| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Departments of Medicine (I.L., X.Y., T.C.F., S.M.), and Obstetrics and Gynecology (D.A.M.), Cedars-Sinai Research Institute-University of California School of Medicine, Los Angeles, California 90048
Address all correspondence and requests for reprints to: Shlomo Melmed, M.D., Academic Affairs, Cedars-Sinai Medical Center, 8700 Beverly Boulevard, Rm 2015, Los Angeles, California 90048. E-mail: melmed{at}csmc.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The human fetal pituitary expresses GH abundantly from 8 weeks gestation, when well differentiated somatotrophs can be identified (10, 11). Human fetal pituitary cells, including somatotrophs, are responsive to hypothalamic releasing and inhibitory factors as early as 1014 weeks (11, 12). Adult pituitary GH is affected by metabolic status and body mass; thus, human GH is suppressed in obesity, and after weight loss, GH secretion is restored (13). As GH release is also modified physiologically by glycemic status, we used our in vitro model of human fetal pituitary to study interactions between leptin and GH and to assess differences in the expression of leptin receptor isoforms in adult human pituitary vs. fetal and adenomatous tissues.
| Materials and Methods |
|---|
|
|
|---|
Recombinant human leptin and LH-releasing hormone (LHRH) were obtained from Peninsula Laboratories, Inc. (Belmont, CA). In addition, experiments were performed using human leptin cloned and expressed using ribonucleic acid (RNA) extracted from a specimen of human abdominal fat. Complementary DNA (cDNA) was then amplified from reverse transcribed messenger RNA (mRNA) using PCR primers incorporating BamHI and KpnI end restriction sites. The amplified product was gel purified, extracted, and ligated into pGE30. After sequencing, the leptin protein was expressed in bacterial culture, purified, and renatured through successive dialysis against decreasing concentrations of urea and then phosphate-buffered saline. The leptin yielded (10 mg protein) was at least 99% pure, as judged by SDS-PAGE.
Human pituitary tissue
Human fetal pituitary glands (1833 weeks gestation) were obtained from an independent facility, with no direct or indirect involvement of our investigators in third party pregnancy termination referral. Studies of human tissues followed the guidelines of the National Advisory Board on Ethics in Reproduction (14), and written informed consent was obtained. Normal adult human pituitary glands were purchased from Zion Diagnostics (New York, NY). Pituitary adenomas (secreting and nonfunctional) were obtained at the time of transsphenoidal surgery. The collection and use of tumor samples were in accordance with the guidelines of the local committee on human research.
Human pituitary OB-R expression
Three normal adult human pituitary glands and two fetal pituitaries (18 and 31 weeks gestation) were harvested and kept at -70 C for RNA extraction. Tissues were homogenized, and total RNA was extracted using TRIzol (Life Technologies, Grand Island, NY). RT followed by PCR amplification to detect human OB-R receptor was performed as previously described (15). Briefly, 1 µg of each RNA sample was treated with deoxyribonuclease I (amplification grade; Life Technologies) to eliminate contaminating genomic DNA. RNA was reverse transcribed in a 20-µL RT reaction containing oligo(deoxythymidine)16 as a primer and SuperScript II (Life Technologies). RT incubations were performed for 50 min at 42 C. Samples were also incubated without RT enzyme as negative controls. Aliquots (1 µL) from the generated cDNA and the negative control reactions were used for subsequent PCR amplification in the presence of 2.5 mmol/L MgCl2 (1.5 mmol/L for the OB-R extracellular region and the short isoform, 12.1) and 5 U Taq DNA polymerase (Life Technologies) in 50-µL reaction volumes. Amplifications were carried out for 37 cycles (40 cycles for the extracellular domain), with an initial denaturation step at 95 C for 5 min and a final 7-min extension step at 72 C. Each cycle consisted of denaturation at 94 C, annealing at 59 C (55 C for OB-R extracellular domain amplification), and elongation at 72 C (each step for 1 min).
The following primer set was used for human OB-R extracellular domain amplification: 5'-GTCAGAAGATGTGGGAAA (nucleotides 22662283) and 3'- GTGCCCAGGAACAATTCTT (nucleotides 28282846; GenBank accession no. U43168). For the other PCR reactions we used a common 5'-primer located before the splicing point of human OB-R: ATCCCCATTGAGAAGTACCAG (nucleotides 25972617). The 3'-primers used with this common primer were: the intact (long) isoform, GGCCTCATAGGTTACCTCAG (nucleotides 31023121); the 6.4 isoform, ACTGTTGGGAAGTTGGCACA (nucleotides 29172936; GenBank, U66495); and the 12.1 short isoform, GCAGGGTCATAGGACAATAG (nucleotides 30173036; GenBank, U66496). The PCR products thus generated are 581 bp (extracellular domain), 525 bp (long isoform), and 340 and 440 bp (short isoforms), and they were digested by Sau3AI, EcoRV, AluI, and AvaII, respectively (all obtained from Life Technologies), and visualized with ethidium bromide after electrophoresis on 2% agarose gels. In addition, we used another set of primers to study the OB-R long isoform expression in pituitary adenomas: 5'-GAAGATGTTCCGAACCCCAAGAAT (nucleotides 28102833) and 3'- CTAGAGAAGCACTTGGTGACTGAA (nucleotides 32143237); the corresponding generated PCR product was 428 bp. Primers and PCR conditions for GH cDNA amplification (279-bp product) were previously described (15).
Primary pituitary cell culture
Fetal specimens were harvested within 12 h of the termination procedure. The fetal and adenoma tissues collected were washed in low glucose DMEM supplemented with 0.3% BSA, 2 mmol/L glutamine, and penicillin/streptomycin, then minced and enzymatically dissociated using 0.35% collagenase and 0.1% hyaluronidase (both from Sigma Chemical Co., Inc., St. Louis, MO) for 60 min. Cell suspensions were filtered and resuspended in low glucose DMEM supplemented with 10% FBS, glutamine, and antibiotics. For primary cultures, about 5 x 104 cells were seeded in 48-well tissue culture plates (Costar, Cambridge, MA) in 0.5 mL medium and incubated for 7296 h in a humidified atmosphere of 95% air-5% CO2, at 37 C. Medium was then changed to serum-free defined low glucose DMEM containing 0.2% BSA, 120 nmol/L transferrin, 100 nmol/L hydrocortisone, 0.6 nmol/L T3, 5 U/L insulin, 3 nmol/L glucagon, 50 nmol/L PTH, 2 mmol/L glutamine, 15 nmol/L epidermal growth factor, and antibiotics, and cells were treated for 8 or 16 h with recombinant human leptin (0.1, 1, 3, 6, 10, and 100 nmol/L; six to eight wells for each treatment group). Controls were treated with vehicle solution. Experiments were also performed in the presence of LHRH (10 nmol/L). After treatments, media were collected and stored at -20 C for later hormone measurements.
Hormone assays
For human GH and ACTH measurements we used RIA kits from Diagnostics Products Corp. (Los Angeles, CA), after appropriate dilutions (1:3 to 1:10) of conditioned medium. Human PRL, LH, and FSH were measured by immunoradiometric assays purchased from Diagnostics Products Corp.
Statistical analysis
Results are expressed as the mean ± SEM. Differences were assessed by unpaired t test, and P < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
RNA extracted from three human adult pituitaries and from two
fetal pituitaries (18 and 31 weeks gestation) was subjected to RT
followed by PCR amplification. Results of the PCR revealed the presence
of the extracellular domain of human OB-R in both adult and fetal
pituitaries (581-bp DNA products; Fig. 1A
). The specificity of the expressed
bands was confirmed by incubation with Sau3A1, appropriately
digesting the 581-bp bands representing the OB-R extracellular region
to the expected 322- and 259-bp restriction products (Fig. 1A
). When
reactions without RT were amplified by PCR, no bands were observed. To
verify the pituitary origin of the mRNA, GH expression was confirmed in
these tissues, as reflected by a 279-bp PCR product, as expected (Fig. 1A
). The intact OB-R isoform (long isoform mRNA of 3800 bp) containing
the intracellular signaling domain (4) is expressed (525-bp PCR
products) in human fetal pituitaries (both 18 and 31 weeks gestation),
but not in adult human pituitary tissues (Fig. 1B
). These DNA products
are specifically digested with EcoRV to the expected 358-
and 167-bp products (Fig. 1B
). We found that human pituitaries (both
fetal and adult) also express the two short leptin receptor splice
variant forms (9). Figure 1C
depicts mRNA expression of the 2977-bp
(6.4 mRNA) isoform (340-bp PCR products) in normal adult and 18- and
31-week-old fetal glands, specifically digested by AluI to
the two expected restriction products (203 and 137 bp). Figure 1D
shows
expression of the other OB-R splice variant, designated 12.1 mRNA (3100
bp), in both adult and fetal human glands (440 bp, digested as expected
by AvaII to 358- and 82-bp short bands). Thus, these RT-PCR
studies show that adult human pituitaries only express short splice
variants of OB-R containing the extracellular binding domain and the
truncated intracytoplasmic region without Janus kinase or STAT
signaling ability. In contrast, human fetal pituitary mRNAs contain the
long OB-R isoform with the intact intracellular signaling domain in
addition to the short OB-R variants.
|
RNAs extracted from 5 GH-secreting, 9 PRL-secreting, 3
ACTH-secreting adenomas, and 29 nonfunctioning human pituitary tumors
were used (Table 1
) for RT-PCR to study
OB-R expression. RNAs derived from 3 normal pituitaries served as
negative controls, and fetal pituitary (22 weeks gestation) was the
positive control (Table 1
). For these experiments we used a new set of
primers for the intact OB-R (428-bp PCR product) and similar primers
for the short 6.4 isoform (340-bp DNA band). Figure 2A
and Table 1
depict mRNA expression of
the intact OB-R isoform in 4 of 5 GH-secreting, all 9 PRL-secreting,
and 26 of 29 nonfunctioning adenomas as well as in fetal pituitary
tissue. In contrast, normal adult pituitaries and ACTH-secreting
adenomas did not express this long receptor isoform. Using the new set
of primers for the intact OB-R further confirmed our previous
observations that the long isoform is expressed in fetal, but not
adult, tissues. Expression of the 6.4 short isoform was found in almost
all tumor tissues studied, except for one third of the nonfunctioning
tumors (Table 1
and Fig. 2B
).
|
|
We used recombinant human leptin to study in vitro
effects of this hormone on human fetal pituitary cells. After 16-h
incubations, leptin (36 nmol/L) specifically stimulated GH release
from human fetal pituitary cultures by 4090% (P <
0.05; Fig. 3
). Other pituitary hormone
concentrations, including PRL, LH, FSH (with and without added LHRH),
and ACTH, were not altered by incubation with human leptin (Fig. 3
).
The maximal GH stimulatory effect was achieved in somatotrophs derived
from 22-week gestation fetal pituitary, and this induction decreased
with increasing fetal age, ultimately disappearing when cells derived
from third trimester pituitary were incubated with leptin (Fig. 4
). In contrast to fetal somatotrophs,
GH- and PRL-secreting adenoma cells did not respond to leptin
stimulation by increasing GH or PRL release into the cell culture
medium.
|
|
| Discussion |
|---|
|
|
|---|
In mice, the long intact isoform of OB-R is detected mainly in the hypothalamus (5, 18), consistent with the known role of leptin in body weight regulation and food intake, mediated via the arcuate, ventromedial, and lateral intrahypothalamic nuclei. Recently, expression of the OB-R extracellular domain was detected in the rat anterior pituitary (19). However, other extrapituitary tissues, including lung and kidney, mainly express short isoforms of OB-R (5), but only very low levels of intact OB-R. The functional role and importance of the OB-R short splice variants is unknown, as these truncated isoforms lack the critical intracellular signal transduction domains. Interestingly, using RT-PCR we demonstrated expression of the long OB-R isoform outside the human hypothalamus in fetal pituitaries, but not in adult pituitary tissues. Moreover, most human pituitary adenomas studied also expressed this intact OB-R receptor. However, all tissues, including adult, fetal, and pituitary tumors, express the short nonsignaling forms of the human receptor. These data suggest that the intact receptor splice variant may be associated with fetal pituitary development and dedifferentiation, disappearing in adult and normally functioning human pituitary tissue.
Leptin is involved in pathways other than energy metabolism, including fertility (20), and has in vitro and in vivo effects on pituitary hormone secretion in rodents. In vitro, leptin stimulates gonadotropins and PRL release from rat pituitaries (21), and administration of leptin to rodents results in early puberty onset (22, 23) and elevation of gonadotropin levels (21, 24). Peripheral leptin may influence other pituitary hormones. Serum ACTH and cortisol were shown to be inversely related to leptin levels in humans (25). Leptin antiserum decreases GH release in normal rats (26), whereas intracerebroventricular injection of leptin into fasted rats enhanced GH levels (26). However, exogenous leptin has no effect on GH in normal fed rats and no direct effect on cultured rat pituitaries (26). Moreover, leptin can suppress in vitro hypothalamic somatostatin synthesis and secretion (27). Thus, these data suggest in vivo signaling of rodent GH by leptin, although the site of action is unclear.
As we detected the long OB-R isoform in fetal pituitaries and in most pituitary adenomas, and this isoform is believed to transduce leptin signaling, we studied the possibility that leptin has direct actions on human fetal pituitary hormones or secreting adenomas. As fetal GH was specifically stimulated by leptin, leptin and GH may have interacting roles in intrauterine energy balance and regulation. The limited number of GH-secreting adenomas tested precludes a definitive conclusion regarding their in vitro leptin responsiveness. Fasting decreases both circulating leptin (28) and GH levels (29) in rodents, whereas feeding enhances both hormone levels. Adult human GH deficiency is associated with a decrease in body muscle mass and an increase in sc fat mass (30). Moreover, GH replacement therapy decreases fat mass in these patients while increasing lean body mass (31). Similarly, leptin replacement in ob/ob mice with total leptin deficiency also decreases body fat mass (2, 32). Thus, as leptin stimulates fetal GH release, GH may augment or mediate the metabolic effects exerted by leptin in utero. Recently, human leptin levels in umbilical cord blood at delivery were shown to correlate with birth weight (33, 34). Moreover, fetal GH receptors have been well characterized on several tissues (35, 36), indicating that in utero leptin may affect GH-mediated intrauterine growth patterns.
Interestingly, we have previously shown that IL-6 and other leptin-related cytokines stimulate human fetal ACTH as well as GH secretion (15). Thus, in utero, leptin and cytokines dependent on related receptors have similar signaling capabilities, resulting in enhanced secretion of human GH. Leptin-mediated fetal somatotroph function is thus a further determinant of intrauterine fetal pituitary cytokine response. In addition to the well known regulators of GH, GHRH, somatostatin, and insulin-like growth factor I, novel peptides, including GH-releasing peptides (37) and leptin, appear to participate in the complex regulation of human fetal GH secretion. Fetal GH, which participates in metabolic and prenatal somatic development as well as homeostasis, is therefore regulated by integrated neuroendocrine hormonal and cytokine signals.
| Footnotes |
|---|
2 Charles. E. Culpeper fellow. ![]()
Received April 9, 1998.
Revised July 7, 1998.
Accepted July 20, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. J. Forhead and A. L. Fowden The hungry fetus? Role of leptin as a nutritional signal before birth J. Physiol., March 15, 2009; 587(6): 1145 - 1152. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Veldhuis, J. N. Roemmich, E. J. Richmond, A. D. Rogol, J. C. Lovejoy, M. Sheffield-Moore, N. Mauras, and C. Y. Bowers Endocrine Control of Body Composition in Infancy, Childhood, and Puberty Endocr. Rev., February 1, 2005; 26(1): 114 - 146. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Anderson, S. Jeftinija, and C. G. Scanes Growth Hormone Secretion: Molecular and Cellular Mechanisms and In Vivo Approaches Experimental Biology and Medicine, April 1, 2004; 229(4): 291 - 302. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. A. McDuffie, N. Akhter, and G. V. Childs Regulation of Leptin mRNA and Protein Expression in Pituitary Somatotropes J. Histochem. Cytochem., February 1, 2004; 52(2): 263 - 273. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Watanobe Leptin directly acts within the hypothalamus to stimulate gonadotropin-releasing hormone secretion in vivo in rats J. Physiol., November 15, 2002; 545(1): 255 - 268. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Watanobe and S. Habu Leptin Regulates Growth Hormone-Releasing Factor, Somatostatin, and alpha -Melanocyte-Stimulating Hormone But Not Neuropeptide Y Release in Rat Hypothalamus In Vivo: Relation with Growth Hormone Secretion J. Neurosci., July 15, 2002; 22(14): 6265 - 6271. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Ahmad, R. Guzder, A. M. Wallace, J. Thomas, W. D. Fraser, and J. P. Vora Circadian and Ultradian Rhythm and Leptin Pulsatility in Adult GH Deficiency: Effects of GH Replacement J. Clin. Endocrinol. Metab., August 1, 2001; 86(8): 3499 - 3506. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lacroix, N. N'Diaye, J. Tremblay, and P. Hamet Ectopic and Abnormal Hormone Receptors in Adrenal Cushing's Syndrome Endocr. Rev., February 1, 2001; 22(1): 75 - 110. [Abstract] [Full Text] |
||||
![]() |
R. Heptulla, A. Smitten, B. Teague, W. V. Tamborlane, Y.-Z. Ma, and S. Caprio Temporal Patterns of Circulating Leptin Levels in Lean and Obese Adolescents: Relationships to Insulin, Growth Hormone, and Free Fatty Acids Rhythmicity J. Clin. Endocrinol. Metab., January 1, 2001; 86(1): 90 - 96. [Abstract] [Full Text] |
||||
![]() |
M. C. Henson and V. D. Castracane Leptin in Pregnancy Biol Reprod, November 1, 2000; 63(5): 1219 - 1228. [Abstract] [Full Text] |
||||
![]() |
J. Iqbal, S. Pompolo, R. V. Considine, and I. J. Clarke Localization of Leptin Receptor-Like Immunoreactivity in the Corticotropes, Somatotropes, and Gonadotropes in the Ovine Anterior Pituitary Endocrinology, April 1, 2000; 141(4): 1515 - 1520. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Hileman, D. D. Pierroz, and J. S. Flier Leptin, Nutrition, and Reproduction: Timing Is Everything J. Clin. Endocrinol. Metab., February 1, 2000; 85(2): 804 - 807. [Full Text] |
||||
![]() |
L. Jin, S. Zhang, B. G. Burguera, M. E. Couce, R. Y. Osamura, E. Kulig, and R. V. Lloyd Leptin and Leptin Receptor Expression in Rat and Mouse Pituitary Cells Endocrinology, January 1, 2000; 141(1): 333 - 339. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Jin, B. G. Burguera, M. E. Couce, B. W. Scheithauer, J. Lamsan, N. L. Eberhardt, E. Kulig, and R. V. Lloyd Leptin and Leptin Receptor Expression in Normal and Neoplastic Human Pituitary: Evidence of a Regulatory Role for Leptin on Pituitary Cell Proliferation J. Clin. Endocrinol. Metab., August 1, 1999; 84(8): 2903 - 2911. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |