| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Population Council and The Rockefeller University, New York, New York 10021; the Department of Obstetrics and Gynecology, Nassau County Medical Center, (S.K., A.D., Y.-K.Y.), New York, New York 11554; the Department of Obstetrics and Gynecology, Center for Reproductive Biology, University of Edinburgh (S.T.C., D.T.B.), Edinburgh, United Kingdom; and the Department of Obstetrics and Gynecology, New York University Medical School (F.S.), New York, New York 10016
Address all correspondence and requests for reprints to: Dr. Indrani C. Bagchi, The Population Council, 1230 York Avenue, New York, New York 10021. E-mail: indrani{at}popcbr.rockefeller.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A timely interplay of the ovarian steroids, estrogen and progesterone, orchestrates the entry of the fertilized ova into the uterus followed by the pronounced morphological and physiological alteration of the endometrium leading to the acquisition of the receptive state of the uterus (1, 2, 3, 4, 13). Estrogen initiates hypertrophy and hyperplasia of endometrial epithelia. Progesterone transforms this prepared endometrium into a secretory tissue and creates an environment within the uterine milieu that is conducive to embryo attachment. Although previous research has established that estrogen and progesterone regulate the events leading to implantation, relatively little is known of the molecular mechanisms by which these hormones promote uterine receptivity. Steroid hormones act through their intracellular receptors, which are ligand-inducible gene regulatory factors (14, 15, 16). It is therefore likely that steroids trigger the expression of a unique set of genes during the early stages of pregnancy and that these eventually lead to the synthesis of new proteins that prepare the uterus to accept the invading blastocyst. These steroid-induced molecules, when identified, may serve as useful markers of uterine receptivity.
To identify the molecular signals that participate in the establishment of a receptive endometrium, we previously employed a gene expression screen technique (17) to isolate a number of putative implantation stage-specific genes. Nucleotide sequence analysis identified one of these genes as that encoding the peptide hormone calcitonin (18, 19). Our studies revealed that the level of calcitonin messenger ribonucleic acid (mRNA) or protein in rat uterus rises dramatically during the implantation phase of gestation. The expression of calcitonin increases by day 2 (postfertilization) of gestation and reaches a peak on day 4, the day before implantation. On day 5, the day implantation occurs, the expression of the gene starts to decline, and by day 6, when the embryo has attached to the endometrium, the calcitonin level falls to below detection limits (18, 19). Our studies also indicated that the expression of calcitonin in the uterus is regulated by progesterone, and the transient expression of calcitonin at the time of implantation is restricted to the glandular epithelial cells of the endometrium (18). We recently demonstrated that administration of antisense oligodeoxynucleotides (ODNs), targeted specifically against calcitonin mRNAs, into the lumen of the preimplantation rat uterus results in a dramatic reduction in the number of implanted embryos (20). The antisense ODN intervention also markedly suppresses the steady state level of the calcitonin mRNAs in the uterus, without affecting the expression of nontarget genes, suggesting strongly that a transient expression of calcitonin in the preimplantation uterus provides a critical signal for blastocyst implantation.
In the present study, we examined the expression of calcitonin mRNA in the human endometrium on different days of the menstrual cycle. Our study showed that calcitonin expression in human endometrium is temporally restricted to the midsecretory phase of the cycle, which closely overlaps with the putative window of implantation. We localized the site of postovulatory synthesis of calcitonin mRNA and protein in the glandular epithelial cells of human endometrium by in situ hybridization and immunocytochemistry. We also examined whether progesterone regulates calcitonin expression in human endometrium by monitoring biopsies from human subjects treated with the progesterone receptor antagonist mifepristone. We observed that progesterone is the primary inducer of calcitonin gene expression in the human endometrium during the menstrual cycle. Calcitonin therefore displays the potential to serve as a progesterone-regulated marker of the receptive endometrium in the human.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Human endometrial tissues were obtained as part of endometrial curettage from healthy, nonpregnant women between the ages of 25–40 yr before elective sterilization with informed consent. These tissues were obtained in accordance with the rules and regulations of the institution and after approval of the institutional review board at the Nassau County Medical Center. Endometrial tissues were transported to the laboratory in Hanks’ balanced salt solution on ice. Tissues were then snap-frozen in liquid nitrogen and stored at -70 C until further use. Endometrial tissues were classified according to the last menstrual period and histology according to the criteria of Noyes et al. (21). Dating was also verified by measuring serum levels of estradiol and progesterone.
Paraffin-embedded mifepristone-treated endometrial sections were prepared at the Department of Obstetrics/Gynecology, Center for Reproductive Biology, University of Edinburgh (Edinburgh, UK). These tissue sections were prepared as part of a previously reported study to examine the effects of a daily low dose of mifepristone on endometrial maturation and proliferation (22). The histology of these endometrial sections has been reported previously by Cameron et al. (22). The tissues were obtained in accordance with the rules and regulations of the institution and after approval of the study by the institutional review board. Briefly, six healthy women with regular menstrual cycles, aged 29–36 yr, agreed to take part in the study with mifepristone. Subjects were monitored over three consecutive cycles: control, treatment, and follow-up. During the treatment cycle, 200 mg mifepristone were administered 2 days after the midcycle LH surge in urine (LH+2). An endometrial biopsy was taken from each subject 6 days after the LH surge, that is, LH+6, on the same day of both control and treatment cycles. In the treatment cycle, the biopsy was taken 4 days after drug intake.
Isolation of RNA and RT-PCR
Endometrial specimens were homogenized using a hand-held microhomogenizer, and total RNA was isolated using a micro-RNA isolation kit (Stratagene, La Jolla, CA). Pelleted RNA was resuspended in diethylpyrocarbonate water. RNA samples were quantitated by absorbance spectroscopy at 260 nm and stored at -70 C in 95% ethanol until further use. Endometrial total RNA (0.15 µg) was subjected to RT reaction using a RT-PCR kit (Stratagene). Briefly, the RNA samples were mixed with oligo(deoxythymidine) primer, incubated at 65 C for 5 min, and annealed at room temperature. First strand complementary DNA (cDNA) was synthesized using Moloney murine leukemia virus reverse transcriptase at 37 C, and the reaction was stopped by heating the tubes at 95 C for 5 min. The nucleotide sequences of the oligonucleotide primers were CAGATCTAAGCGGTGCGGTAATC and GACATCTCTGGGGGACTCAAAG. PCR reaction was then performed in a 100-µL total volume using 35 ng primer set; 200 µmol/L each of deoxy (d)-ATP, dGTP, dCTP and dTTP; 1.5 mmol/L Mg2+; and 0.5 µL Taq DNA polymerase (Perkin Elmer, Norwalk, CT). The conditions for PCR were 94 C for 30 s for 1 cycle, followed by 94 C for 30 s, 65 C for 30 s, and 68 C for 2 min for 15–40 cycles. PCR products were electrophoresed on agarose gels and processed for Southern blot analysis.
Southern blot analysis
PCR products (2 µL each) were run on 1% agarose gel. After electrophoresis, the gel was transferred to Duralon membrane (Stratagene). The membrane was prehybridized in 6 x SSC (standard saline citrate), 5 x Denhardt’s solution, 0.5% SDS, and 100 µg/mL salmon sperm DNA for 2 h at 68 C. Hybridization was performed in the same buffer containing 106 cpm/mL 32P-labeled cDNA fragment of human calcitonin or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) overnight at 68 C. The membrane was washed with 2 x SSC and 0.1% SDS for 15 min at room temperature and in 0.1x SSC containing 0.5% SDS at 68 C for 45 min, then exposed to x-ray film for 12 h.
In situ hybridization
For in situ hybridization, endometrium sections (5 µm) were deparaffinized in xylene, rehydrated through ethanol baths from 100% to 50%, and washed in phosphate-buffered saline (PBS). In situ hybridization was then performed with digoxygenin (DIG)-labeled antisense RNA probes complimentary to nucleotides 2600–3000 of the calcitonin gene. Prehybridization was carried out in a damp chamber at 37 C for 60 min in hybridization buffer (50% formamide, 5 x SSC, 2% blocking reagent, 0.02% SDS, and 0.1% N-laurylsarcosine). Hybridization was carried out at 42 C overnight in a damp humidified chamber. To develop the substrate, sections were sequentially washed in 2 x SSC, 1 x SSC, and 0.1 x SSC for 15 min in each buffer at 37 C. Sections were then incubated with anti-DIG alkaline phosphatase-conjugated antibody. Excess antibody was washed away, and the color substrate (nitro blue tetrazolium salt and 5-bromo-4-chloro-3-indoylphosphate) was added. Slides were allowed to develop in the dark, and the color was visualized under light microscopy until maximum levels of staining were achieved. The reaction was stopped, and the slides were counterstained in Nuclear Fast Red for 5 min. The slides were washed in water, dehydrated, and coverslipped. Control incubations used a DIG-labeled RNA sense strand and were performed under identical conditions.
Immunohistochemistry and image analysis
Polyclonal antibody against human calcitonin (Peninsula Laboratory, Belmont, CA) was diluted 1:1000 for immunohistochemistry. Frozen or paraffin-embedded endometrial tissues were sectioned at 7 µm and mounted on slides. Frozen sections were then fixed in 5% formaldehyde solution in PBS. Sections were washed in PBS for 20 min and then incubated in a blocking solution containing 10% normal goat serum for 10 min before incubation in primary antibody overnight at 4 C. Immunostaining was performed using a streptavidin-biotin kit for rabbit primary antibody (Zymed, Burlingame, CA). Sections were counterstained with hematoxylin, mounted, and examined under brightfield. Red deposits indicate the sites of immunostaining. In control experiments, 1 µg human calcitonin (Sigma Chemical Co., St. Louis, MO) were incubated overnight with antibody against human calcitonin at 4 C. The antigen-antibody solution was centrifuged briefly, and the supernatant was collected and then used for incubation of endometrial sections (day 20) for immunohistochemistry, which was performed following the protocol described above.
A quantitative analysis of the immunohistochemical data was performed by image analysis. The intensity of calcitonin-specific staining was determined using a Nikon Optiphot-2 microscope (Nikon, Inc., Melville, NY) equipped with a Dage MTI video camera (CCD 72, Michigan City, IN). The video images of calcitonin signal were then digitized using a frame grabber (Quick Capture, Data Translation, Inc., Marlboro, MA) and were displayed on a Sun IPC work station (Mountain View, CA). The stained cytoplasmic areas of the glandular epithelial cells were traced. The integrated pixel intensity was determined for the traced areas using image analysis software (Image-Pro, Media Cybernetics, Silver Spring, MD). The intensities were normalized by dividing the integrated pixel intensity by the cytoplasmic area (which equaled the total number of pixels within the traced boundary). The background intensities were determined for each group by tracing an unlabeled area adjacent to the labeled cells. The background was subtracted from the values obtained for the labeled cells, and the adjusted values are referred to as the relative signal intensities. There were 30 observations for each group.
Statistical analyses
Statistical evaluations of the data representing the levels of calcitonin in endometrium on different days of the menstrual cycle and before and after treatment of mifepristone were performed using ANOVA and Fisher’s least significant differences test. P < 0.05 was considered statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Our previous studies showed that the expression of calcitonin is
markedly induced in rat uterus immediately before implantation (18, 19). To monitor the expression of calcitonin mRNA in human endometrium
during the menstrual cycle, we analyzed RNA isolated from human
endometrial biopsies for the presence of calcitonin by RT-PCR. The RNA
samples obtained from the endometrium of 14 patients on different days
of the cycle were reversed transcribed and amplified by PCR using
calcitonin gene (exon 4)-specific primers. The PCR-amplified products
were then subjected to Southern blot analysis employing a radiolabeled
human calcitonin cDNA fragment containing exon 4 as a probe. The
results depicted in Fig. 1A
(upper
panel) show that no calcitonin transcripts were detected in the
proliferative phase. A faint signal corresponding to calcitonin mRNA
appeared on day 17 of the cycle. The level of calcitonin mRNA increased
dramatically on days 19–21 and then declined to low levels by day 25
of the cycle. No signal corresponding to calcitonin mRNA was detected
beyond day 25. The relative levels of expression of calcitonin mRNA in
the endometrium on different days of the cycle were estimated by
densitometric scanning, followed by normalization with respect to the
control GAPDH mRNA signal (Fig. 1A, lower panel). A
significant level of calcitonin mRNA was observed on days 17, 19, 20,
21, and 25 of the secretory phase compared to all other days of the
cycle (Fig. 1B). As the window of implantation in the human is thought
to open between days 18–24 of the cycle, these results indicate that
calcitonin is expressed in human endometrium within the putative window
of implantation.
|
To identify the site(s) of calcitonin mRNA expression in the human
endometrium, we performed in situ hybridization analysis
with sections of endometrial specimens in the proliferative (day 8) and
midsecretory (day 20) phases of the menstrual cycle. We used a 400-bp
DIG-labeled antisense RNA probe containing sequences from the exon 4 of
the calcitonin gene. As shown in Fig. 2, a strong hybridization of the probe to the glandular epithelial cells
was observed in the sections of the midsecretory phase endometrium
(Fig. 2, B and D, respectively). In contrast, little, if any,
hybridization signal was present in the glandular epithelial cells of
the proliferative phase endometrium (Fig. 2E). Control uterine sections
(day 20) hybridized with the corresponding sense RNA probe of equal
length did not exhibit any signal demonstrating the specificity of the
hybridization reaction (Fig. 2, A and C, respectively). These results
indicated that calcitonin mRNA is induced in the human endometrium
around the midsecretory phase of the menstrual cycle and this mRNA is
present exclusively in the glandular epithelial cells.
|
, sections of an endometrial sample in
the midsecretory phase (day 20) of the menstrual cycle exhibited strong
calcitonin-specific staining. This staining was predominantly present
in the glandular epithelial cells. No significant staining was observed
in the stromal cells. Control sections of the same endometrial tissue
sample, when incubated with calcitonin antibody that has been
preabsorbed with excess human calcitonin, showed no immunoreactivity
(Fig. 3C), indicating the specificity of the immunostaining.
Interestingly, endometrial samples in the proliferative or preovulatory
phase of the cycle failed to show any immunoreactivity (Fig. 3A). These
results, like those of the in situ hybridization analysis,
suggest that calcitonin synthesis is induced in the glandular
epithelial cells of the human endometrium in a stage-specific manner
during the midsecretory phase of the menstrual cycle, the time during
which implantation of the embryo occurs.
|
Our previous studies showed that the expression of calcitonin is
regulated by progesterone in rat uterus. We therefore
examined whether calcitonin expression in the human endometrium is also
under progesterone regulation. We analyzed endometrial
biopsies from subjects before and after treatment with an
antiprogestin, mifepristone, and monitored calcitonin expression by
in situ hybridization and immunohistochemistry. The
endometrial biopsies from six healthy female volunteers were obtained
from two consecutive menstrual cycles: a control cycle and a treatment
cycle in which 200 mg mifepristone were administered 2 days after the
midcycle LH surge in urine (LH+2). An endometrial biopsy was taken 6
days after the LH surge (LH+6) in a control cycle and on the
corresponding day of the treatment cycle. Biopsies were then assessed
for the presence of calcitonin mRNA and protein by in situ
hybridization and immunohistochemistry. As shown in Fig. 4a, no signal corresponding to calcitonin
mRNA was observed when the biopsy from the control cycle was hybridized
with sense complementary RNA (cRNA) calcitonin probe (Fig. 4a, A).
However a strong signal corresponding to calcitonin mRNA was observed
when biopsy from the control cycle was hybridized with antisense cRNA
calcitonin probe (Fig. 4a, B). The staining was specifically localized
in the glandular epithelial cells. Interestingly, biopsy of the same
subject after treatment with mifepristone showed drastically reduced
calcitonin-specific staining when hybridized with an antisense cRNA
calcitonin probe (Fig. 4a, C). We also monitored calcitonin protein in
the endometrial biopsies of subjects before and after treatment with
mifepristone by immunohistochemistry. Figure 4b, A, shows intense
calcitonin-specific staining in the endometrial glands of subjects from
the control cycle. The calcitonin-specific staining declined
dramatically upon treatment with mifepristone (Fig. 4b, B). An
endometrial section from the control cycle and a section from the
mifepristone-treated cycle incubated with calcitonin antibody that was
preabsorbed with excess human calcitonin showed no immunoreactivity
(Fig. 4b, C and D, respectively), indicating the specificity of the
immunostaining. Similar results were obtained with endometrial biopsies
from all six subjects. Quantitation of protein staining by image
analysis revealed that greater than 70% of calcitonin immunoreactivity
was lost upon treatment with mifepristone (Fig. 5). Collectively, these results indicated
that calcitonin expression in the human endometrium is under
progesterone regulation.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Our previous studies in the rat and the current studies in the human
suggest that calcitonin is a candidate marker of uterine receptivity
during blastocyst implantation. A comparison of the patterns of
calcitonin expression in human and rat endometria is presented in Fig. 6. In the rat, calcitonin mRNA is
expressed at a low level in nonpregnant animals, and its expression
does not change significantly at various stages of the estrous cycle. A
burst of calcitonin is expressed in the rat endometrium immediately
preceding implantation (days 3–4). In the human, calcitonin expression
peaks on days 19–21 of the midsecretory phase of the menstrual cycle,
whereas none is detected during the preovulatory or late secretory
stage. Moreover, in situ hybridization and
immunohistochemical analyses indicated that uterine calcitonin is
synthesized predominantly in the glandular epithelium. The fact that
calcitonin is expressed in the glands tempt us to speculate that it
might be secreted into the uterine lumen. This scenario, if validated
by future experiments, may permit the development of sensitive methods
for detection (such as RIA) of this hormone in uterine secretions or
other body fluids of the human. This will give calcitonin a clear
advantage over other potential markers of uterine receptivity that are
not secreted.
|
By definition, a true marker of uterine receptivity should have a relevant functional role during the implantation process. Our recent studies in the rat using antisense ODNs indeed suggested that calcitonin performs critical functions in the endometrium to regulate uterine receptivity before implantation (20). The precise functional role of calcitonin in human endometrium remains unknown. The most well characterized physiological role of calcitonin is to regulate calcium levels in bone and kidney cells (28, 29, 30, 31, 32). In response to hypercalcemia, the thyroid gland rapidly releases calcitonin, which, in turn, lowers blood calcium by inhibiting osteoclast activity and thereby reducing bone resorption and remodeling (28, 29, 30, 31, 32). The hormone is also present in small amounts in tissues such as lung, liver, intestine, and pituitary and in the central nervous system (33). Although the precise functional role of calcitonin in these tissues remains unclear, its wide distribution throughout the body, including the central nervous system, and its presence in animals that have no bony skeleton suggest that calcitonin may possess other properties in addition to its action in bones. The common denominator in the various physiological actions of calcitonin could well be the modulation of calcium flux across the membranes of a number of different types of cells and thus of the intracellular-extracellular distribution of calcium in various systems (34). In future studies we will investigate whether calcitonin regulates uterine receptivity for blastocyst implantation by controlling calcium homeostasis within the uterus in an autocrine/paracrine manner.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received May 21, 1998.
Revised August 7, 1998.
Accepted August 18, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  S. M Krzysik-Walker, O. M Ocon-Grove, S. B Maddineni, G. L Hendricks III, and R. Ramachandran Identification of Calcitonin Expression in the Chicken Ovary: Influence of Follicular Maturation and Ovarian Steroids Biol Reprod, October 1, 2007; 77(4): 626 - 635. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Achache and A. Revel Endometrial receptivity markers, the journey to successful embryo implantation Hum. Reprod. Update, November 1, 2006; 12(6): 731 - 746. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J-W Jeong, K Y Lee, J P Lydon, and F J DeMayo Steroid hormone regulation of Clca3 expression in the murine uterus. J. Endocrinol., June 1, 2006; 189(3): 473 - 484. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Li, M. K. Bagchi, and I. C. Bagchi Identification of a Signaling Pathway Involving Progesterone Receptor, Calcitonin, and Tissue Tranglutaminase in Ishikawa Endometrial Cells Endocrinology, May 1, 2006; 147(5): 2147 - 2154. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. N. Jabbour, R. W. Kelly, H. M. Fraser, and H. O. D. Critchley Endocrine Regulation of Menstruation Endocr. Rev., February 1, 2006; 27(1): 17 - 46. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-W. Jeong, K. Y. Lee, I. Kwak, L. D. White, S. G. Hilsenbeck, J. P. Lydon, and F. J. DeMayo Identification of Murine Uterine Genes Regulated in a Ligand-Dependent Manner by the Progesterone Receptor Endocrinology, August 1, 2005; 146(8): 3490 - 3505. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. R. McDonald, N. J. Fudge, J. P. Woodrow, J. K. Friel, A. O. Hoff, R. F. Gagel, and C. S. Kovacs Ablation of calcitonin/calcitonin gene-related peptide-{alpha} impairs fetal magnesium but not calcium homeostasis Am J Physiol Endocrinol Metab, August 1, 2004; 287(2): E218 - E226. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. S. Taylor Endometrial Cells Derived From Donor Stem Cells in Bone Marrow Transplant Recipients JAMA, July 7, 2004; 292(1): 81 - 85. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Gemzell-Danielsson and L. Marions Mechanisms of action of mifepristone and levonorgestrel when used for emergency contraception Hum. Reprod. Update, July 1, 2004; 10(4): 341 - 348. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R.D. Catalano, A. Yanaihara, A.L. Evans, D. Rocha, A. Prentice, S. Saidi, C.G. Print, D.S. Charnock-Jones, A.M. Sharkey, and S.K. Smith The effect of RU486 on the gene expression profile in an endometrial explant model Mol. Hum. Reprod., August 1, 2003; 9(8): 465 - 473. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kumar, A. Brudney, Y.-P. Cheon, A. T. Fazleabas, and I. C. Bagchi Progesterone Induces Calcitonin Expression in the Baboon Endometrium Within the Window of Uterine Receptivity Biol Reprod, April 1, 2003; 68(4): 1318 - 1323. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Chegini, C. Ma, X.M. Tang, and R.S. Williams Effects of GnRH analogues, `add-back' steroid therapy, antiestrogen and antiprogestins on leiomyoma and myometrial smooth muscle cell growth and transforming growth factor-{beta} expression Mol. Hum. Reprod., December 1, 2002; 8(12): 1071 - 1078. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-P. Cheon, Q. Li, X. Xu, F. J. DeMayo, I. C. Bagchi, and M. K. Bagchi A Genomic Approach to Identify Novel Progesterone Receptor Regulated Pathways in the Uterus during Implantation Mol. Endocrinol., December 1, 2002; 16(12): 2853 - 2871. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Li, J. Wang, D. R. Armant, M. K. Bagchi, and I. C. Bagchi Calcitonin Down-regulates E-cadherin Expression in Rodent Uterine Epithelium during Implantation J. Biol. Chem., November 22, 2002; 277(48): 46447 - 46455. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Reese, S. K. Das, B. C. Paria, H. Lim, H. Song, H. Matsumoto, K. L. Knudtson, R. N. DuBois, and S. K. Dey Global Gene Expression Analysis to Identify Molecular Markers of Uterine Receptivity and Embryo Implantation J. Biol. Chem., November 16, 2001; 276(47): 44137 - 44145. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-Y. Li, S.-P. Chang, C.-C. Yuan, H.-T. Chao, H.-T. Ng, and Y.-J. Sung Nitric oxide induces extensive apoptosis in endometrial epithelial cells in the presence of progesterone: involvement of mitogen-activated protein kinase pathways Mol. Hum. Reprod., August 1, 2001; 7(8): 755 - 763. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Pavelock, K. M. Braas, L'H. Ouafik, G. Osol, and V. May Differential Expression and Regulation of the Vascular Endothelial Growth Factor Receptors Neuropilin-1 and Neuropilin-2 in Rat Uterus Endocrinology, February 1, 2001; 142(2): 613 - 622. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Gui, J. Zhang, L. Yuan, and B. A. Lessey Regulation of HOXA-10 and its expression in normal and abnormal endometrium Mol. Hum. Reprod., September 1, 1999; 5(9): 866 - 873. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||
