseudohypoparathyroidism Types 1A and 1B J. Clin. Endocrinol. Metab., September 1, 2003; 88(9): 4336 - 4341. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Linglart, J. C. Carel, M. Garabedian, T. Le, E. Mallet, and M. L. Kottler GNAS1 Lesions in Pseudohypoparathyroidism Ia and Ic: Genotype Phenotype Relationship and Evidence of the Maternal Transmission of the Hormonal Resistance J. Clin. Endocrinol. Metab., January 1, 2002; 87(1): 189 - 197. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. S. Weinstein, S. Yu, D. R. Warner, and J. Liu Endocrine Manifestations of Stimulatory G Protein {alpha}-Subunit Mutations and the Role of Genomic Imprinting Endocr. Rev., October 1, 2001; 22(5): 675 - 705. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W.-I. Wu, W. F. Schwindinger, L. F. Aparicio, and M. A. Levine Selective Resistance to Parathyroid Hormone Caused by a Novel Uncoupling Mutation in the Carboxyl Terminus of Galpha s. A CAUSE OF PSEUDOHYPOPARATHYROIDISM TYPE Ib J. Biol. Chem., January 5, 2001; 276(1): 165 - 171. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
