| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Division of Endocrinology and Metabolism, Department of Medicine (M.M.S., R.N., M.O.T.), Department of Pathology (B.L.), and Department of Neurosurgery (E.R.L.), University of Virginia Health Sciences Center, Charlottesville, Virginia 22908
Address all correspondence and requests for reprints to: Dr. Michael O. Thorner, Department of Medicine, University of Virginia Health Sciences, Box 466, Charlottesville, Virginia 22908. E-mail: mot{at}virginia.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In addition, a class of synthetic molecules, termed GH secretagogues (GHSs), act at both the pituitary and the hypothalamus to stimulate and amplify pulsatile GH release. GHSs induce the release of GHRH from arcuate neurons and act to functionally antagonize somatostatin (7, 8, 9, 10, 11, 12). The synthetic hexapeptide GHRP-6 contains D-amino acids and stimulates GH release by a pathway distinct from that of GHRH (13, 14). The nonpeptide mimetics of GHRP-6, L-692,429 and MK-0677, have improved pharmacokinetics and oral bioavailability (15). GHSs cause depolarization and inhibition of potassium channels, induce a transient increase in the concentration of intracellular calcium in somatotrophs, increase intracellular concentrations of inositol triphosphate, and increase the activity of protein kinase C (16, 17, 18, 19, 20).
Recently, a receptor was cloned and was shown to be the target of GHSs (21). Sequence analysis of the GHS receptor (GHS-R) reveals that it has seven transmembrane domains and shares only limited sequence homology with other known G protein-coupled receptors. An initial mapping study of GHS-R in human tissue revealed its expression in pituitary, hypothalamus, and hippocampus as well as a weak signal in pancreas (22). GHS-R is also expressed in human fetal pituitary tissue (23). Recently, Bennett et al. (24) showed that hypothalamic GHS-R expression was highly sensitive to GH, being markedly increased in GH-deficient dw/dw dwarf rats and decreased in dw/dw rats treated with bovine GH, suggesting that GHS-R may be involved in feedback regulation of GH.
Characterization of the GHS receptor provides evidence for the presence of an endocrine pathway distinct from that described for GHRH and somatostatin that contributes to the control of GH release. Thus, it is important to determine its expression in different pituitary cell types. X-Linked inactivation studies have demonstrated that the vast majority of pituitary tumors are monoclonal and are comprised solely of one cell type (25, 26, 27, 28), thus offering a unique opportunity to determine cell type-specific expression of GHS-R as well as to study its possible effect on tumor proliferation. It is unknown which, if any, factor selectively stimulates the clonal proliferation of pituitary tumor cells. Alterations in hormone biosynthesis and secretion as well as abnormal cell surface receptor gene expression by pituitary adenomas may provide clues to the underlying cellular mechanisms that modulate pituitary cell proliferation.
Therefore, we used a semiquantitative approach to determine the amount of GHS-R messenger ribonucleic acid (mRNA) in different pituitary tumor cell types and in nonadenomatous postmortem pituitary. As the ligands for the GHS-R behave as amplifiers of GHRH activity and functional antagonists of somatostatin, the expression of GHRH receptor (GHRH-R) and the somatostatin receptor (SSTR2) was comparatively analyzed by RT-PCR in these same tumors.
| Subjects and Methods |
|---|
|
|
|---|
Pituitary tumors were collected from 24 patients at the time of
transsphenoidal resection and were snap-frozen at -70 C until the time
of RNA preparation. These tumors were classified according to their
immunohistochemical staining for ACTH, GH, PRL, FSH, LH, and TSH. Ten
patients had tumors positive for GH (AT-1 to AT-10), nine patients had
tumors positive for FSH or LH (NT-1 to NT-9), four patients had tumors
positive for ACTH (CT-1 through CT-4), and one patient had a
TSH-positive tumor (TT-1). The clinical and pathological
characteristics of the patients and the tumors are summarized in Tables 1
and 2
.
Normal human postmortem pituitary tissue was obtained frozen from the
National Hormone Pituitary Program.
|
|
Total RNA was extracted from the GH- and TSH-secreting tumors and normal pituitary tissue using the product TriReagent (Molecular Research Center, Inc., Cincinnati, OH). Polyadenylated [poly(A)+] RNA was extracted from the nine gonadotroph adenomas and the four ACTH-secreting tumors using the QuickPrep Micro mRNA purification kit from Pharmacia Biotech (Piscataway, NJ). Quantitation of the RNA was performed by spectrophotometry using an optical density of 260 nm. The integrity of the RNA samples was tested using PCR with primers for the human glyceraldehyde 3-phosphate dehydrogenase gene (Stratagene, La Jolla, CA). Each sample produced the expected 600-bp fragment when analyzed by agarose gel electrophoresis (data not shown).
RT-PCR analysis of GHRH-R, GHS-R, and SSTR2 mRNA
For each RT reaction, either 1.25 g total RNA or 62.5 ng poly(A)+ RNA from each specimen were heated to 65 C for 5 min and then cooled on ice. The RNA was then incubated with 0.625 g oligo(deoxythymidine)15 primer (Promega Corp., Madison, WI), 2.5 L 10 mmol/L of each of the four deoxy (d)-NTPs (Promega Corp.), 5 L 100 mmol/L dithiothreitol, 10 L 5 x reaction buffer (375 mmol/L KCl, 250 mmol/L Tris-HCl, and 15 mmol/L MgCl2), and 500 U Moloney murine leukemia virus (MMuLV) reverse transcriptase (Life Technologies, Gaithersburg, MD; total reaction volume, 50 L). RT reactions were carried out at 25 C for 10 min [oligo(deoxythymidine) annealing], followed by a 60-min elongation step at 37 C and MMuLV-RT heat inactivation at 99 C for 5 min.
PCR oligonucleotide primer sets for GHRH-R, GHS-R, and SSTR2 were designed to amplify 350-, 429-, and 892-bp products, respectively. The following GHRH-R primers were used (5'-3'): MS7 TCTGAGCCCTTTCCACCTTACCCTGTG and MS8 GCTGAAGTTGGTCATGGTGGCGAAATG. Oligonucleotide primers for human GHS-R were (5'-3') MS11 CTCTGCATGCCCCTGGACCTCGTTCGC and MS12 CTGCCGATGAGACTGTAGAGGACCGTGAGAC. Oligonucleotide primers for human SSTR2 were (5'-3') MS15 GATGATCACCATGGCTGTG and MS16 CAGGCATGATCCCTCTTC. All amplifications were carried out by the following method. Ten liters of each reverse transcribed product were incubated at 95 C for 5 min with 20 pmol each of specific 5'- and 3'-oligonucleotide primers, water, and a wax bead (Perkin Elmer, Branchburg, NJ; total reaction volume, 40 L). After cooling to room temperature for 10 min, 8 L 10 x reaction buffer (100 mmol/L Tris-HCl, 15 mmol/L MgCl2, and 500 mmol/L KCl, pH 8.3), 2 L 10 mmol/L deoxy-NTPs, 2.5 U Taq DNA polymerase (Boehringer Mannheim, Indianapolis, IN), and water to a final volume of 80 L were layered on top of the wax barrier. The reactions were carried out in a DNA thermal cycler 480 (Perkin Elmer) for 40 cycles (1 min at 94 C, 1 min at 45 C, and 90 s at 72 C). The PCR products were electrophoresed on 1.0% agarose gel and visualized under UV light. Control reactions without MMuLV reverse transcriptase were also performed to exclude genomic DNA contamination as a source of amplified signal (data not shown).
Quantitation of the GHS-R using MIMIC PCR
A competitive PCR approach using a nonhomologous internal standard called a PCR MIMIC (Clontech, Palo Alto, CA) was used to analyze the level of GHS-R mRNA in normal human pituitary tissue and in human pituitary tumors. A PCR MIMIC consists of a heterologous DNA fragment with primer templates that are recognized by a pair of gene-specific primers. The template mimics the target and is amplified during PCR.
To construct the 559-bp GHS-R PCR MIMIC, two rounds of PCR amplification were performed according to the manufacturers protocol (Clontech). In the first PCR reaction, two composite primers were used (5'-3'): MS13 CTCTGCATGCCCCTGGACCTCGTTCGCCGCAAGTGAAATCTCCTCCG and MS14 CTGCCGATGAGACTGTAGAGGACCGTGAGACATTTGATTCTGGACCATGGC. Each composite primer has the GHS-R gene primer sequence attached to a 20-nucleotide stretch of sequences (underlined) designed to hybridize to opposite strands of the MIMIC DNA fragment (574-bp BamHI/EcoRI fragment of v-erbB). A dilution of the first PCR reaction was then amplified again using the GHS-R gene-specific primers MS11 and MS12 (see above). The GHS-R PCR MIMIC was purified using a CHROMA SPIN+TE-100 column (Clontech), and the yield was calculated according to manufacturers instructions. A portion of the concentrated PCR MIMIC was diluted to 100 attomol/L (equal to 6 x 107 molecules/L) from which 10-fold serial dilution stock solutions were made. The 10-2-10-7 10-fold serial dilutions (equal to 6 x 105 to 6 x 100 molecules/L, respectively) were used to titrate a constant amount of target complementary DNA (cDNA).
RT reactions were performed using tumor samples that were positive for GHS-R by RT-PCR. The reactions were performed as described above, except that 37.5 ng poly(A)+ or 0.75 g total RNA were used in a scaled reaction with a final volume of 30 L. Two liters of each serial dilution of the GHS-R PCR MIMIC were added to PCR amplification reactions containing constant amounts (2 L) of cDNA from normal pituitary or tumor samples, 5 L 10 x PCR reaction buffer [100 mmol/L Tris-HCl (pH 8.3), 500 mmol/L KCl, and 20 mmol/L MgCl2], 1 L 10 mmol/L dNTPs, 1 L 20 mol/L MS11, 1 L 20 mol/L MS12, 2 U Taq DNA polymerase (Boehringer Mannheim), and water to a final volume of 50 L. Reactions were carried out for 40 cycles (45 s at 94 C, 45 s at 50 C, 90 s at 72 C). The PCR products were electrophoresed on 1.6% agarose gel, stained with ethidium bromide, and visualized under UV light.
A 2-fold serial dilution series was made for each sample after determining which 10-fold MIMIC dilution produced PCR MIMIC and target cDNA template bands of equal intensity. The MIMIC dilution 10-fold less dilute than the dilution that gave bands of equal intensity was used to start the 2-fold serial dilutions. PCR amplification reactions were carried out as described above, except with 2 L of each 2-fold serial dilution of the GHS-R PCR MIMIC added to constant amounts (2 L) of cDNA from normal pituitary or tumor samples. By knowing the amount of GHS-R PCR MIMIC added to the reactions, the amount of GHS-R target template was determined in each sample.
| Results |
|---|
|
|
|---|
The results of the RT-PCR using primers MS11 and MS12 for the
GHS-R are shown in Fig. 1
. All 10
acromegalic tumors were positive for the 429-bp GHS-R fragment (Fig. 1A
), as were three of nine gonadotroph adenomas (Fig. 1B
, lanes 2, 5,
and 10), three of four of the ACTH-secreting tumors (Fig. 1C
, lanes 2,
4, and 5), and the TSH-secreting tumor (Fig. 1D
). The normal human
pituitary sample was also positive for the GHS-R signal (Fig. 1E
).
|
RT-PCR results for the GHRH-R are shown in Fig. 2
. Analysis of the GHRH-R mRNAs with
primers MS7 and MS8 demonstrated that the expected 350-bp PCR fragment
was detectable in all 10 acromegalic tumors (Fig. 2A
), all 9
gonadotroph adenomas (Fig. 2B
), all 4 ACTH-secreting tumors (Fig. 2C
),
the TSH-secreting tumor (Fig. 2D
), and the normal pituitary sample
(Fig. 2E
).
|
Results from the RT-PCR using primers MS15 and MS16 for SSTR2 are
shown in Fig. 3
. The 10 acromegalic tumor
samples were positive for the 892-bp fragment of SSTR2 (Fig. 3A
). Seven
of nine gonadotroph adenomas (Fig. 3B
, lanes 2, 3, 57, 9, and 10),
all four ACTH-secreting tumors (Fig. 3C
), and the TSH-secreting tumor
(Fig. 3D
) were also positive for SSTR2. The normal pituitary sample was
positive for the 892-bp fragment (Fig. 3E
).
|
Results from the GHS-R competitive PCR using 10-fold serial
dilutions of the GHS-R MIMIC are shown in Fig. 4
. Normal pituitary tissue produced MIMIC
and target cDNA template bands of equal intensity at 6 x
102 GHS-R molecules/L (Fig. 4A
, lane 4).
|
A 2-fold serial dilution series was made for each sample starting with
the MIMIC dilution 10-fold less dilute than the dilution that gave
MIMIC and target cDNA bands of equal intensity. After running the PCR
samples on an agarose gel, it was determined that 750 MIMIC molecules/L
produced a band equal in intensity to the normal pituitary sample (Fig. 5A
, lane 4).
|
| Discussion |
|---|
|
|
|---|
Whereas SSTR2 and GHRH-R gene expression have been demonstrated in pituitary adenomas (33, 34, 35), little is known about the occurrence of the GHS-R in these tumors. As the natural ligand of this receptor has not yet been found, the measurement of its receptor provides a mechanism to gather information about this system. Using RT-PCR and semiquantitative RT-PCR analysis, we present data which show that GHS-R, GHRH-R, and SSTR2 mRNA are expressed in normal human pituitary tissue and in a variety of pituitary tumors, including GH-, TSH-, and ACTH-secreting tumors, as well as nonfunctioning pituitary tumors. Specifically, a GHS-R PCR product was detected in all acromegalic tumors, in three of four ACTH-secreting tumors, and in one third of the nonfunctioning tumors. As there was only one TSH-secreting tumor, it is not possible to assess the prevalence of GHS-R mRNA in this tissue type. GHS-R mRNA expression was 200-fold higher in the somatotroph tumor and 10-fold higher in the TSH-secreting tumor than that in normal pituitary tissue. The other pituitary tumors (ACTH secreting and nonfunctioning) showed levels in the same range or lower than normal pituitary tissue. These results suggest that the somatotroph cell is the main target cell at the pituitary level for the natural ligand of the GHS-R, which plays a less important role in the development of nonsecreting tumors.
The presence of GHS-R mRNA in somatotroph cells suggests that GHSs can act directly on pituitary cells to stimulate GH release. This result concurs with earlier demonstrations that the GHSs are able to directly stimulate GH release from rat primary pituitary cells in vitro (36) and in acromegalic subjects (37). In addition, Renner et al. (38) showed that GH secretion was stimulated by the secretagogue GHRP-6 in 100% of 12 different somatotroph adenoma cell cultures, whereas only a subset of the adenomas responded to GHRH, TRH, or octreotide. This suggests that GHS-R and its signaling pathway are expressed more consistently in somatotroph adenoma cells than are receptors and signaling pathways for GHRH, TRH, and somatostatin. In a recent report by Adams et al. (39), GHS-R mRNA was detected in 6 human pituitary somatotropinomas by RT-PCR, 4 of which hydrolyzed phosphatidylinositol and secreted GH in response to GHRP-2 in vitro. In addition, 3 prolactinomas expressed GHS-R, with 2 of the tumors showing significant stimulation of PRL secretion and phosphatidylinositol hydrolysis in culture. The rat pituitary tumor cell line GH3 was also found to express GHS-R mRNA, but these cells did not respond to GHRPs. This group was unable to detect GHS-R mRNA in 8 functionless human pituitary tumors. The RT-PCR results of the 6 somatotropinomas are consistent with our RT-PCR data that all somatotroph adenomas are positive for GHS-R. Our semiquantitative data also demonstrate that the receptor is expressed at a much higher level in somatotroph adenomas than in normal pituitary, which consists of a mixture of cell types. We were, however, able to detect GHS-R in 1 of 3 gonadotroph tumors by RT-PCR. When examined by semiquantitative competitive PCR, the gonadotroph tumor NT-1 had only 300 GHS-R molecules/µL. This is 2.5-fold fewer than the 750 GHS-R molecules/µL observed in normal pituitary tissue. Perhaps it is the low level of GHS-R in gonadotroph tumors that caused this discrepancy in results. We also detected GHS-R in 75% of ACTH-secreting tumors and in 1 TSH-secreting tumor. The ACTH-secreting tumor CT-4 had 750 GHS-R molecules/µL, equal to that in normal pituitary, whereas the TSH-secreting tumor expressed GHS-R at levels 10-fold higher than normal. These results are consistent with our findings that not only are all somatotroph adenomas positive for GHS-R, but the receptor is expressed at a much higher level than in normal pituitary, which consists of a mixture of cell types.
However, the other pituitary tumors (ACTH secreting and nonfunctioning) showed GHS-R levels in the same range or lower than those in normal pituitary tissue. The existence of increased levels of GHS-R in somatotroph adenomas might explain why patients with acromegaly exhibit major GH discharges to GHRP despite the fact that high GH levels decrease GHS-R in the hypothalamus (24), but only some patients respond similarly to GHRH (40). This suggests a lack of GHS-R down-regulation in the neoplastic somatotroph that has been previously described for the GHRH-R (41, 42). Thapar et al. (42) also demonstrated that overexpression of the GHRH gene in the pituitary is associated with neoplastic progression and clinical aggressiveness of somatotroph adenomas. Whether such a potential role exists for the natural ligand of the GHS-R in the development of somatotroph adenomas requires further study.
Our observation that GHS-R mRNA is present in 75% of the ACTH-secreting pituitary tumors is consistent with the findings of animal and human studies, which showed that the administration of GH secretagogues increased ACTH and cortisol levels (43, 44). Ghigo and colleagues (44) have speculated that 1) the ACTH-releasing activity of GHRP might be used in differentiating pituitary from ectopic ACTH-dependent Cushings syndrome; and 2) GHRP stimulates at least in part ACTH in Cushings disease, independent of CRH-mediated mechanisms. Our results support the latter conclusion. However, as not all ACTH-secreting adenomas expressed GHS-R mRNA, the utility of GHRP as a diagnostic tool to differentiate between ectopic and pituitary tumors is questionable.
Measurement of GHS-R and the assignment of this receptor to different tumor types may lead to the selective use of a receptor-antagonist as seen with the competitive antagonist of GHRH, (N-Ac-Tyr1,D-Arg2)GHRH-(129)NH2, which suppressed the GH concentration in a patient with acromegaly and ectopic GHRH secretion (45), and the GHRH antagonists MZ-4-71 and MZ-5-156, which inhibited elevated GH levels caused by overproduction of human GHRH in transgenic mice (46). Therefore, the demonstration of the GHS-R and its quantification might provide valuable information for future therapeutic approaches in the medical treatment of somatotroph pituitary adenomas.
The quantitative screening of a large number of pituitary tumors and correlation with clinical outcome will provide further information about the involvement of the GHS/GHS-R system in the development and neoplastic progression of pituitary adenomas.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received June 15, 1998.
Revised August 19, 1998.
Accepted August 31, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H D. Falls, B. D Dayton, D. G Fry, C. A Ogiela, V. G Schaefer, S. Brodjian, R. M Reilly, C. A Collins, and W. Kaszubska Characterization of ghrelin receptor activity in a rat pituitary cell line RC-4B/C. J. Mol. Endocrinol., August 1, 2006; 37(1): 51 - 62. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. D. Dixit, A. T. Weeraratna, H. Yang, D. Bertak, A. Cooper-Jenkins, G. J. Riggins, C. G. Eberhart, and D. D. Taub Ghrelin and the Growth Hormone Secretagogue Receptor Constitute a Novel Autocrine Pathway in Astrocytoma Motility J. Biol. Chem., June 16, 2006; 281(24): 16681 - 16690. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Martinez-Fuentes, J. Moreno-Fernandez, R. Vazquez-Martinez, M. Duran-Prado, A. de la Riva, M. Tena-Sempere, C. Dieguez, L. Jimenez-Reina, S. M. Webb, A. Pumar, et al. Ghrelin Is Produced by and Directly Activates Corticotrope Cells from Adrenocorticotropin-Secreting Adenomas J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2225 - 2231. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Tolle, M.-H. Bassant, P. Zizzari, F. Poindessous-Jazat, C. Tomasetto, J. Epelbaum, and M.-T. Bluet-Pajot Ultradian Rhythmicity of Ghrelin Secretion in Relation with GH, Feeding Behavior, and Sleep-Wake Patterns in Rats Endocrinology, April 1, 2002; 143(4): 1353 - 1361. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Murata, Y. Okimura, K. Iida, M. Matsumoto, H. Sowa, H. Kaji, M. Kojima, K. Kangawa, and K. Chihara Ghrelin Modulates the Downstream Molecules of Insulin Signaling in Hepatoma Cells J. Biol. Chem., February 8, 2002; 277(7): 5667 - 5674. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Brinkmeier, J. H. Stahl, D. F. Gordon, B. D. Ross, V. D. Sarapura, J. M. Dowding, S. K. Kendall, R. V. Lloyd, E. C. Ridgway, and S. A. Camper Thyroid Hormone-Responsive Pituitary Hyperplasia Independent of Somatostatin Receptor 2 Mol. Endocrinol., December 1, 2001; 15(12): 2129 - 2136. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Petersenn, A. C. Rasch, M. Penshorn, F. U. Beil, and H. M. Schulte Genomic Structure and Transcriptional Regulation of the Human Growth Hormone Secretagogue Receptor Endocrinology, June 1, 2001; 142(6): 2649 - 2659. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-d. Peng, S. Park, M. R. Gadelha, K. T. Coschigano, J. J. Kopchick, L. A. Frohman, and R. D. Kineman The Growth Hormone (GH)-Axis of GH Receptor/Binding Protein Gene-Disrupted and Metallothionein-Human GH-Releasing Hormone Transgenic Mice: Hypothalamic Neuropeptide and Pituitary Receptor Expression in the Absence and Presence of GH Feedback Endocrinology, March 1, 2001; 142(3): 1117 - 1123. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Korbonits, S. A. Bustin, M. Kojima, S. Jordan, E. F. Adams, D. G. Lowe, K. Kangawa, and A. B. Grossman The Expression of the Growth Hormone Secretagogue Receptor Ligand Ghrelin in Normal and Abnormal Human Pituitary and Other Neuroendocrine Tumors J. Clin. Endocrinol. Metab., February 1, 2001; 86(2): 881 - 887. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |