| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Istituto di Endocrinologia (M.T., L.C., A.P., P.A., E.F., F.C., R.R., P.V.), Dipartimento di Oncologia Sezione di Anatomia Patologica (P.V.), and Dipartimento di Clinica Chirurgica (P.M.), Università di Pisa, Pisa, Italy
Address all correspondence and requests for reprints to: Massimo Tonacchera, Istituto di Endocrinologia, Università degli Studi di Pisa, Via Paradisa 2, 56124, Cisanello, Pisa.
 |
Abstract |
|---|
 Top Abstract IntroductionPatients and MethodsResultsDiscussionAddendumReferences |
|---|
Six patients with a single hot nodule within a multinodular goiter and 11 patients with toxic thyroid adenoma were enrolled in our study. At histology five hyperfunctioning nodules in multinodular goiters showed the features of adenomas, and one was identified as a hyperplastic nodule. The entire exon 10 of the TSH receptor gene was directly sequenced after PCR amplification from genomic DNA obtained from surgical specimens. Functional studies of mutated receptors were performed in COS-7 cells.
Five out of 6 (83%) hyperfunctioning nodules within toxic multinodular goiters harbored a TSH receptor mutation. A TSH receptor mutation was also evident in the hyperfunctioning nodule that at histology had the features of noncapsulated hyperplastic nodule. Among toxic adenomas, 8 out of 11 (72%) nodules harbored a TSH receptor mutation. All the mutations were heterozygotic and somatic. Nonfunctioning nodules, whether adenomas or hyperplastic nodules present in association with hyperfunctioning nodules in the same multinodular goiters, had no TSH receptor mutation. All the mutations identified had constitutive activity as assessed by cAMP production after expression in COS-7 cells.
Hyperfunctioning thyroid nodules in multinodular goiters recognize the same pathogenetic event (TSH receptor mutation) as toxic adenoma. Other mechanisms are implicated in the growth of nonfunctioning thyroid nodules coexistent in the same gland.
|
Introduction |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionAddendumReferences |
|---|
Recently, somatic gain-of-function mutations of the TSH receptor (TSHr) gene have been identified as a cause of toxic adenoma (4, 5, 6, 7, 8, 9, 10), although controversy still exists about the frequency of such mutations in this condition. The majority of hot nodules in 11 patients with toxic adenoma were found to harbor an activating TSHr mutation by Parma et al. (4, 6). Subsequent studies by other groups reported a lower frequency of TSHr mutations in toxic adenoma ranging from 3% (8) to 20% (9, 10, 11). The pathogenesis of hyperfunctioning nodules in toxic multinodular goiter has not been investigated at the molecular level and, to our knowledge, no data on TSHr mutations in this condition are available.
The aim of the present study was to search for activating TSHr mutations in hyperfunctioning thyroid nodules arising in toxic multinodular goiters of patients living in an area of iodine deficiency. Patients with well-defined single hyperfunctioning nodules within a toxic multinodular goiter were selected. The frequency of TSHr mutations was also studied in patients with solitary toxic adenoma living in the same area. TSHr mutations were identified by direct sequencing of the entire exon 10 of the TSHr gene after PCR amplification of genomic DNA obtained from surgical specimens.
Our results indicate that activating TSHr mutations occur in the majority of hyperfunctioning nodules within toxic multinodular goiters and suggest that, similar to toxic adenoma, gain-of-function TSHr mutations are responsible for the genesis of hyperfunctioning nodules in multinodular goiters. No TSHr mutation was identified in adenomatous or hyperplastic nonfunctioning nodules contained in the same gland. A new, not previously described TSHr mutation, was identified in a hyperfunctioning nodule of a patient with multinodular goiter.
|
Patients and Methods |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionAddendumReferences |
|---|
Included in this study were 17 patients who were submitted to surgery. Eleven of them had toxic adenoma and 6 had toxic multinodular goiter. Lobectomy was performed in patients with toxic adenoma and subtotal or near total thyroidectomy in those with toxic multinodular goiter. At the time of diagnosis, all patients were clinically thyrotoxic with high free T4 (FT4) and FT3 concentrations and undetectable serum TSH by a sensitive method. Thyroid autoimmunity was excluded for the absence of circulating antithyroglobulin, antithyroperoxidase, and anti-TSHr antibodies. Thyroid glands were studied by clinical examination, thyroid ultrasound, scintiscan imaging using 131I, and histology. All patients were prepared before surgery with methimazole and iodide.
Classification of disease
Thyroid diseases were classified according to the following criteria.
Toxic adenoma. Cases of toxic adenoma had 1) a solitary nodule in an otherwise normal thyroid gland as assessed by palpation and thyroid ultrasound; 2) exclusive 131I uptake in the nodule (hot nodule) with suppression of the extranodular parenchyma at thyroid scintiscan; and 3) a well-circumscribed lesion surrounded by a fibrous capsule at histology.
Toxic multinodular goiter. Cases of toxic multinodular goiter had 1) an enlarged thyroid gland with two or more nodules as assessed by palpation and thyroid ultrasound; 2) exclusive 131I uptake in one nodule with functional suppression of the extranodular tissue and coexistent nonfunctioning nodules; and 3) multinodular goiter at histology.
Age, sex, and the findings at thyroid ultrasound in patients with toxic
adenoma or toxic multinodular goiter are shown in Tables 1
and 2,
respectively. Functioning and nonfunctioning thyroid nodules were
identified by matching the ultrasound and thyroid scintigraphy and were
carefully isolated during surgery from the surrounding tissue. Four
patients had two or more nonfunctioning nodules each; the remaining two
had only one nonfunctioning nodule each. At microscopic examination,
all solitary toxic adenomas were well defined tumors surrounded by a
complete thin fibrous capsule with compression of the adjacent tissue.
All toxic adenomas exhibited a micro-macrofollicular architecture with
occasional foci of necrosis, hemorrhage, and cystic changes. A diffuse
oxyphil pattern was observed in one case of toxic adenoma.
|
|
Thyroid ultrasound
Ultrasound evaluation was performed by the same examiner using a linear transducer (7.5 MHz) attached to a real-time instrument (AU 590 Asynchronous Apparatus, Esaote Biomedica, Milan, Italy). Patients were examined in the supine position with the neck hyperextended. Thyroid volume was calculated according to the formula of the ellipsoid model (12): width (mm) x length (mm) x thickness (mm) x 0,52 x each lobe = volume (mL). The thyroid volume used as the normal reference value, obtained by measurements of 130 adult healthy individuals (65 males and 65 females) residing in urban areas with sufficient iodine intake of the same region, was 11.3 ± 3.4 mL in males and 8.6 ± 2.2 mL in females.
Laboratory evaluation of thyroid function
FT4 and FT3 were measured by RIA (Lysophase, Technogenetics SpA, Milan, Italy). Thyrotropin was assessed with a sensitive method (sensitive-TSH IRMA, Delfia, Wallac, Finland). Antithyroperoxidase and antithyroglobulin antibodies were measured by passive agglutination (SERODIA-AMC and SERODIA-ATG, Fujirebio, Tokyo, Japan). TSHr antibodies were measured using a commercial radioreceptor assay (TRAK assay, B.R.A.H.M.S., Berlin, Germany).
Sequence determination
Genomic DNA was extracted from hyperfunctioning and nonfunctioning thyroid nodules and from the normal extranodular tissue, as previously described (6, 13). We sequenced the entire portion of the C-terminal region of the TSHr gene coding for all seven transmembrane segments, and extracellular and intracellular loops codified by exon 10. At least two different PCR amplifications from genomic DNA were sequenced on double strands with sense and antisense primers.
Two fragments encompassing the entire exon 10 of the TSHr gene were amplified by PCR and subjected to direct sequencing (13). Fragment A, positions 942-1960; forward primer: 5' TGTGAATGCCTTGAATAGCC 3'; reverse primer 5' AACAGCTATGACCATGTGAGAGGCTTGTTCAGAATT 3'. Fragment B, positions 1746–2204; forward primer: 5' TGTAAAACGACGGCCAGTTATTGTTTTTGTTCTGACGC 3'; reverse primer: 5' ATGTTGTGGAGACCCTGCCT 3'.
Underlined sequences correspond to the M13 sequencing
primer. Primer containing the M13 sequences were biotinylated. PCR was
performed in a final volume of 100 µL containing 1 µg DNA, 50
mM KCl, 10 mM Tris-Cl, pH 8.3, 1.5
mM MgCl2, 0.01% gelatin, 0.2 mM
deoxynucleotide triphosphate, 5 U Taq polymerase (Gibco BRL,
Life Technologies, Gaithersburg, MD) and 150 nM (for
fragment A) or 200 nM (for fragment B) of each primer.
Annealing temperature was 50 C and 54 C for fragments A and B,
respectively. PCR products were purified on streptavidin-coated
magnetic beads (Dynal, Oslo, Norway) and sequenced with Sequenase
(version 2, United States Biological, Cleveland, OH) (14) and
35S-labeled deoxyadenosine ATP-
S (Amersham,
Buckingamshire, UK). No other coding region of the gene was sequenced.
To confirm the presence of a TSHr mutation, all mutations were
subcloned in a plasmid, and sequences were repeated on individual
clones.
Contamination problems were ruled out by including PCR control samples with no DNA as template. Extraction of DNA and pre-PCR reactions were performed in different rooms with respect to post-PCR reactions.
Construction and expression of mutated genes
pSVL-TSHr constructs harboring mutations D619G, A623V, L629F, I630L, T632I, D633E, and P639S were obtained by replacing, within the original wild-type construct (wtTSHr), a CvnI-BstEII segment (positions 1604–2169) directly amplified from genomic DNA of affected patients. This mutated segment was obtained as previously described (4, 5). To facilitate the insertion in a pSVL-based construct of I486M, a unique SpeI restriction site within the sequence encoding the end of transmembrane segment I of wtTSHr was created as described in Parma et al. (6). Constructs containing the mutant TSHr sequences were obtained by replacing a SpeI-CvnI segment (positions 1322–1603) from this new construct by the corresponding segments of the mutants, obtained by direct PCR amplification of genomic DNA. The sequences of the resulting mutated constructs were verified by double-stranded sequencing.
COS-7 cells transfected with wild type, and mutated receptors were used for binding studies and cAMP determination. COS-7 cells were grown in DMEM supplemented with 10% FBS, 100 IU mL-1 penicillin, 100 µg mL-1 streptomycin, 2.5 µg mL-1 fungizone, and 1 mM sodium pyruvate. For the transient expression of mutated TSHrs, COS-7 cells were seeded at the concentration of 150,000 cells/3-cm dish. One day after seeding, cells were transfected using the diethylaminoethyl (DEAE)-Dextran method followed by a 2-min 10% dimethylsulfoxide shock.
Functional assays
Forty-eights hours after transfection, cells were used for cAMP production assay and 125I TSH binding studies. All experiments were performed in triplicate, and each experiment was repeated at least three times. Results were expressed as mean ± SE.
cAMP assay production. Cells were washed with hypotonic medium (HBSS without NaCl) and preincubated in the same buffer for 30 min at 37 C. This was followed by a 1-h incubation at 37 C in the presence of 0.5 mM isobutylmethylxantine (IBMX), as a cAMP phosphodiesterase inhibitor, in the absence of bovine TSH (bTSH). Extracellular cAMP was measured in the medium collected at the end of the incubation by an in-house RIA method using a commercial polyclonal anti-cAMP antibody, as previously described (15).
125I TSH binding assay. Forty-eight hours after
transfection, cells were washed with Hanks’ solution in which NaCl was
replaced by sucrose 280 mM containing 0.2% BSA and 2.5%
low-fat milk (6). Binding studies were performed by incubating cells in
the same medium at room temperature for 4 h in the presence of
80,000 counts/min 125I TSH, (35 µCi/µg, 40 U/mg) and
the appropriate concentrations of cold bTSH (125I TSH was a
gift from B.R.A.H.M.S. Diagnostica). At the end of the incubation,
cells were rinsed twice with ice-cold Hanks’ medium and then
solubilized with 1 N NaOH. Cell-bound radioactivity was determined in a
-counter. Under these conditions, nonspecific binding (defined as
the radioactivity bound to dishes in the presence of 100 mU/mL cold
bTSH) was identical to that bound to mock transfected cells (1% of
total counts added). In the absence of a consensus about the
bioactivity of pure bTSH (16), we expressed all TSH or TSHr
concentrations in milliunits per milliliters, assuming a 1:1
stoichiometry for TSH binding to its receptor. The competitive binding
curves were made to fit by nonlinear regression assuming a single
receptor site (17).
|
Results |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionAddendumReferences |
|---|
and Fig. 1). Five out of 6 (83%) hyperfunctioning
nodules within toxic multinodular goiter harbored a TSHr mutation
(patients 12, 13, 14, 16, and 17). Included in these five cases
harboring a TSHr mutation was also the patient in whom the
hyperfunctioning nodule at histology appeared as a noncapsulated
hyperplastic nodule rather than a true adenoma. Among toxic adenomas, 8
out of 11 (72%) nodules (patients 1, 4, 5, 6, 7, 9, 10, and 11)
harbored a TSHr mutation.
|
|
All the mutations identified were heterozygotic and somatic. Direct sequence analysis of genomic DNA revealed that the proportion of the mutated and wild-type allele were similar, suggesting that the mutation affected only one allele and that it was dominant. Mutation P639S is a new, not previously described mutation. Only wtTSHr sequences were found in the normal extranodular tissue and in nonfunctioning nodules.
Functional characteristics of the TSHr mutations
The L629F and I630L mutations have been recently reported (18, 19), but their functional characteristics were not yet published. The
P639S mutation has been identified in this study for the first time.
The functional characteristics of mutations L629F, I630L, and P639S
were analyzed. To demonstrate that the L629F, I630L, and P639S are
activating mutations responsible for the development of
hyperfunctioning nodules, the cAMP pathway was studied. Basal cAMP
production was measured after transient expression of 250 ng DNA of
various constructs in COS-7 cells. As previously shown, cells
transfected with wtTSHr exhibited an increased production of cAMP
compared to cells transfected with vector alone (Fig. 2). Cells transfected with constructs
harboring the mutated receptors L629F, I630L, or P639S exhibited an
increased cAMP production with respect to the wtTSHr (Fig. 2). As
assessed by 125I TSH binding experiments, all mutated TSHr
constructs showed lower levels of expression on the cell surface (Fig. 2, Table 4), demonstrating that the
increased cAMP production was not caused by overexpression of the
receptor. The functional characteristics of the D619G, A623V, T632I,
and D633E mutations were already described (4, 5, 6, 20, 21, 22).
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionAddendumReferences |
|---|
According to current pathogenetic concepts, toxic multinodular goiter results from chronic TSH stimulation leading to progressive accumulation of new follicles with heterogeneous ability of iodine turnover and hormone synthesis (23, 24, 25, 26). Follicles with high rates of iodine turnover eventually progress towards autonomous growth and function (i.e. independent from TSH regulation). Large clusters of autonomously functioning thyroid follicles may mimic hyperfunctioning adenomas (24). The observation that similar to toxic thyroid adenoma single hyperfunctioning thyroid nodules within toxic multinodular goiters harbor a TSHr gene mutation, suggests that the basic mechanism leading to the formation of toxic thyroid adenoma and hyperfunctioning nodules in toxic multinodular goiter is the same. TSHr gene mutations were found in four out of five hyperfunctioning nodules within multinodular goiters that at microscopic examination were diagnosed as true adenomas but, interestingly, also in the one hyperfunctioning nodule that lacked the histological features of true adenoma.
The notion that toxic thyroid adenoma is more frequent and that toxic multinodular goiter is almost exclusively observed in areas of iodine deficiency (27, 28, 29, 30) suggests that iodine deficiency and/or chronic TSH stimulation plays a role in the clinical expression of gain-of-function mutations of the TSHr gene.
In all cases of toxic multinodular goiter, the hyperfunctioning nodules were greater in size than nonfunctioning nodules. Although we have no information about the time of appearance of nonfunctioning and hot nodules, respectively, it could be argued that further growth of nonfunctioning nodules was prevented by the suppression of TSH by the hyperfunctioning nodules.
All TSHr gene mutations identified in the present study were shown to activate constitutively either the cAMP cascade alone or both the cAMP and the inositolphosphate pathways. Mutations D619G, A623V, T632I, and D633E were already shown to increase intracellular cAMP accumulation in the absence of the specific ligand (20). The I486M mutation displays a constitutive activity also towards the phosholipase-C pathway (6). Two mutations (L629F and I630L) had been already reported (18, 19), but their functional activity had not been studied. The P639S is a newly identified mutation. When transfected in COS cells, mutations L629F, I630L, and P639S increased basal cAMP accumulation to a greater extent as compared with wtTSHr. In binding experiments, these mutated receptors displayed lower expression levels as compared with the wtTSHr, indicating that the increased cAMP accumulation was not caused by an overexpression of mutated receptors. These functional data prove that the above-described amino acid substitutions are indeed active mutations of the TSHr and not simple polymorphysms. Mutations were mainly located in the VI transmembrane segment of TSHr, confirming that this is a hot spot for gain-of-function mutations (4, 7, 10, 20). When genotype was correlated to phenotype, no relationship was found between the type or location of the mutation and the size of the nodule, its ultrasound pattern (solid, cystic, hypo- or hyper-isoechogenic), or the degree of thyrotoxicosis.
Seventy-three percent of toxic thyroid adenomas considered in
this study were found to harbor a TSHr mutation. A much lower frequency
of TSHr mutations in toxic thyroid adenoma was found by other authors
(8, 9, 10, 11). This discrepancy might be because of racial differences in the
population studied (Caucasian vs. Japanese), or to different
criteria utilized to define toxic thyroid adenoma. Failure to entirely
sequence exon 10 of the TSHr gene (8) or the use of less-sensitive
techniques, such as single-stranded conformational polymorphism, might
also explain the lower frequency of TSHr gene mutations reported in
other studies (8, 31, 32). A further explanation is that several of
these studies used material obtained from fine-needle aspiration (7, 9), in which normal tissue surrounding the hyperfunctioning nodule can
dilute the DNA expressing the mutated allele. Our data confirm the
notion that gain-of-function mutations of the TSHr gene account for the
majority of toxic thyroid adenomas. The minority of hyperfunctioning
thyroid nodules with no TSHr mutation could result from alterations of
other proteins involved in the activation of the cAMP pathway. In this
respect, it is interesting to note that Gs mutations (gsp oncogene)
were reported in about 30% of toxic thyroid adenomas (33).
At variance with the hyperfunctioning nodules of toxic multinodular goiters, nonfunctioning thyroid nodules within the same gland, whether histologically classified as true adenomas or as hyperplastic nodules, lacked TSHr mutations. This observation indicates that the mutated TSHr sequences in hyperfunctioning nodules identified in this study are somatic. Other mechanisms are implicated in the growth of nonfunctioning thyroid nodules coexistent in the same gland (32, 34).
In conclusion, our data indicate that single hyperfunctioning thyroid nodules within toxic multinodular goiters recognize the same pathogenetic event (an activating TSHr mutation) as toxic thyroid adenoma. The pathogenetic mechanisms involved in the development of other varieties of toxic multinodular goiter in which distinct hyperfunctioning nodules are not recognized, remain to be elucidated.
|
Addendum |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionAddendumReferences |
|---|
in that article, 6 out of the 33 patients
studied had a toxic multinodular goiter. This finding was not further
discussed.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received July 22, 1997.
Revised September 16, 1997.
Accepted October 22, 1997.
|
References |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionAddendumReferences |
|---|
subunit in nodules and
adenomas of multinodular goiters and identification of a new activating
mutation (Tyr 601 Asp) in a solitary toxic adenoma. Thyroid 6[Suppl
1]:S-9. (Abstract).
genes as a cause of toxic thyroid adenomas. J
Clin Endocrinol Metab. 82:2695–2701.This article has been cited by other articles:
 |
|
 |
|
  F Palos-Paz, O Perez-Guerra, J Cameselle-Teijeiro, C Rueda-Chimeno, F Barreiro-Morandeira, J Lado-Abeal, the Galician Group for the Study of Toxic Multinod, D Araujo Vilar, R Argueso, O Barca, et al. Prevalence of mutations in TSHR, GNAS, PRKAR1A and RAS genes in a large series of toxic thyroid adenomas from Galicia, an iodine-deficient area in NW Spain Eur. J. Endocrinol., November 1, 2008; 159(5): 623 - 631. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Rossi, A. Dimida, M. T. Dell'anno, M. L. Trincavelli, P. Agretti, F. Giorgi, G. U. Corsini, A. Pinchera, P. Vitti, M. Tonacchera, et al. The Thyroid Disruptor 1,1,1-Trichloro-2,2-Bis(p-Chlorophenyl)-Ethane Appears to Be an Uncompetitive Inverse Agonist for the Thyrotropin Receptor J. Pharmacol. Exp. Ther., January 1, 2007; 320(1): 465 - 474. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. I. Gozu, R. Bircan, K. Krohn, S. Muller, S. Vural, C. Gezen, H. Sargin, D. Yavuzer, M. Sargin, B. Cirakoglu, et al. Similar prevalence of somatic TSH receptor and Gs{alpha} mutations in toxic thyroid nodules in geographical regions with different iodine supply in Turkey. Eur. J. Endocrinol., October 1, 2006; 155(4): 535 - 545. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S G Watson, A D Radford, A Kipar, P Ibarrola, and L Blackwood Somatic mutations of the thyroid-stimulating hormone receptor gene in feline hyperthyroidism: parallels with human hyperthyroidism J. Endocrinol., September 1, 2005; 186(3): 523 - 537. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Porra, C. Ferraro-Peyret, C. Durand, S. Selmi-Ruby, H. Giroud, N. Berger-Dutrieux, M. Decaussin, J.-L. Peix, C. Bournaud, J. Orgiazzi, et al. Silencing of the Tumor Suppressor Gene SLC5A8 Is Associated with BRAF Mutations in Classical Papillary Thyroid Carcinomas J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3028 - 3035. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F Al-Khafaji, M Wiltshire, D Fuhrer, G Mazziotti, M D Lewis, P J Smith, and M Ludgate Biological activity of activating thyrotrophin receptor mutants: modulation by iodide J. Mol. Endocrinol., February 1, 2005; 34(1): 209 - 220. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. W. Beukers, J. van Oppenraaij, P. P. W. van der Hoorn, C. C. Blad, H. d. Dulk, J. Brouwer, and A. P. IJzerman Random Mutagenesis of the Human Adenosine A2B Receptor Followed by Growth Selection in Yeast. Identification of Constitutively Active and Gain of Function Mutations Mol. Pharmacol., March 1, 2004; 65(3): 702 - 710. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Krohn and R. Paschke Progress in Understanding the Etiology of Thyroid Autonomy J. Clin. Endocrinol. Metab., July 1, 2001; 86(7): 3336 - 3345. [Full Text] [PDF]
|
|
|
|
|
|
M. Tonacchera and A. Pinchera Thyrotropin Receptor Polymorphisms and Thyroid Diseases J. Clin. Endocrinol. Metab., August 1, 2000; 85(8): 2637 - 2639. [Full Text]
|
|
|
|
|
|
T. Mühlberg, K. Herrmann, W. Joba, M. Kirchberger, H.-J. Heberling, and A. E. Heufelder Lack of Association of Nonautoimmune Hyperfunctioning Thyroid Disorders and a Germline Polymorphism of Codon 727 of the Human Thyrotropin Receptor in a European Caucasian Population J. Clin. Endocrinol. Metab., August 1, 2000; 85(8): 2640 - 2643. [Abstract] [Full Text]
|
|
|
|
|
|
M. Tonacchera, P. Agretti, L. Chiovato, V. Rosellini, G. Ceccarini, A. Perri, P. Viacava, A. G. Naccarato, P. Miccoli, A. Pinchera, et al. Activating Thyrotropin Receptor Mutations Are Present in Nonadenomatous Hyperfunctioning Nodules of Toxic or Autonomous Multinodular Goiter J. Clin. Endocrinol. Metab., June 1, 2000; 85(6): 2270 - 2274. [Abstract] [Full Text]
|
|
|
|
|
|
M. Tonacchera, P. Vitti, P. Agretti, G. Ceccarini, A. Perri, R. Cavaliere, B. Mazzi, A. G. Naccarato, P. Viacava, P. Miccoli, et al. Functioning and Nonfunctioning Thyroid Adenomas Involve Different Molecular Pathogenetic Mechanisms J. Clin. Endocrinol. Metab., November 1, 1999; 84(11): 4155 - 4158. [Abstract] [Full Text]
|
|
|
|
|
|
E. M. Gabriel, E. R. Bergert, C. S. Grant, J. A. van Heerden, G. B. Thompson, and J. C. Morris Germline Polymorphism of Codon 727 of Human Thyroid-Stimulating Hormone Receptor Is Associated with Toxic Multinodular Goiter J. Clin. Endocrinol. Metab., September 1, 1999; 84(9): 3328 - 3335. [Abstract] [Full Text]
|
|
|
|
|
|
D. H. C. Khoo, J. Parma, C. Rajasoorya, S. C. Ho, and G. Vassart A Germline Mutation of the Thyrotropin Receptor Gene Associated with Thyrotoxicosis and Mitral Valve Prolapse in a Chinese Family J. Clin. Endocrinol. Metab., April 1, 1999; 84(4): 1459 - 1462. [Abstract] [Full Text]
|
|
|
|
|
|
X. De Deken, C. Vilain, J. Van Sande, J. E. Dumont, and F. Miot Decrease of Telomere Length in Thyroid Adenomas without Telomerase Activity J. Clin. Endocrinol. Metab., December 1, 1998; 83(12): 4368 - 4372. [Abstract] [Full Text]
|
|
|
|
 |
|
 C. Govaerts, C. Blanpain, X. Deupi, S. Ballet, J. A. Ballesteros, S. J. Wodak, G. Vassart, L. Pardo, and M. Parmentier The TXP Motif in the Second Transmembrane Helix of CCR5. A STRUCTURAL DETERMINANT OF CHEMOKINE-INDUCED ACTIVATION J. Biol. Chem., April 13, 2001; 276(16): 13217 - 13225. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
