help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kumar, S.
Right arrow Articles by Bagchi, I. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kumar, S.
Right arrow Articles by Bagchi, I. C.
The Journal of Clinical Endocrinology & Metabolism Vol. 83, No. 12 4443-4450
Copyright © 1998 by The Endocrine Society


Original Studies

Progesterone Induces Calcitonin Gene Expression in Human Endometrium within the Putative Window of Implantation1

Sushma Kumar, Li-Ji Zhu, Mary Polihronis, Sharon T. Cameron, David T. Baird, Frederick Schatz, Anuradha Dua, Yu-Kang Ying, Milan K. Bagchi and Indrani C. Bagchi

Population Council and The Rockefeller University, New York, New York 10021; the Department of Obstetrics and Gynecology, Nassau County Medical Center, (S.K., A.D., Y.-K.Y.), New York, New York 11554; the Department of Obstetrics and Gynecology, Center for Reproductive Biology, University of Edinburgh (S.T.C., D.T.B.), Edinburgh, United Kingdom; and the Department of Obstetrics and Gynecology, New York University Medical School (F.S.), New York, New York 10016

Address all correspondence and requests for reprints to: Dr. Indrani C. Bagchi, The Population Council, 1230 York Avenue, New York, New York 10021. E-mail: indrani{at}popcbr.rockefeller.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The human endometrium acquires the ability to implant the developing embryo within a specific time window that is thought to open between days 19–24 of the secretory phase of the menstrual cycle. During this period the endometrium undergoes pronounced structural and functional changes induced by the ovarian steroids, estrogen and progesterone, that prepare it to be receptive to invasion by the embryo. The identification of reliable biochemical markers to assess this critical receptive phase in the context of the natural cycle remains one of the major challenges in the study of human reproduction. Our previous studies in a rat model system demonstrated that the expression of calcitonin, a peptide hormone involved in calcium homeostasis, is transiently induced by progesterone in the glandular epithelium at the onset of implantation. Attenuation of calcitonin synthesis in the uterus during the preimplantation phase by administration of calcitonin antisense oligodeoxynucleotides severely impairs implantation of rat embryos, suggesting that this peptide hormone plays a critical role in uterine receptivity. To investigate whether calcitonin is also expressed in the human endometrium during implantation, we monitored the spatio-temporal expression of calcitonin on various days of the menstrual cycle. Our studies employing RT-PCR showed that calcitonin messenger ribonucleic acid is expressed in human endometrium during the postovulatory midsecretory phase (days 17–25) of the menstrual cycle, with maximal expression occurring between days 19–21. Very little calcitonin expression was detected in the endometrium in either the preovulatory proliferative (days 5–14) or the late secretory (days 26–28) phase. In situ hybridization and immunocytochemical analyses localized the calcitonin expression predominantly in the glandular epithelial cells of the endometrium. Our studies further showed that calcitonin expression in the human endometrium is under progesterone regulation. Treatment of women with an antiprogestin, mifepristone (RU-486), drastically reduced calcitonin expression in the endometrium. Collectively, these findings reveal that progesterone-induced expression of calcitonin in the secretory endometrium temporally coincides with the putative window of implantation in the human.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IMPLANTATION, the initiation of complex interactions between the developing embryo and the uterus, is a crucial event in mammalian embryonic growth and development (1, 2, 3, 4). The initial adherence of the blastocyst to the uterine surface epithelium is followed by intimate interaction of the blastocyst trophectoderm with epithelial cells that leads to the progressive phases of implantation. It is generally believed that the endometrium and the fertilized ovum must both undergo concomitant developmental changes for implantation to succeed. The endometrium undergoes certain hormone-dependent changes during a specific time window in the preimplantation phase that prepare it to be receptive to the developing blastocyst. Studies by Psychoyos demonstrated that rat uterus can accept the blastocyst to implant for only a brief period on day 5 of gestation, known as the receptive phase (5, 6, 7). The uterus enters a nonreceptive phase on the following day (day 6), when it is refractory to implantation. In humans, the ovum is fertilized in the fallopian tube, arrives in the uterine cavity around days 17–18 (day 14 is taken as day of ovulation of a 28-day cycle), and remains there as a free-floating embryo until about day 19; implantation then occurs between days 19–24 (8, 9, 10, 11, 12). The precise timing and molecular basis of the receptive window in the human remain undefined.

A timely interplay of the ovarian steroids, estrogen and progesterone, orchestrates the entry of the fertilized ova into the uterus followed by the pronounced morphological and physiological alteration of the endometrium leading to the acquisition of the receptive state of the uterus (1, 2, 3, 4, 13). Estrogen initiates hypertrophy and hyperplasia of endometrial epithelia. Progesterone transforms this prepared endometrium into a secretory tissue and creates an environment within the uterine milieu that is conducive to embryo attachment. Although previous research has established that estrogen and progesterone regulate the events leading to implantation, relatively little is known of the molecular mechanisms by which these hormones promote uterine receptivity. Steroid hormones act through their intracellular receptors, which are ligand-inducible gene regulatory factors (14, 15, 16). It is therefore likely that steroids trigger the expression of a unique set of genes during the early stages of pregnancy and that these eventually lead to the synthesis of new proteins that prepare the uterus to accept the invading blastocyst. These steroid-induced molecules, when identified, may serve as useful markers of uterine receptivity.

To identify the molecular signals that participate in the establishment of a receptive endometrium, we previously employed a gene expression screen technique (17) to isolate a number of putative implantation stage-specific genes. Nucleotide sequence analysis identified one of these genes as that encoding the peptide hormone calcitonin (18, 19). Our studies revealed that the level of calcitonin messenger ribonucleic acid (mRNA) or protein in rat uterus rises dramatically during the implantation phase of gestation. The expression of calcitonin increases by day 2 (postfertilization) of gestation and reaches a peak on day 4, the day before implantation. On day 5, the day implantation occurs, the expression of the gene starts to decline, and by day 6, when the embryo has attached to the endometrium, the calcitonin level falls to below detection limits (18, 19). Our studies also indicated that the expression of calcitonin in the uterus is regulated by progesterone, and the transient expression of calcitonin at the time of implantation is restricted to the glandular epithelial cells of the endometrium (18). We recently demonstrated that administration of antisense oligodeoxynucleotides (ODNs), targeted specifically against calcitonin mRNAs, into the lumen of the preimplantation rat uterus results in a dramatic reduction in the number of implanted embryos (20). The antisense ODN intervention also markedly suppresses the steady state level of the calcitonin mRNAs in the uterus, without affecting the expression of nontarget genes, suggesting strongly that a transient expression of calcitonin in the preimplantation uterus provides a critical signal for blastocyst implantation.

In the present study, we examined the expression of calcitonin mRNA in the human endometrium on different days of the menstrual cycle. Our study showed that calcitonin expression in human endometrium is temporally restricted to the midsecretory phase of the cycle, which closely overlaps with the putative window of implantation. We localized the site of postovulatory synthesis of calcitonin mRNA and protein in the glandular epithelial cells of human endometrium by in situ hybridization and immunocytochemistry. We also examined whether progesterone regulates calcitonin expression in human endometrium by monitoring biopsies from human subjects treated with the progesterone receptor antagonist mifepristone. We observed that progesterone is the primary inducer of calcitonin gene expression in the human endometrium during the menstrual cycle. Calcitonin therefore displays the potential to serve as a progesterone-regulated marker of the receptive endometrium in the human.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Endometrial tissues

Human endometrial tissues were obtained as part of endometrial curettage from healthy, nonpregnant women between the ages of 25–40 yr before elective sterilization with informed consent. These tissues were obtained in accordance with the rules and regulations of the institution and after approval of the institutional review board at the Nassau County Medical Center. Endometrial tissues were transported to the laboratory in Hanks’ balanced salt solution on ice. Tissues were then snap-frozen in liquid nitrogen and stored at -70 C until further use. Endometrial tissues were classified according to the last menstrual period and histology according to the criteria of Noyes et al. (21). Dating was also verified by measuring serum levels of estradiol and progesterone.

Paraffin-embedded mifepristone-treated endometrial sections were prepared at the Department of Obstetrics/Gynecology, Center for Reproductive Biology, University of Edinburgh (Edinburgh, UK). These tissue sections were prepared as part of a previously reported study to examine the effects of a daily low dose of mifepristone on endometrial maturation and proliferation (22). The histology of these endometrial sections has been reported previously by Cameron et al. (22). The tissues were obtained in accordance with the rules and regulations of the institution and after approval of the study by the institutional review board. Briefly, six healthy women with regular menstrual cycles, aged 29–36 yr, agreed to take part in the study with mifepristone. Subjects were monitored over three consecutive cycles: control, treatment, and follow-up. During the treatment cycle, 200 mg mifepristone were administered 2 days after the midcycle LH surge in urine (LH+2). An endometrial biopsy was taken from each subject 6 days after the LH surge, that is, LH+6, on the same day of both control and treatment cycles. In the treatment cycle, the biopsy was taken 4 days after drug intake.

Isolation of RNA and RT-PCR

Endometrial specimens were homogenized using a hand-held microhomogenizer, and total RNA was isolated using a micro-RNA isolation kit (Stratagene, La Jolla, CA). Pelleted RNA was resuspended in diethylpyrocarbonate water. RNA samples were quantitated by absorbance spectroscopy at 260 nm and stored at -70 C in 95% ethanol until further use. Endometrial total RNA (0.15 µg) was subjected to RT reaction using a RT-PCR kit (Stratagene). Briefly, the RNA samples were mixed with oligo(deoxythymidine) primer, incubated at 65 C for 5 min, and annealed at room temperature. First strand complementary DNA (cDNA) was synthesized using Moloney murine leukemia virus reverse transcriptase at 37 C, and the reaction was stopped by heating the tubes at 95 C for 5 min. The nucleotide sequences of the oligonucleotide primers were CAGATCTAAGCGGTGCGGTAATC and GACATCTCTGGGGGACTCAAAG. PCR reaction was then performed in a 100-µL total volume using 35 ng primer set; 200 µmol/L each of deoxy (d)-ATP, dGTP, dCTP and dTTP; 1.5 mmol/L Mg2+; and 0.5 µL Taq DNA polymerase (Perkin Elmer, Norwalk, CT). The conditions for PCR were 94 C for 30 s for 1 cycle, followed by 94 C for 30 s, 65 C for 30 s, and 68 C for 2 min for 15–40 cycles. PCR products were electrophoresed on agarose gels and processed for Southern blot analysis.

Southern blot analysis

PCR products (2 µL each) were run on 1% agarose gel. After electrophoresis, the gel was transferred to Duralon membrane (Stratagene). The membrane was prehybridized in 6 x SSC (standard saline citrate), 5 x Denhardt’s solution, 0.5% SDS, and 100 µg/mL salmon sperm DNA for 2 h at 68 C. Hybridization was performed in the same buffer containing 106 cpm/mL 32P-labeled cDNA fragment of human calcitonin or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) overnight at 68 C. The membrane was washed with 2 x SSC and 0.1% SDS for 15 min at room temperature and in 0.1x SSC containing 0.5% SDS at 68 C for 45 min, then exposed to x-ray film for 12 h.

In situ hybridization

For in situ hybridization, endometrium sections (5 µm) were deparaffinized in xylene, rehydrated through ethanol baths from 100% to 50%, and washed in phosphate-buffered saline (PBS). In situ hybridization was then performed with digoxygenin (DIG)-labeled antisense RNA probes complimentary to nucleotides 2600–3000 of the calcitonin gene. Prehybridization was carried out in a damp chamber at 37 C for 60 min in hybridization buffer (50% formamide, 5 x SSC, 2% blocking reagent, 0.02% SDS, and 0.1% N-laurylsarcosine). Hybridization was carried out at 42 C overnight in a damp humidified chamber. To develop the substrate, sections were sequentially washed in 2 x SSC, 1 x SSC, and 0.1 x SSC for 15 min in each buffer at 37 C. Sections were then incubated with anti-DIG alkaline phosphatase-conjugated antibody. Excess antibody was washed away, and the color substrate (nitro blue tetrazolium salt and 5-bromo-4-chloro-3-indoylphosphate) was added. Slides were allowed to develop in the dark, and the color was visualized under light microscopy until maximum levels of staining were achieved. The reaction was stopped, and the slides were counterstained in Nuclear Fast Red for 5 min. The slides were washed in water, dehydrated, and coverslipped. Control incubations used a DIG-labeled RNA sense strand and were performed under identical conditions.

Immunohistochemistry and image analysis

Polyclonal antibody against human calcitonin (Peninsula Laboratory, Belmont, CA) was diluted 1:1000 for immunohistochemistry. Frozen or paraffin-embedded endometrial tissues were sectioned at 7 µm and mounted on slides. Frozen sections were then fixed in 5% formaldehyde solution in PBS. Sections were washed in PBS for 20 min and then incubated in a blocking solution containing 10% normal goat serum for 10 min before incubation in primary antibody overnight at 4 C. Immunostaining was performed using a streptavidin-biotin kit for rabbit primary antibody (Zymed, Burlingame, CA). Sections were counterstained with hematoxylin, mounted, and examined under brightfield. Red deposits indicate the sites of immunostaining. In control experiments, 1 µg human calcitonin (Sigma Chemical Co., St. Louis, MO) were incubated overnight with antibody against human calcitonin at 4 C. The antigen-antibody solution was centrifuged briefly, and the supernatant was collected and then used for incubation of endometrial sections (day 20) for immunohistochemistry, which was performed following the protocol described above.

A quantitative analysis of the immunohistochemical data was performed by image analysis. The intensity of calcitonin-specific staining was determined using a Nikon Optiphot-2 microscope (Nikon, Inc., Melville, NY) equipped with a Dage MTI video camera (CCD 72, Michigan City, IN). The video images of calcitonin signal were then digitized using a frame grabber (Quick Capture, Data Translation, Inc., Marlboro, MA) and were displayed on a Sun IPC work station (Mountain View, CA). The stained cytoplasmic areas of the glandular epithelial cells were traced. The integrated pixel intensity was determined for the traced areas using image analysis software (Image-Pro, Media Cybernetics, Silver Spring, MD). The intensities were normalized by dividing the integrated pixel intensity by the cytoplasmic area (which equaled the total number of pixels within the traced boundary). The background intensities were determined for each group by tracing an unlabeled area adjacent to the labeled cells. The background was subtracted from the values obtained for the labeled cells, and the adjusted values are referred to as the relative signal intensities. There were 30 observations for each group.

Statistical analyses

Statistical evaluations of the data representing the levels of calcitonin in endometrium on different days of the menstrual cycle and before and after treatment of mifepristone were performed using ANOVA and Fisher’s least significant differences test. P < 0.05 was considered statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Calcitonin mRNA is expressed in human endometrium within the putative window of implantation

Our previous studies showed that the expression of calcitonin is markedly induced in rat uterus immediately before implantation (18, 19). To monitor the expression of calcitonin mRNA in human endometrium during the menstrual cycle, we analyzed RNA isolated from human endometrial biopsies for the presence of calcitonin by RT-PCR. The RNA samples obtained from the endometrium of 14 patients on different days of the cycle were reversed transcribed and amplified by PCR using calcitonin gene (exon 4)-specific primers. The PCR-amplified products were then subjected to Southern blot analysis employing a radiolabeled human calcitonin cDNA fragment containing exon 4 as a probe. The results depicted in Fig. 1AGo (upper panel) show that no calcitonin transcripts were detected in the proliferative phase. A faint signal corresponding to calcitonin mRNA appeared on day 17 of the cycle. The level of calcitonin mRNA increased dramatically on days 19–21 and then declined to low levels by day 25 of the cycle. No signal corresponding to calcitonin mRNA was detected beyond day 25. The relative levels of expression of calcitonin mRNA in the endometrium on different days of the cycle were estimated by densitometric scanning, followed by normalization with respect to the control GAPDH mRNA signal (Fig. 1AGo, lower panel). A significant level of calcitonin mRNA was observed on days 17, 19, 20, 21, and 25 of the secretory phase compared to all other days of the cycle (Fig. 1BGo). As the window of implantation in the human is thought to open between days 18–24 of the cycle, these results indicate that calcitonin is expressed in human endometrium within the putative window of implantation.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 1. Profile of expression of calcitonin mRNA in human endometrium on different days of the menstrual cycle. A, Total RNA (1.5 µg) were isolated from human endometrium on days 5 (n = 4), 8 (n = 4), 10 (n = 3), 11 (n = 4), 14 (n = 4), 17 (n = 2), 19 (n = 3), 20 (n = 4), 21 (n = 2), 25 (n = 2), 27 (n = 3), and 28 (n = 3) of the menstrual cycle and subjected to RT-PCR using calcitonin (upper panel)- or GAPDH (lower panel)-specific primers as described in Materials and Methods. n is the number of independently isolated endometrial samples analyzed. PCR reactions using both calcitonin and GAPDH primers were performed through multiple rounds ranging from 15–40 cycles to ensure that the amplifications were in the linear range. The data shown above represent 30 cycles of PCR amplification. The authenticity of the PCR products were confirmed by Southern blot analysis using calcitonin or GAPDH cDNA probes. B, Quantitation of calcitonin mRNA signals in RT-PCR reactions was performed by densitometry followed by normalization with respect to corresponding GAPDH mRNA signals. For accurate densitometric measurements of the mRNA signals in the RT-PCR reactions, we used shorter exposures of the autoradiograms in which neither calcitonin nor GAPDH signal was saturating. Results are expressed relative to GAPDH and are plotted as the mean ± SE for at least three separate experiments. Results obtained with endometrial samples on days 17, 21, and 25 of the cycle are representative of two independent experiments.

 
Calcitonin mRNA and protein are localized in the glandular epithelium of human endometrium

To identify the site(s) of calcitonin mRNA expression in the human endometrium, we performed in situ hybridization analysis with sections of endometrial specimens in the proliferative (day 8) and midsecretory (day 20) phases of the menstrual cycle. We used a 400-bp DIG-labeled antisense RNA probe containing sequences from the exon 4 of the calcitonin gene. As shown in Fig. 2Go, a strong hybridization of the probe to the glandular epithelial cells was observed in the sections of the midsecretory phase endometrium (Fig. 2Go, B and D, respectively). In contrast, little, if any, hybridization signal was present in the glandular epithelial cells of the proliferative phase endometrium (Fig. 2EGo). Control uterine sections (day 20) hybridized with the corresponding sense RNA probe of equal length did not exhibit any signal demonstrating the specificity of the hybridization reaction (Fig. 2Go, A and C, respectively). These results indicated that calcitonin mRNA is induced in the human endometrium around the midsecretory phase of the menstrual cycle and this mRNA is present exclusively in the glandular epithelial cells.



View larger version (140K):
[in this window]
[in a new window]
 
Figure 2. Localization of calcitonin mRNAs in human endometrium by in situ hybridization. Sections of endometrial samples in the proliferative (day 8) or the midsecretory phase (day 20) of the menstrual cycle were subjected to in situ hybridization. Hybridization was performed employing a 400-bp-long digoxygenin-labeled cRNA probe specific for exon 4 of the calcitonin gene. A and C show hybridization of the day 20 endometrial section with sense RNA probe; B and D show hybridization of the day 20 endometrial section with the corresponding antisense RNA probe of equal length. E represents hybridization of the day 8 endometrial section with antisense RNA probe. The purple color indicates sites of specific hybridization. gl, Glandular epithelium. Magnification: A and B, x50; C–E, x250.

 
To localize the site of accumulation of calcitonin protein in human endometrium, we performed immunocytochemical staining of sections of endometrium at two different stages of the menstrual cycle using an antibody against human calcitonin. As shown in Fig. 3BGo, sections of an endometrial sample in the midsecretory phase (day 20) of the menstrual cycle exhibited strong calcitonin-specific staining. This staining was predominantly present in the glandular epithelial cells. No significant staining was observed in the stromal cells. Control sections of the same endometrial tissue sample, when incubated with calcitonin antibody that has been preabsorbed with excess human calcitonin, showed no immunoreactivity (Fig. 3CGo), indicating the specificity of the immunostaining. Interestingly, endometrial samples in the proliferative or preovulatory phase of the cycle failed to show any immunoreactivity (Fig. 3AGo). These results, like those of the in situ hybridization analysis, suggest that calcitonin synthesis is induced in the glandular epithelial cells of the human endometrium in a stage-specific manner during the midsecretory phase of the menstrual cycle, the time during which implantation of the embryo occurs.



View larger version (89K):
[in this window]
[in a new window]
 
Figure 3. Immunohistochemical localization of calcitonin in human endometrium. Human endometrium specimens in the proliferative (day 11) and midsecretory (day 20) phases of the menstrual cycle were obtained from diagnostic endometrial hysterectomies performed for benign conditions. The specimens were dated according to the criteria of Noyes et al. (21 ). Immunohistochemistry was performed with endometrial sections in the proliferative (day 11; A) or midsecretory (day 20; B) phase, employing a polyclonal rabbit antihuman calcitonin antibody (Peninsula Laboratory, Belmont, CA). C shows the result of a control experiment in which calcitonin antibody was preabsorbed with excess calcitonin antigen and then used to stain sections of secretory phase endometrium. Red deposits indicate sites of specific immunostaining. Arrowheads indicate epithelial cells. Magnification, x400.

 
Calcitonin expression in human endometrium is regulated by progesterone

Our previous studies showed that the expression of calcitonin is regulated by progesterone in rat uterus. We therefore examined whether calcitonin expression in the human endometrium is also under progesterone regulation. We analyzed endometrial biopsies from subjects before and after treatment with an antiprogestin, mifepristone, and monitored calcitonin expression by in situ hybridization and immunohistochemistry. The endometrial biopsies from six healthy female volunteers were obtained from two consecutive menstrual cycles: a control cycle and a treatment cycle in which 200 mg mifepristone were administered 2 days after the midcycle LH surge in urine (LH+2). An endometrial biopsy was taken 6 days after the LH surge (LH+6) in a control cycle and on the corresponding day of the treatment cycle. Biopsies were then assessed for the presence of calcitonin mRNA and protein by in situ hybridization and immunohistochemistry. As shown in Fig. 4aGo, no signal corresponding to calcitonin mRNA was observed when the biopsy from the control cycle was hybridized with sense complementary RNA (cRNA) calcitonin probe (Fig. 4aGo, A). However a strong signal corresponding to calcitonin mRNA was observed when biopsy from the control cycle was hybridized with antisense cRNA calcitonin probe (Fig. 4aGo, B). The staining was specifically localized in the glandular epithelial cells. Interestingly, biopsy of the same subject after treatment with mifepristone showed drastically reduced calcitonin-specific staining when hybridized with an antisense cRNA calcitonin probe (Fig. 4aGo, C). We also monitored calcitonin protein in the endometrial biopsies of subjects before and after treatment with mifepristone by immunohistochemistry. Figure 4bGo, A, shows intense calcitonin-specific staining in the endometrial glands of subjects from the control cycle. The calcitonin-specific staining declined dramatically upon treatment with mifepristone (Fig. 4bGo, B). An endometrial section from the control cycle and a section from the mifepristone-treated cycle incubated with calcitonin antibody that was preabsorbed with excess human calcitonin showed no immunoreactivity (Fig. 4bGo, C and D, respectively), indicating the specificity of the immunostaining. Similar results were obtained with endometrial biopsies from all six subjects. Quantitation of protein staining by image analysis revealed that greater than 70% of calcitonin immunoreactivity was lost upon treatment with mifepristone (Fig. 5Go). Collectively, these results indicated that calcitonin expression in the human endometrium is under progesterone regulation.



View larger version (126K):
[in this window]
[in a new window]
 
Figure 4. Effects of the antiprogestin mifepristone on calcitonin mRNA and protein synthesis in human endometrial glands. a, Endometrial sections from control and mifepristone-treated cycles were subjected to in situ hybridization using a 400-bp-long digoxygenin-labeled cRNA probe specific for exon 4 of the calcitonin gene. A and B represent endometrial sections of subjects from the control cycle treated with sense and antisense cRNA calcitonin probe, respectively. C represents endometrial section of subject from the mifepristone-treated cycle after hybridization with antisense cRNA calcitonin probe. Magnification, x130. b, Immunocytochemistry was performed employing polyclonal rabbit antihuman calcitonin with endometrial sections of subjects from the control (A) and mifepristone-treated (B) cycles, respectively. C and D represent endometrial sections from the control and mifepristone-treated cycles incubated with normal rabbit IgG. Magnification, x255.

 


View larger version (27K):
[in this window]
[in a new window]
 
Figure 5. Immunostaining of calcitonin in human endometrium declines after treatment with mifepristone. The relative signal intensities for calcitonin protein staining in glandular epithelial cells before and after treatment with mifepristone are plotted (mean ± SEM). *, P < 0.001.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The failure to acquire uterine receptivity in a timely manner may account for a significant percentage of cases of infertility in women. The identification of a molecular marker(s) specific for the receptive endometrium may assist in the diagnosis of female infertility due to failure of implantation and facilitate management of a clinical therapy for affected women. Investigation of the phenomenon of uterine receptivity in the human is extremely limited due to ethical concerns. Most of the available data have been obtained from pregnancy outcomes in in vitro fertilization/embryo transfer procedures. For the in vitro fertilization embryos of the 4- to 12-cell stage, the optimal period for their transfer to the uterus was shown to be on days 17–19 of artificial cycles induced by hormone replacement therapy (12). One must be cautioned, however, that this transfer window may not correspond to the natural implantation window because the hormonally stimulated cycles of the embryo recipients are likely to be different from normal menstrual cycles with respect to the timing of the morphological changes (23, 24, 25). Additionally, the exact developmental stage of the transferred embryos varies from case to case. The only available histological data come from one study performed by Hertig et al. in 1956 with hysterectomy samples (8). They observed unattached blastocysts in uteri samples on days 19–20 of the menstrual cycle, but found blastocysts firmly implanted in samples beyond day 21. This study therefore placed the time of implantation in the human between days 19–22. A more precise definition of the implantation window still eludes us. The use of reliable biochemical markers to assess uterine receptivity in the context of the natural menstrual cycle is one way to achieve this goal.

Our previous studies in the rat and the current studies in the human suggest that calcitonin is a candidate marker of uterine receptivity during blastocyst implantation. A comparison of the patterns of calcitonin expression in human and rat endometria is presented in Fig. 6Go. In the rat, calcitonin mRNA is expressed at a low level in nonpregnant animals, and its expression does not change significantly at various stages of the estrous cycle. A burst of calcitonin is expressed in the rat endometrium immediately preceding implantation (days 3–4). In the human, calcitonin expression peaks on days 19–21 of the midsecretory phase of the menstrual cycle, whereas none is detected during the preovulatory or late secretory stage. Moreover, in situ hybridization and immunohistochemical analyses indicated that uterine calcitonin is synthesized predominantly in the glandular epithelium. The fact that calcitonin is expressed in the glands tempt us to speculate that it might be secreted into the uterine lumen. This scenario, if validated by future experiments, may permit the development of sensitive methods for detection (such as RIA) of this hormone in uterine secretions or other body fluids of the human. This will give calcitonin a clear advantage over other potential markers of uterine receptivity that are not secreted.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 6. Comparison of the patterns of calcitonin.

 
The presence of calcitonin in the progesterone-dominant secretory phase of the menstrual cycle is consistent with our previous observation that the calcitonin gene is regulated by progesterone in the rat uterus. In the human during a normal 28-day menstrual cycle, a midcycle LH surge triggers ovulation and formation of the corpus luteum, which then releases progesterone throughout the luteal phase. We therefore examined whether the expression of calcitonin in the midsecretory phase of the menstrual cycle is regulated by progesterone. Analyses of the expression of calcitonin mRNA and protein by in situ hybridization and immunohistochemistry methods in tissue biopsies obtained from four subjects who had been treated with the antiprogestin RU-486 on day 6 after the LH surge showed that this is indeed the case. Compared to the intense calcitonin mRNA- or protein-specific staining that was observed in the glandular epithelium of the endometrial specimens obtained from the subjects in the control cycle, no such staining was detected in the glandular epithelium of biopsies obtained from the same subjects in the RU-486 treatment cycle. As RU-486 is known to exert its inhibitory effects by impairing the gene regulatory activity of the progesterone receptor (26, 27), down-regulation of calcitonin in the RU-486-treated patients indicated that synthesis of calcitonin in the uterus is regulated by progesterone.

By definition, a true marker of uterine receptivity should have a relevant functional role during the implantation process. Our recent studies in the rat using antisense ODNs indeed suggested that calcitonin performs critical functions in the endometrium to regulate uterine receptivity before implantation (20). The precise functional role of calcitonin in human endometrium remains unknown. The most well characterized physiological role of calcitonin is to regulate calcium levels in bone and kidney cells (28, 29, 30, 31, 32). In response to hypercalcemia, the thyroid gland rapidly releases calcitonin, which, in turn, lowers blood calcium by inhibiting osteoclast activity and thereby reducing bone resorption and remodeling (28, 29, 30, 31, 32). The hormone is also present in small amounts in tissues such as lung, liver, intestine, and pituitary and in the central nervous system (33). Although the precise functional role of calcitonin in these tissues remains unclear, its wide distribution throughout the body, including the central nervous system, and its presence in animals that have no bony skeleton suggest that calcitonin may possess other properties in addition to its action in bones. The common denominator in the various physiological actions of calcitonin could well be the modulation of calcium flux across the membranes of a number of different types of cells and thus of the intracellular-extracellular distribution of calcium in various systems (34). In future studies we will investigate whether calcitonin regulates uterine receptivity for blastocyst implantation by controlling calcium homeostasis within the uterus in an autocrine/paracrine manner.


    Acknowledgments
 
We thank Evan Read for the artwork, and Jean Schweis for carefully reading the manuscript.


    Footnotes
 
1 This work was supported in part by NIH Grant RO1-HD-34527 and National Cooperative Program on Markers of Uterine Receptivity for Blastocyst Implantation Grant HD-34760 from the NIH (to I.C.B.) and in part by funds from The Population Council. Milan K. Bagchi is supported by NIH Grants RO1-DK-50257 and HD-13541-18. Back

Received May 21, 1998.

Revised August 7, 1998.

Accepted August 18, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Psychoyos A. 1973 Endocrine control of egg implantation. In: Greep RO, Astwood EG, eds. Handbook of physiology. Washington DC: American Physiological Society; 187–215.
  2. Yoshinaga K. 1988 Uterine receptivity for blastocyst implantation. Ann NY Acad Sci. 541:424–431.[Abstract]
  3. Parr MB, Parr EL. 1989 The implantation reaction. In: Wynn RM, Jollie WP, eds. Biology of the uterus. New York: Plenum Press; 233–277.
  4. Weitlauf HM. 1994 Biology of implantation. In: Knobil E, Neill JD, eds. The physiology of reproduction. New York: Raven Press; 391–440.
  5. Psychoyos A. 1973 Hormonal control of ovoimplantation. Vitam Horm. 31:205–255.
  6. Psychoyos A. 1976 Hormonal control of uterine receptivity for nidation. J Reprod Fertil. 25(Suppl):17–28.
  7. Psychoyos A. 1986 Uterine receptivity for nidation. Ann NY Acad Sci. 476:36–42.[Medline]
  8. Hertig AT, Rock J, Adams EC. 1956 A description of 34 human ova within the first 17 days of development. Am J Anat. 98:435–493.
  9. Formigli L, Formigli G, Roccio C. 1987 Donation of fertilized uterine ova to infertile women. Fertil Steril. 47:62–65.
  10. Rogers PAW, Murphy CR. 1989 Uterine receptivity for implantation: human studies. In: Yoshinaga K, ed. Blastocyst implantation. New York: Serono Symposia; 231–238.
  11. Navot DM, Anderson TL, Droesch K, Scott RT, Kreiner RT, Kreiner D, Rosenwaks Z. 1989 Hormonal manipulation of endometrial maturation. J Clin Endocrinol Metab. 68:801–807.[Abstract]
  12. Navot DM, Scott RT, Droesch K, Veeck LL, Liu HC, Rosenwaks Z. 1991 The window of embryo transfer and the efficiency of human conception in vitro. Fertil Steril. 55:114–117.[Medline]
  13. Strauss JF, Gurpide E. 1991 The endometrium: regulation and dysfunction. In: Yen SSC, Jaffe RB, eds. Reproductive endocrinology. Philadelphia: Saunders; 309–356.
  14. Evans RM. 1988 The steroid and thyroid hormone receptor superfamily. Science. 240:889–895.[Abstract/Free Full Text]
  15. Beato M. 1989 Gene regulation by steroid hormones. Cell. 56:335–344.[CrossRef][Medline]
  16. Tsai MJ, O’Malley BW. 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem. 63:451–486.[CrossRef][Medline]
  17. Wang Z, Brown DD. 1991 A gene expression screen. Proc Natl Acad Sci USA. 88:11505–11509.[Abstract/Free Full Text]
  18. Ding YQ, Zhu LZ, Bagchi MK, Bagchi IC. 1994 Progesterone stimulates calcitonin gene expression in the uterus during implantation. Endocrinology. 135:2265–2274.[Abstract]
  19. Ding YQ, Bagchi MK, Bardin CW, Bagchi IC. 1995 Calcitonin gene expression in the rat uterus during pregnancy. Recent Prog Horm Res. 50:373–378.
  20. Zhu L-J, Bagchi MK, Bagchi IC. 1998 Attenuation of calcitonin gene expression in pregnant rat uterus leads to a block in embryonic implantation. Endocrinology. 139:330–339.[Abstract/Free Full Text]
  21. Noyes RW, Hertig AI, Rock J. 1950 Dating the endometrial biopsy. Fertil Steril. 1:3–25.
  22. Cameron ST, Critchley HOD, Thong KJ, Buckley CH, Kelly RW, Baird DT. 1997 Effect of two antiprogestins (mifepristone and onapristone) on endometrial factors of potential importance for implantation. Fertil Steril. 67:1046–1053.[CrossRef][Medline]
  23. Martel D, Frydman R, Glissant M, Maggioni C, Roche D, Psychoyos A. 1987 Scanning electron microscopy of postovulatory human endometrium in spontaneous cycles and cycles stimulated by hormone treatment. J Endocrinol. 114:319–324.[Abstract]
  24. Martel D, Frydman R, Sarantis L, Roche D, Psychoyos A. 1989 Scanning electron microscopy of the uterine luminal epithelium as a marker of the implantation window. In: Yoshinaga K, ed. Blastocyst implantation. Boston: Adams Publishing Group; 225–230.
  25. Psychoyos A, Nikas G. 1994 Uterine pinopodes as markers of uterine receptivity. Assisted Reprod Rev. 4:26.
  26. Baulieu EE. 1989 Contragestion and other clinical applications of RU 486, an antiprogesterone at the receptor. Science. 245:1351–1357.[Abstract/Free Full Text]
  27. Baulieu EE. 1991 The antisteroid RU 486. Its cellular and molecular mode of action. Trends Endocrinol Metab. 2:233–239.
  28. Friedman J, Raisz LG. 1965 Thyrocalcitonin: inhibitor of bone resorption in tissue culture. Science. 150:1465–1467.[Abstract/Free Full Text]
  29. Foster GV. 1968 Calcitonin (thyrocalcitonin). N Engl J Med. 279:349–360.
  30. Austin LA, Heath H. 1981 Calcitonin. N Engl J Med. 304:269–278.[Medline]
  31. Wimalawansa SJ. 1990 Calcitonin: molecular biology, physiology, pathophysiology and its therapeutic uses. In: Pecile AAB, ed. Advances in bone regulatory factors: morphology, biochemistry, physiology and pharmacology. London: Plenum Press; 121–160.
  32. Becker KL, Snider R, Moore CF, Monaghan KG, Silva OL. 1979 Calcitonin in extrathyroidal tissues of man. Acta Endocrinol (Copenh). 92:746–751.[Medline]
  33. Fischer JA, Tobler PH, Kaufmann M, et al. 1981 Calcitonin: regional distribution of the hormone and its binding sites in the human brain and pituitary. Proc Natl Acad Sci USA. 78:7801–7805.[Abstract/Free Full Text]
  34. MacIntyre I. 1989 Endogenous calcitonin. In: Azira M, ed. The Calcitonins: Physiology and Pharmacology. Basel: S. Karger AG.



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
S. M Krzysik-Walker, O. M Ocon-Grove, S. B Maddineni, G. L Hendricks III, and R. Ramachandran
Identification of Calcitonin Expression in the Chicken Ovary: Influence of Follicular Maturation and Ovarian Steroids
Biol Reprod, October 1, 2007; 77(4): 626 - 635.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
H. Achache and A. Revel
Endometrial receptivity markers, the journey to successful embryo implantation
Hum. Reprod. Update, November 1, 2006; 12(6): 731 - 746.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
J-W Jeong, K Y Lee, J P Lydon, and F J DeMayo
Steroid hormone regulation of Clca3 expression in the murine uterus.
J. Endocrinol., June 1, 2006; 189(3): 473 - 484.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Q. Li, M. K. Bagchi, and I. C. Bagchi
Identification of a Signaling Pathway Involving Progesterone Receptor, Calcitonin, and Tissue Tranglutaminase in Ishikawa Endometrial Cells
Endocrinology, May 1, 2006; 147(5): 2147 - 2154.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
H. N. Jabbour, R. W. Kelly, H. M. Fraser, and H. O. D. Critchley
Endocrine Regulation of Menstruation
Endocr. Rev., February 1, 2006; 27(1): 17 - 46.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J.-W. Jeong, K. Y. Lee, I. Kwak, L. D. White, S. G. Hilsenbeck, J. P. Lydon, and F. J. DeMayo
Identification of Murine Uterine Genes Regulated in a Ligand-Dependent Manner by the Progesterone Receptor
Endocrinology, August 1, 2005; 146(8): 3490 - 3505.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
K. R. McDonald, N. J. Fudge, J. P. Woodrow, J. K. Friel, A. O. Hoff, R. F. Gagel, and C. S. Kovacs
Ablation of calcitonin/calcitonin gene-related peptide-{alpha} impairs fetal magnesium but not calcium homeostasis
Am J Physiol Endocrinol Metab, August 1, 2004; 287(2): E218 - E226.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
H. S. Taylor
Endometrial Cells Derived From Donor Stem Cells in Bone Marrow Transplant Recipients
JAMA, July 7, 2004; 292(1): 81 - 85.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
K. Gemzell-Danielsson and L. Marions
Mechanisms of action of mifepristone and levonorgestrel when used for emergency contraception
Hum. Reprod. Update, July 1, 2004; 10(4): 341 - 348.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
R.D. Catalano, A. Yanaihara, A.L. Evans, D. Rocha, A. Prentice, S. Saidi, C.G. Print, D.S. Charnock-Jones, A.M. Sharkey, and S.K. Smith
The effect of RU486 on the gene expression profile in an endometrial explant model
Mol. Hum. Reprod., August 1, 2003; 9(8): 465 - 473.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. Kumar, A. Brudney, Y.-P. Cheon, A. T. Fazleabas, and I. C. Bagchi
Progesterone Induces Calcitonin Expression in the Baboon Endometrium Within the Window of Uterine Receptivity
Biol Reprod, April 1, 2003; 68(4): 1318 - 1323.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
N. Chegini, C. Ma, X.M. Tang, and R.S. Williams
Effects of GnRH analogues, `add-back' steroid therapy, antiestrogen and antiprogestins on leiomyoma and myometrial smooth muscle cell growth and transforming growth factor-{beta} expression
Mol. Hum. Reprod., December 1, 2002; 8(12): 1071 - 1078.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Y.-P. Cheon, Q. Li, X. Xu, F. J. DeMayo, I. C. Bagchi, and M. K. Bagchi
A Genomic Approach to Identify Novel Progesterone Receptor Regulated Pathways in the Uterus during Implantation
Mol. Endocrinol., December 1, 2002; 16(12): 2853 - 2871.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Li, J. Wang, D. R. Armant, M. K. Bagchi, and I. C. Bagchi
Calcitonin Down-regulates E-cadherin Expression in Rodent Uterine Epithelium during Implantation
J. Biol. Chem., November 22, 2002; 277(48): 46447 - 46455.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Reese, S. K. Das, B. C. Paria, H. Lim, H. Song, H. Matsumoto, K. L. Knudtson, R. N. DuBois, and S. K. Dey
Global Gene Expression Analysis to Identify Molecular Markers of Uterine Receptivity and Embryo Implantation
J. Biol. Chem., November 16, 2001; 276(47): 44137 - 44145.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
H.-Y. Li, S.-P. Chang, C.-C. Yuan, H.-T. Chao, H.-T. Ng, and Y.-J. Sung
Nitric oxide induces extensive apoptosis in endometrial epithelial cells in the presence of progesterone: involvement of mitogen-activated protein kinase pathways
Mol. Hum. Reprod., August 1, 2001; 7(8): 755 - 763.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. Pavelock, K. M. Braas, L'H. Ouafik, G. Osol, and V. May
Differential Expression and Regulation of the Vascular Endothelial Growth Factor Receptors Neuropilin-1 and Neuropilin-2 in Rat Uterus
Endocrinology, February 1, 2001; 142(2): 613 - 622.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
Y. Gui, J. Zhang, L. Yuan, and B. A. Lessey
Regulation of HOXA-10 and its expression in normal and abnormal endometrium
Mol. Hum. Reprod., September 1, 1999; 5(9): 866 - 873.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar