| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Unité INSERM-INRA U-418 and Institut Federatif de Recherchesen Endocrinologie de Lyon, Hôpital Debrousse (M.C.L., O.A., J.M.S.), Lyon; Département d’Endocrinologie, Centre Hospitalier Universitaire (Y.R., J.M.), Caen; CHU (F.A.), Limoges; and CHU (J.C., G.N.), Besançon, France; and Laboratory of Cell Biology, National Institute of Health (T.B.U.), Bethesda, Maryland 20892
Address all correspondence and requests for reprints to: Dr. J. M. Saez, INSERM-INRA U-418, Hôpital Debrousse, 69322 Lyon Cedex 05, France. E-mail: saez{at}lyon151.inserm.fr
 |
Abstract |
|---|
 Top Abstract IntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
In the present work we have investigated the acute effects of both ACTH and GIP on freshly isolated cells from adrenals of three patients with food-dependent Cushing’s syndrome, as well as the long term effects of both peptides on the expression of three key steroidogenic enzymes. In addition, RT-PCR and in situ hybridization demonstrated the presence of GIP receptor messenger ribonucleic acid (mRNA) in the three cases, but not in normal human adrenals.
|
Subjects and Methods |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
The three women patients (43–49 yr old) were referred for evaluation of Cushing’s syndrome with subnormal morning plasma concentrations of cortisol and suppressed ACTH levels; in these subjects food intake stimulated cortisol secretion. A full clinical description of patient 1 has been published (8). She was successfully treated with 0.1 mg octreotide, three times daily, and after 5 months of treatment, the clinical and biological signs of Cushing’s syndrome recurred. Therefore, bilateral adrenalectomy was performed. Microscopic and histological examination was typical of bilateral macronodular adrenal hyperplasia. A partial clinical description of patient 2 has been published (10). She had food-dependent Cushing’s syndrome associated with the Carney complex. Abdominal computed tomography revealed macronodular bilateral hyperplasia. Both adrenal glands contained multiple nodules with dark areas of lipofuscin. Patient 3 was a 43-yr-old woman with typical food-dependent Cushing’s syndrome (a full clinical description will be published elsewhere). Abdominal computed tomography showed a left-sided adrenal mass of about 3.5 cm. The patient was treated with 0.1 mg octreotide, three times daily, without any result. Therefore, a left adrenalectomy was performed. Microscopic and histological examination confirmed the presence of an adenoma.
Materials
Synthetic ACTH [ACTH-(1–24)] was purchased from Ciba
(Rueil-Malmaison, France). All other reagents were obtained from
Sigma Chemical Co. (St. Louis, MO). Human placental
3ß-hydroxysteroid dehydrogenase (3ßHSD) complementary DNA (cDNA)
was provided by Dr. F. Labrie (Centre Hospitalier Universitaire Laval,
Quebec, Canada) (11), bovine P-45017
and bovine
cholesterol side-chain cleavage cytochrome P-450 (P-450scc)
cDNAs were donated by Dr. M. R. Waterman (Vanderbilt University
School of Medicine, Nashville, TN) (12, 13).
Preparation and culture of human adult and tumoral adrenocortical cells
Portions of the three patients’ adrenal gland adenomas were dispersed by two collagenase-deoxyribonuclease digestions (1 and 0.1 mg/mL) in DMEM-Ham’s nutrition mixture F-12 (DMEM/F12; 1:1) medium, supplemented with NaHCO3 (14 mmol) and HEPES (10 mmol), containing gentamicin (20 µg/mL), penicillin (100 U/mL), streptomycin (0.1 mg/mL), and nystatin (100 U/mL) as described previously (14). Some of the dispersed cells were incubated in the same medium with various concentrations of ACTH and GIP for 2 h. The remaining cells were seeded in monolayer cultures in the same medium containing 1% FCS and cultured at 37 C under a humidified atmosphere of 5% carbon dioxide-95% air. After 24 h, the medium was changed to DMEM-F12 medium containing insulin (10 µg/mL) and vitamin C (10-4 mol/liter), without FCS. Treatments were conducted in this defined medium starting on day 2 of culture for 48 or 96 h.
Human adult adrenals were obtained after organ removal for transplantation from brain-dead patients, with the approval of the ethics committee of the Hospices Civils de Lyon. Informed consent to perform the studies described in the present work was obtained from the three patients.
Steroid measurements
At the end of each experimental protocol, one aliquot of medium was saved. The cells were then washed and incubated in fresh medium in the presence of 10-8 mol/L ACTH or 10-7 mol/L GIP. Samples were frozen until the specific RIAs were performed for cortisol and cAMP, as previously described (15).
Cell multiplication
The potential mitogenic effect of several factors was evaluated by [3H]thymidine incorporation into DNA. For this experiment cells were plated at 2 x 104 cells on 48-well plates. After 24 h, the medium was replaced by DMEM-F12 medium containing 0.1% BSA and was cultured for an additional day. Cells were then cultured in the same medium in the absence or presence of basic fibroblast growth factor (bFGF), without or with ACTH, GIP, or 10% FCS for 1 day, followed by a 4-h pulse with [3H]thymidine (1 µCi/mL). The cells were fixed with 0.5 mL methanol-acetic acid (3:1) and washed three times with 80% methanol. 3H-Labeled DNA was extracted by 0.5 mL 0.4% deoxycholate 0.5 N NaOH. Radioactivity was measured by a liquid scintillation counter.
RNA preparation and Northern blot analysis
Total RNA was isolated from cells by the method of Chomczynski
and Sacchi (16). After electrophoresis through 1.0% agarose gels and
transfer to nylon membranes, hybridization was performed as previously
described (17), using human placental 3ßHSD cDNA (11), bovine
P45017 cDNA (12), or bovine P450scc cDNA
(13) as probes (106 dpm/mL).
RT-PCR
Total RNAs were reverse transcribed with Moloney murine leukemia
virus reverse transcriptase (Life Technologies, Eragny,
France) using oligo(deoxythymidine)12–18
(Pharmacia-France, Saint-Quentin-en-Yvelines, France). The cDNAs
obtained were then amplified by PCR (35 cycles at 94 C for 30 s,
58 C for 30 s, 72 C for 1 min) using 5'-oligonucleotide
ATCCGCATTCTTGGCATTCTCCTG (944–968) and the 3'-oligonucleotide
ATGCTAACTGAACAGACACGGGGA (1435–1411) from human GIP receptor cDNA
(GenBank U39231). PCR fragments obtained were sequenced by dideoxy
chain termination using [-35S]deoxy-ATP and Sequenase
(U.S. Biochemical Corp., Cleveland, OH) according to the
instructions provided.
In situ hybridization
The GIR receptor template was amplified from the human GIP receptor cDNA in a PCR reaction consisting of a 5-min denaturation step at 94 C followed by 35 amplification cycles (94 C for 1 min, 65 C for 1 min, and 72 C for 1 min) and a 10-min elongation step at 72 C in the presence of the following primers: sense primer, 5'-CAGAGATGCATTAACCCTCACTAAAGGGAGA/ATCCGCATTCTTGGCATTCTCCTG-3' [the consensus T3 sequence is underlined preceded by a 9-bp leader sequence in italics and followed after the slash (/) by the gene-specific sequence (944–968)]; and antisense primer, 5'-CCAAGCTTCTAATACGACTCA CTATAGGGAGA/ATGCTAACTGAACAGACACGGGGA-3' [the consensus T7 sequence is underlined preceded by a 9-bp leader sequence in italics and followed after the slash (/) by the gene-specific sequence ()]. The resulting PCR product was purified using the QIA quick-spin columns from Qiagen (Courtaboeuf, France).
Preparation of sense and antisense complementary RNA probes was performed essentially as described by Logel et al. (18), and in situ hybridization using these probes followed essentially the protocol described by Simmons et al. (19).
|
Results |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
First, we investigated the effects of 2-h treatment with
increasing concentrations of ACTH or GIP on cortisol production by
freshly isolated cells from normal adrenals and those from the three
patients (Fig. 1
). Normal adrenal cells
respond to ACTH but not to GIP. In contrast, adrenal cells from the
three patients responded in a dose-dependent manner to both hormones,
although the maximal steroidogenic response varied from one patient to
another. In the three patients the maximal steroidogenic response to
GIP was greater than that to ACTH. Moreover, the effects of GIP
and ACTH were not additive in the two patients studied (Table 1).
|
|
). However, whereas the
steroidogenic effects of GIP were more marked during the first day than
during the second day, those of ACTH were similar (patient 1) or
greater (patients 2 and 3) on the second day. Moreover, on day 4 the
productions of cortisol by control and GIP-treated adrenal cells from
patient 1 were similar (1174 ± 37 and 1255 ± 170
pmol/106 cells) and significantly lower than the production
of cortisol by ACTH-treated cells (7285 ± 250
pmol/106 cells).
Further evidence of the desensitizing action of GIP was obtained by
studying the acute effects (2 h) of GIP and ACTH on cells cultured
under several conditions (Table 2).
Pretreatment of adrenal cells from patients 2 and 3 for 48 h with
GIP reduced cAMP and cortisol production in response to GIP, but not in
response to ACTH. On the other hand, pretreatment with ACTH enhanced
the response to ACTH and maintained that to GIP. Similarly,
pretreatment of adrenal cells from patient 1 for 96 h with GIP
completely abolished the cortisol response to GIP, but not that to
ACTH, whereas the steroidogenic responses of ACTH-pretreated cells to
ACTH and GIP were 4- and 3-fold greater than that of cells cultured
without hormone (data not shown).
|
To investigate the potential mitogenic action of ACTH and GIP in
cells from normal adrenals and patient 3, adenoma cells were incubated
without or with bFGF in the absence or presence of ACTH, GIP, or 10%
FCS (Table 3). bFGF as well as 10% FCS
had a significant mitogenic effect. In the absence of bFGF, ACTH
slightly reduced DNA synthesis in both cell types, whereas GIP only had
an effect on adenoma cells. These small inhibitory effects of both
hormones became significant when the cells were cultured in the
presence of bFGF. Under these conditions, ACTH blocked the mitogenic
action on both cell types, whereas GIP only had an inhibitory action on
adenoma cells.
|
To investigate the trophic effects of both hormones, cells from
normal adrenals and patients’ adrenals were cultured without or with
ACTH, GIP, or both for 2 (normal adrenals and patients 2 and 3) or 4
(patient 1) days. As previously reported (17), ACTH in normal human
adrenal cells enhanced the mRNA levels of P450scc,
P450c17, and 3ßHSD, but GIP had no effect (Fig. 2). In contrast, both hormones increased
the mRNA levels of the three enzymes in adrenal cells from the three
patients. Again, at maximal concentrations the effects of both hormones
were not additive. The stimulatory effect of ACTH was higher in normal
adrenal cells than in patients’ adrenal cells. The effects of GIP in
patients’ adrenal cells were lower than those of ACTH. Moreover, the
stimulatory effects of GIP, but not those of ACTH, varied markedly
between patient 1 (lower) and patients 2 and 3. These differences may
be related to the fact that patient 1’s adrenal cells were treated for
4 days, whereas those from the two other subjects were treated for 2
days, and as indicated above, GIP induced homologous desensitization by
down-regulating its own receptors (see below).
|
GIP receptors were characterized by RT-PCR and in situ
hybridization. Using specific primers, a single band of the expected
size (-500 bp) was observed after RT-PCR in the three patient adrenals
and the fetal adrenal, but not in normal human adrenals or an adenoma
from a patient with nonfood, non-ACTH-dependent Cushing’s syndrome
(Fig. 3). Similarly, a positive signal
was observed by in situ hybridization in the three patient
adrenal cells (Fig. 4), but not in normal
human adrenals (data not shown). Moreover, as shown in Figs. 3c and 4,
treatment of adenoma cells from patient 3 with GIP markedly reduced GIP
receptor mRNA, whereas the effects of ACTH at the maximal concentration
used were far less marked.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
GIP receptors have been detected by radioligand binding in rat, hamster, and human pancreatic tissue (20, 21). More recently, the rat (22) and human (GenBank U39231) receptor cDNAs have been cloned. By using both approaches, RT-PCR and in situ hybridization, we demonstrated the presence of GIP receptor mRNAs in the adrenals of the three patients with food-dependent Cushing’s syndrome, in human fetal adrenals, but not in normal adult human adrenals or in one patient with nonfood-dependent Cushings’ syndrome. These results confirm and extend previous studies showing by in situ hybridization the presence of GIP receptor mRNA in the adenoma of one patient with food-dependent Cushing’s syndrome (9) and those reported in one abstract (23) indicating the presence of GIP receptor mRNA in the latter patient and in the patient described by Lacroix et al. (7) by RT-PCR. Using this method, a low level of expression was also reported in fetal and normal adult adrenals (23). However, although we found a low expression in fetal adrenals, we were unable to find it in two normal adult adrenals. Even if there is some expression in normal human adrenal cells, the receptors are nonfunctional, because no effect of GIP was observed in any of the parameters measured.
The importance of GIP as a direct regulator of cortisol secretion was demonstrated by in vitro studies showing that isolated cells from patient adrenals, but not those from normal adrenals, respond in a dose-dependent manner to GIP. Indeed, at the maximal effective concentrations, the steroidogenic effects of GIP were greater than those of ACTH, but no additive effect was found when both peptides were added together.
Previous studies have shown that long term treatment with ACTH of normal human adrenals enhanced the mRNA levels of specific adrenal genes, including ACTH receptors and several steroidogenic enzymes (14, 17), and this resulted in an enhanced steroidogenic responsiveness to further ACTH stimulation. The present findings demonstrated that in adenoma cells, ACTH pretreatment also enhanced the mRNA levels of the three steroidogenic enzymes (P450scc, P450c17, and 3ßHSD) and the steroidogenic responsiveness to both ACTH and GIP. Our results demonstrated that GIP pretreatment increases the mRNA levels of the three steroidogenic enzymes, although to a lesser extent than ACTH, and this was associated with an enhanced steroidogenic responsiveness to ACTH, but with a decreased responsiveness (cAMP and cortisol) to its own stimulation. This indicated that in contrast to ACTH, GIP induced a homologous desensitization by inducing down-regulation of its own receptors, as demonstrated by RT-PCR and in situ hybridization. The desensitizing action of GIP in vitro probably did not exist in vivo, as in the three patients each meal caused an increase in plasma cortisol levels. This discrepancy between in vivo and in vitro situations has been reported for other hormones, i.e. LH/hCG and GnRH (reviewed in Refs. 24, 25), and might be related to differences between in vivo and in vitro situations, in particular to the fact that in vivo the levels of polypeptide hormones are pulsatory, whereas in vitro they remain relatively constant.
Although in vivo studies have shown that an excess of endogenous or exogenous ACTH caused adrenal hyperplasia, in vitro studies using adrenal cells from several species have shown that ACTH, through the cAMP pathway, is antimitogenic, rather that mitogenic (reviewed in Ref. 26). To investigate the potential effects of both hormones on adenoma cell multiplication, their effect on DNA synthesis, in the absence or presence of bFGF, a potent mitogen for adrenal cells (27), was studied. In the absence of bFGF, both ACTH and GIP slightly decreased DNA synthesis, but both hormones blocked the stimulatory action of bFGF in adenoma cells, whereas in adrenal cells only ACTH had this inhibitory action.
In conclusion, the present findings confirm that food-dependent Cushing’s syndrome resulted from the ectopic expression of functional GIP receptors in adrenal glands. These receptors were responsible not only for the acute food-induced cortisol secretion, but also for the increased expression of genes encoding steroidogenic enzymes and therefore for the high responsiveness to the elevated plasma GIP levels that physiologically occur after each meal. However, the potential roles of these ectopic receptors in adrenal cell multiplication were not explained by the present in vitro studies.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received May 15, 1998.
Revised August 6, 1998.
Accepted August 17, 1998.
|
References |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
: regulation
of gene expression and elucidation of primary sequence. J Biol
Chem. 261:2475–2482.
(17-hydroxylase) and 3ß-hydroxysteroid-dehydrogenase mRNA and
proteins and on steroidogenic responsiveness to corticotropin and
angiotensin II. J Clin Endocrinol Metab. 78:1212–1219.[Abstract]
This article has been cited by other articles:
 |
|
 |
|
  N M Albiger, G Occhi, B Mariniello, M Iacobone, G Favia, A Fassina, D Faggian, F Mantero, and C Scaroni Food-dependent Cushing's syndrome: from molecular characterization to therapeutical results Eur. J. Endocrinol., December 1, 2007; 157(6): 771 - 778. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D Vezzosi, D Cartier, C Regnier, P Otal, A Bennet, F Parmentier, M Plantavid, A Lacroix, H Lefebvre, and P Caron Familial adrenocorticotropin-independent macronodular adrenal hyperplasia with aberrant serotonin and vasopressin adrenal receptors Eur. J. Endocrinol., January 1, 2007; 156(1): 21 - 31. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. L. Mazzuco, O. Chabre, N. Sturm, J.-J. Feige, and M. Thomas Ectopic Expression of the Gastric Inhibitory Polypeptide Receptor Gene Is a Sufficient Genetic Event to Induce Benign Adrenocortical Tumor in a Xenotransplantation Model Endocrinology, February 1, 2006; 147(2): 782 - 790. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Baldacchino, S. Oble, P.-O. Decarie, I. Bourdeau, P. Hamet, J. Tremblay, and A. Lacroix The Sp transcription factors are involved in the cellular expression of the human glucose-dependent insulinotropic polypeptide receptor gene and overexpressed in adrenals of patients with Cushing's syndrome J. Mol. Endocrinol., August 1, 2005; 35(1): 61 - 71. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. M. Swords, S. Aylwin, L. Perry, J. Arola, A. B. Grossman, J. P. Monson, and A. J. L. Clark The Aberrant Expression of the Gastric Inhibitory Polypeptide (GIP) Receptor in Adrenal Hyperplasia: Does Chronic Adrenocorticotropin Exposure Stimulate Up-Regulation of GIP Receptors in Cushing's Disease? J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3009 - 3016. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Bertherat, V. Contesse, E. Louiset, G. Barrande, C. Duparc, L. Groussin, P. Emy, X. Bertagna, J.-M. Kuhn, H. Vaudry, et al. In Vivo and in Vitro Screening for Illegitimate Receptors in Adrenocorticotropin-Independent Macronodular Adrenal Hyperplasia Causing Cushing's Syndrome: Identification of Two Cases of Gonadotropin/Gastric Inhibitory Polypeptide-Dependent Hypercortisolism J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1302 - 1310. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Bourdeau, A. Lacroix, W. Schurch, P. Caron, T. Antakly, and C. A. Stratakis Primary Pigmented Nodular Adrenocortical Disease: Paradoxical Responses of Cortisol Secretion to Dexamethasone Occur in Vitro and Are Associated with Increased Expression of the Glucocorticoid Receptor J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3931 - 3937. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Mune, H. Murase, N. Yamakita, T. Fukuda, M. Murayama, A. Miura, T. Suwa, J. Hanafusa, H. Daido, H. Morita, et al. Eutopic Overexpression of Vasopressin V1a Receptor in Adrenocorticotropin-Independent Macronodular Adrenal Hyperplasia J. Clin. Endocrinol. Metab., December 1, 2002; 87(12): 5706 - 5713. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. BOURDEAU and C. A. STRATAKIS Cyclic AMP-Dependent Signaling Aberrations in Macronodular Adrenal Disease Ann. N.Y. Acad. Sci., June 1, 2002; 968(1): 240 - 255. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Groussin, K. Perlemoine, V. Contesse, H. Lefebvre, A. Tabarin, P. Thieblot, J. L. Schlienger, J. P. Luton, X. Bertagna, and J. Bertherat The Ectopic Expression of the Gastric Inhibitory Polypeptide Receptor Is Frequent in Adrenocorticotropin-Independent Bilateral Macronodular Adrenal Hyperplasia, but Rare in Unilateral Tumors J. Clin. Endocrinol. Metab., May 1, 2002; 87(5): 1980 - 1985. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Lacroix, N. N'Diaye, J. Tremblay, and P. Hamet Ectopic and Abnormal Hormone Receptors in Adrenal Cushing's Syndrome Endocr. Rev., February 1, 2001; 22(1): 75 - 110. [Abstract] [Full Text]
|
|
|
|
|
|
S. Tsagarakis, C. Tsigos, V. Vassiliou, P. Tsiotra, H. Pratsinis, D. Kletsas, P. Trivizas, A. Nikou, T. Mavromatis, F. Sotsiou, et al. Food-Dependent Androgen and Cortisol Secretion by a Gastric Inhibitory Polypeptide-Receptor Expressive Adrenocortical Adenoma Leading to Hirsutism and Subclinical Cushing's Syndrome: In Vivo and in Vitro Studies J. Clin. Endocrinol. Metab., February 1, 2001; 86(2): 583 - 589. [Abstract] [Full Text]
|
|
|
|
|
|
H. Mircescu, J. Jilwan, N. N'Diaye, I. Bourdeau, J. Tremblay, P. Hamet, and A. Lacroix Are Ectopic or Abnormal Membrane Hormone Receptors Frequently Present in Adrenal Cushing's Syndrome? J. Clin. Endocrinol. Metab., October 1, 2000; 85(10): 3531 - 3536. [Abstract] [Full Text]
|
|
|
|
 |
|
 A. Lacroix, P. Hamet, and J.-M. Boutin Leuprolide Acetate Therapy in Luteinizing Hormone-Dependent Cushing's Syndrome N. Engl. J. Med., November 18, 1999; 341(21): 1577 - 1581. [Full Text] [PDF]
|
|
|
|
|
|
F. P. Pralong, F. Gomez, L. Guillou, F. Mosimann, S. Franscella, and R. C. Gaillard Food-Dependent Cushing's Syndrome: Possible Involvement of Leptin in Cortisol Hypersecretion J. Clin. Endocrinol. Metab., October 1, 1999; 84(10): 3817 - 3822. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. N’Diaye, P. Hamet, J. Tremblay, J.-M. Boutin, L. Gaboury, and A. Lacroix Asynchronous Development of Bilateral Nodular Adrenal Hyperplasia in Gastric Inhibitory Polypeptide-Dependent Cushing's Syndrome J. Clin. Endocrinol. Metab., August 1, 1999; 84(8): 2616 - 2622. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
