help button home button Endocrine Society JCEM JCEM Call for Nominations for EIC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shimon, I.
Right arrow Articles by Melmed, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shimon, I.
Right arrow Articles by Melmed, S.
The Journal of Clinical Endocrinology & Metabolism Vol. 83, No. 11 4059-4064
Copyright © 1998 by The Endocrine Society


Original Studies

Intact Leptin Receptor Is Selectively Expressed in Human Fetal Pituitary and Pituitary Adenomas and Signals Human Fetal Pituitary Growth Hormone Secretion1

Ilan Shimon, Xinmin Yan, Denis A. Magoffin, Theodore C. Friedman2 and Shlomo Melmed

Departments of Medicine (I.L., X.Y., T.C.F., S.M.), and Obstetrics and Gynecology (D.A.M.), Cedars-Sinai Research Institute-University of California School of Medicine, Los Angeles, California 90048

Address all correspondence and requests for reprints to: Shlomo Melmed, M.D., Academic Affairs, Cedars-Sinai Medical Center, 8700 Beverly Boulevard, Rm 2015, Los Angeles, California 90048. E-mail: melmed{at}csmc.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Leptin, a circulating hormone secreted by adipocytes, communicates peripheral nutritional status to hypothalamic centers affecting satiety, energy expenditure, and body weight. The intact leptin receptor (OB-R), a single membrane-spanning peptide containing an approximately 300-amino acid intracellular domain, is highly expressed in the hypothalamus, whereas shorter OB-R isoforms with truncated cytoplasmic regions resulting from alternative splicing have also been identified. We studied expression of OB-R isoforms in human fetal pituitaries, adult anterior pituitaries, and human pituitary adenomas. Using RT-PCR, messenger ribonucleic acid expression of the OB-R intact isoform was detected in fetal anterior pituitary tissues, but not in adult anterior pituitary glands, whereas both fetal and adult tissues expressed the short forms. Messenger ribonucleic acid of both intact and short OB-R isoforms were expressed in 4 of 5 GH-secreting, all 9 PRL-secreting, and 26 of 29 nonfunctioning pituitary adenomas. Recombinant human leptin (3–6 nmol/L) specifically stimulated GH secretion from primary human fetal pituitary cultures by 40–90% (P < 0.05) without altering fetal ACTH, PRL, or gonadotropin secretion. Thus, the intact OB-R is selectively expressed in human fetal and adult pituitary tumor tissues, but not in normal adult pituitary. Leptin specifically stimulates GH release from normal fetal somatotrophs, substantiating the functionality of its intact receptor in the fetal pituitary. Thus, pituitary adenomas appear to revert to a fetal phenotype of leptin receptor expression.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
LEPTIN, an adipocyte-derived 16-kDa peptide hormone, is the product of the ob gene, (1). This 167-amino acid predicted protein, absent in obese (ob/ob) mice, is secreted to the circulation and has a critical role in signaling specific hypothalamic centers regarding available energy in peripheral adipose tissue, thus affecting food intake, body mass, metabolic rate, activity level, and body temperature (2, 3). This closed feedback system loop, the adipostat, depends on the expression of a specific receptor in the central nervous system. The leptin receptor (OB-R), cloned from mouse choroid plexus and human infant brain (4), is highly expressed in the hypothalamus (5) and exhibits structural and functional similarity to members of the class I cytokine receptor superfamily (6). The intact OB-R is a single membrane-spanning peptide, containing an approximately 300-amino acid intracellular domain with several known signal transduction sequence motifs, including Janus kinase and STAT (signal transducer and activator of transcription) and activation boxes (6, 7, 8). Several alternatively spliced short OB-R isoforms with truncated cytoplasmic regions have been identified in several tissues (9). These isoforms lack known signaling sequence motifs, and their physiological roles are unclear.

The human fetal pituitary expresses GH abundantly from 8 weeks gestation, when well differentiated somatotrophs can be identified (10, 11). Human fetal pituitary cells, including somatotrophs, are responsive to hypothalamic releasing and inhibitory factors as early as 10–14 weeks (11, 12). Adult pituitary GH is affected by metabolic status and body mass; thus, human GH is suppressed in obesity, and after weight loss, GH secretion is restored (13). As GH release is also modified physiologically by glycemic status, we used our in vitro model of human fetal pituitary to study interactions between leptin and GH and to assess differences in the expression of leptin receptor isoforms in adult human pituitary vs. fetal and adenomatous tissues.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Peptides

Recombinant human leptin and LH-releasing hormone (LHRH) were obtained from Peninsula Laboratories, Inc. (Belmont, CA). In addition, experiments were performed using human leptin cloned and expressed using ribonucleic acid (RNA) extracted from a specimen of human abdominal fat. Complementary DNA (cDNA) was then amplified from reverse transcribed messenger RNA (mRNA) using PCR primers incorporating BamHI and KpnI end restriction sites. The amplified product was gel purified, extracted, and ligated into pGE30. After sequencing, the leptin protein was expressed in bacterial culture, purified, and renatured through successive dialysis against decreasing concentrations of urea and then phosphate-buffered saline. The leptin yielded (10 mg protein) was at least 99% pure, as judged by SDS-PAGE.

Human pituitary tissue

Human fetal pituitary glands (18–33 weeks gestation) were obtained from an independent facility, with no direct or indirect involvement of our investigators in third party pregnancy termination referral. Studies of human tissues followed the guidelines of the National Advisory Board on Ethics in Reproduction (14), and written informed consent was obtained. Normal adult human pituitary glands were purchased from Zion Diagnostics (New York, NY). Pituitary adenomas (secreting and nonfunctional) were obtained at the time of transsphenoidal surgery. The collection and use of tumor samples were in accordance with the guidelines of the local committee on human research.

Human pituitary OB-R expression

Three normal adult human pituitary glands and two fetal pituitaries (18 and 31 weeks gestation) were harvested and kept at -70 C for RNA extraction. Tissues were homogenized, and total RNA was extracted using TRIzol (Life Technologies, Grand Island, NY). RT followed by PCR amplification to detect human OB-R receptor was performed as previously described (15). Briefly, 1 µg of each RNA sample was treated with deoxyribonuclease I (amplification grade; Life Technologies) to eliminate contaminating genomic DNA. RNA was reverse transcribed in a 20-µL RT reaction containing oligo(deoxythymidine)16 as a primer and SuperScript II (Life Technologies). RT incubations were performed for 50 min at 42 C. Samples were also incubated without RT enzyme as negative controls. Aliquots (1 µL) from the generated cDNA and the negative control reactions were used for subsequent PCR amplification in the presence of 2.5 mmol/L MgCl2 (1.5 mmol/L for the OB-R extracellular region and the short isoform, 12.1) and 5 U Taq DNA polymerase (Life Technologies) in 50-µL reaction volumes. Amplifications were carried out for 37 cycles (40 cycles for the extracellular domain), with an initial denaturation step at 95 C for 5 min and a final 7-min extension step at 72 C. Each cycle consisted of denaturation at 94 C, annealing at 59 C (55 C for OB-R extracellular domain amplification), and elongation at 72 C (each step for 1 min).

The following primer set was used for human OB-R extracellular domain amplification: 5'-GTCAGAAGATGTGGGAAA (nucleotides 2266–2283) and 3'- GTGCCCAGGAACAATTCTT (nucleotides 2828–2846; GenBank accession no. U43168). For the other PCR reactions we used a common 5'-primer located before the splicing point of human OB-R: ATCCCCATTGAGAAGTACCAG (nucleotides 2597–2617). The 3'-primers used with this common primer were: the intact (long) isoform, GGCCTCATAGGTTACCTCAG (nucleotides 3102–3121); the 6.4 isoform, ACTGTTGGGAAGTTGGCACA (nucleotides 2917–2936; GenBank, U66495); and the 12.1 short isoform, GCAGGGTCATAGGACAATAG (nucleotides 3017–3036; GenBank, U66496). The PCR products thus generated are 581 bp (extracellular domain), 525 bp (long isoform), and 340 and 440 bp (short isoforms), and they were digested by Sau3AI, EcoRV, AluI, and AvaII, respectively (all obtained from Life Technologies), and visualized with ethidium bromide after electrophoresis on 2% agarose gels. In addition, we used another set of primers to study the OB-R long isoform expression in pituitary adenomas: 5'-GAAGATGTTCCGAACCCCAAGAAT (nucleotides 2810–2833) and 3'- CTAGAGAAGCACTTGGTGACTGAA (nucleotides 3214–3237); the corresponding generated PCR product was 428 bp. Primers and PCR conditions for GH cDNA amplification (279-bp product) were previously described (15).

Primary pituitary cell culture

Fetal specimens were harvested within 1–2 h of the termination procedure. The fetal and adenoma tissues collected were washed in low glucose DMEM supplemented with 0.3% BSA, 2 mmol/L glutamine, and penicillin/streptomycin, then minced and enzymatically dissociated using 0.35% collagenase and 0.1% hyaluronidase (both from Sigma Chemical Co., Inc., St. Louis, MO) for 60 min. Cell suspensions were filtered and resuspended in low glucose DMEM supplemented with 10% FBS, glutamine, and antibiotics. For primary cultures, about 5 x 104 cells were seeded in 48-well tissue culture plates (Costar, Cambridge, MA) in 0.5 mL medium and incubated for 72–96 h in a humidified atmosphere of 95% air-5% CO2, at 37 C. Medium was then changed to serum-free defined low glucose DMEM containing 0.2% BSA, 120 nmol/L transferrin, 100 nmol/L hydrocortisone, 0.6 nmol/L T3, 5 U/L insulin, 3 nmol/L glucagon, 50 nmol/L PTH, 2 mmol/L glutamine, 15 nmol/L epidermal growth factor, and antibiotics, and cells were treated for 8 or 16 h with recombinant human leptin (0.1, 1, 3, 6, 10, and 100 nmol/L; six to eight wells for each treatment group). Controls were treated with vehicle solution. Experiments were also performed in the presence of LHRH (10 nmol/L). After treatments, media were collected and stored at -20 C for later hormone measurements.

Hormone assays

For human GH and ACTH measurements we used RIA kits from Diagnostics Products Corp. (Los Angeles, CA), after appropriate dilutions (1:3 to 1:10) of conditioned medium. Human PRL, LH, and FSH were measured by immunoradiometric assays purchased from Diagnostics Products Corp.

Statistical analysis

Results are expressed as the mean ± SEM. Differences were assessed by unpaired t test, and P < 0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human fetal and adult pituitary OB-R expression

RNA extracted from three human adult pituitaries and from two fetal pituitaries (18 and 31 weeks gestation) was subjected to RT followed by PCR amplification. Results of the PCR revealed the presence of the extracellular domain of human OB-R in both adult and fetal pituitaries (581-bp DNA products; Fig. 1AGo). The specificity of the expressed bands was confirmed by incubation with Sau3A1, appropriately digesting the 581-bp bands representing the OB-R extracellular region to the expected 322- and 259-bp restriction products (Fig. 1AGo). When reactions without RT were amplified by PCR, no bands were observed. To verify the pituitary origin of the mRNA, GH expression was confirmed in these tissues, as reflected by a 279-bp PCR product, as expected (Fig. 1AGo). The intact OB-R isoform (long isoform mRNA of 3800 bp) containing the intracellular signaling domain (4) is expressed (525-bp PCR products) in human fetal pituitaries (both 18 and 31 weeks gestation), but not in adult human pituitary tissues (Fig. 1BGo). These DNA products are specifically digested with EcoRV to the expected 358- and 167-bp products (Fig. 1BGo). We found that human pituitaries (both fetal and adult) also express the two short leptin receptor splice variant forms (9). Figure 1CGo depicts mRNA expression of the 2977-bp (6.4 mRNA) isoform (340-bp PCR products) in normal adult and 18- and 31-week-old fetal glands, specifically digested by AluI to the two expected restriction products (203 and 137 bp). Figure 1DGo shows expression of the other OB-R splice variant, designated 12.1 mRNA (3100 bp), in both adult and fetal human glands (440 bp, digested as expected by AvaII to 358- and 82-bp short bands). Thus, these RT-PCR studies show that adult human pituitaries only express short splice variants of OB-R containing the extracellular binding domain and the truncated intracytoplasmic region without Janus kinase or STAT signaling ability. In contrast, human fetal pituitary mRNAs contain the long OB-R isoform with the intact intracellular signaling domain in addition to the short OB-R variants.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 1. Human OB-R mRNA expression in adult human pituitary and in 18- and 31-week gestation human fetal pituitaries. Extracted RNA (1 µg/reaction) was treated with deoxyribonuclease and subjected to RT using oligo(deoxythymidine) as primer. Samples incubated without RT enzyme served as controls. Aliquots from the generated cDNAs and negative controls were subjected to subsequent PCR amplification (37–40 cycles) of the OB-R extracellular region (A; 581-bp PCR product, digested by Sau3AI), the OB-R long isoform containing the intracellular signaling domain (B; 525 bp, digested by EcoRV), the 6.4 mRNA short isoform (C; 340 bp, digested by AluI), and 12.1 mRNA (D; 440 bp, digested by AvaII) using the primer pairs indicated in Materials and Methods. Schematic presentation of RT-PCR analysis of OB-R splicing variants is shown in E; 581-, 525-, 340-, and 440-bp PCR products are depicted. Human GH mRNA expression (A; 279-bp band) confirmed the pituitary origin of the studied mRNA samples. L, One hundred-base pair ladder; +, with RT; -, no RT added.

 
Pituitary adenoma OB-R expression

RNAs extracted from 5 GH-secreting, 9 PRL-secreting, 3 ACTH-secreting adenomas, and 29 nonfunctioning human pituitary tumors were used (Table 1Go) for RT-PCR to study OB-R expression. RNAs derived from 3 normal pituitaries served as negative controls, and fetal pituitary (22 weeks gestation) was the positive control (Table 1Go). For these experiments we used a new set of primers for the intact OB-R (428-bp PCR product) and similar primers for the short 6.4 isoform (340-bp DNA band). Figure 2AGo and Table 1Go depict mRNA expression of the intact OB-R isoform in 4 of 5 GH-secreting, all 9 PRL-secreting, and 26 of 29 nonfunctioning adenomas as well as in fetal pituitary tissue. In contrast, normal adult pituitaries and ACTH-secreting adenomas did not express this long receptor isoform. Using the new set of primers for the intact OB-R further confirmed our previous observations that the long isoform is expressed in fetal, but not adult, tissues. Expression of the 6.4 short isoform was found in almost all tumor tissues studied, except for one third of the nonfunctioning tumors (Table 1Go and Fig. 2BGo).


View this table:
[in this window]
[in a new window]
 
Table 1. OB-R isoform expression in human pituitary adenomas

 


View larger version (43K):
[in this window]
[in a new window]
 
Figure 2. OB-R mRNA expression in human pituitary adenomas; the intact long isoform (428-bp PCR product) is depicted in A, and the 6.4 mRNA short isoform is depicted in B. RNA was extracted from pituitary adenomas obtained at the time of transsphenoidal surgery (after tumor tissue homogenization). Extracted mRNA was subjected to RT-PCR using specific primers for the OB-R long isoform, the short isoform, and ß-actin (256-bp PCR product). C, Control; FP, fetal pituitary; NP, normal adult pituitary; NF, nonfunctioning adenoma; GH, acromegaly; ACTH, Cushing’s disease; PRL, prolactinoma; +, with RT; -, no RT added; M, markers.

 
Hormone stimulation by leptin

We used recombinant human leptin to study in vitro effects of this hormone on human fetal pituitary cells. After 16-h incubations, leptin (3–6 nmol/L) specifically stimulated GH release from human fetal pituitary cultures by 40–90% (P < 0.05; Fig. 3Go). Other pituitary hormone concentrations, including PRL, LH, FSH (with and without added LHRH), and ACTH, were not altered by incubation with human leptin (Fig. 3Go). The maximal GH stimulatory effect was achieved in somatotrophs derived from 22-week gestation fetal pituitary, and this induction decreased with increasing fetal age, ultimately disappearing when cells derived from third trimester pituitary were incubated with leptin (Fig. 4Go). In contrast to fetal somatotrophs, GH- and PRL-secreting adenoma cells did not respond to leptin stimulation by increasing GH or PRL release into the cell culture medium.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 3. Leptin effects on human fetal pituitary hormone secretion. Human fetal pituitary cells (A; 22 weeks gestation; B, 23 weeks gestation) were incubated for 16 h with recombinant human leptin in serum-free medium. Medium was collected after treatment for hormone assays. Results are expressed as the percent change in hormone secretion over that in vehicle-treated control wells (100%). Each bar represents the mean ± SEM of hormone levels in six to eight wells. Solid bars, Control; gray bars, leptin (1 nmol/L); striped bars, leptin (3 nmol/L). *, P < 0.05; #, P < 0.005.

 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 4. Gestational age-dependent effects of recombinant leptin on GH stimulation in human fetal pituitary cell cultures. Primary fetal pituitary cultures (22–33 weeks gestation) were incubated for 16 h with 3–6 nmol/L recombinant leptin in serum-free medium. Results are expressed as the percent change in GH over that in vehicle-treated control wells (100%). Each bar represents the mean ± SEM of GH levels in six to eight wells. *, P < 0.05; #, P < 0.005.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
OB-R is a single membrane-spanning receptor with homology to members of the class I/interleukin-6 (IL-6)-type cytokine receptor superfamily, which also includes receptors for IL-6, leukemia inhibitory factor, GH, granulocyte colony-stimulating factor, and the gp130 signaling subunit (6, 16). Although leptin and these related cytokines share similar signal transduction pathways, leptin signaling appears to be independent of the gp130 signal transducing subunit of the IL-6-type cytokine receptors (17).

In mice, the long intact isoform of OB-R is detected mainly in the hypothalamus (5, 18), consistent with the known role of leptin in body weight regulation and food intake, mediated via the arcuate, ventromedial, and lateral intrahypothalamic nuclei. Recently, expression of the OB-R extracellular domain was detected in the rat anterior pituitary (19). However, other extrapituitary tissues, including lung and kidney, mainly express short isoforms of OB-R (5), but only very low levels of intact OB-R. The functional role and importance of the OB-R short splice variants is unknown, as these truncated isoforms lack the critical intracellular signal transduction domains. Interestingly, using RT-PCR we demonstrated expression of the long OB-R isoform outside the human hypothalamus in fetal pituitaries, but not in adult pituitary tissues. Moreover, most human pituitary adenomas studied also expressed this intact OB-R receptor. However, all tissues, including adult, fetal, and pituitary tumors, express the short nonsignaling forms of the human receptor. These data suggest that the intact receptor splice variant may be associated with fetal pituitary development and dedifferentiation, disappearing in adult and normally functioning human pituitary tissue.

Leptin is involved in pathways other than energy metabolism, including fertility (20), and has in vitro and in vivo effects on pituitary hormone secretion in rodents. In vitro, leptin stimulates gonadotropins and PRL release from rat pituitaries (21), and administration of leptin to rodents results in early puberty onset (22, 23) and elevation of gonadotropin levels (21, 24). Peripheral leptin may influence other pituitary hormones. Serum ACTH and cortisol were shown to be inversely related to leptin levels in humans (25). Leptin antiserum decreases GH release in normal rats (26), whereas intracerebroventricular injection of leptin into fasted rats enhanced GH levels (26). However, exogenous leptin has no effect on GH in normal fed rats and no direct effect on cultured rat pituitaries (26). Moreover, leptin can suppress in vitro hypothalamic somatostatin synthesis and secretion (27). Thus, these data suggest in vivo signaling of rodent GH by leptin, although the site of action is unclear.

As we detected the long OB-R isoform in fetal pituitaries and in most pituitary adenomas, and this isoform is believed to transduce leptin signaling, we studied the possibility that leptin has direct actions on human fetal pituitary hormones or secreting adenomas. As fetal GH was specifically stimulated by leptin, leptin and GH may have interacting roles in intrauterine energy balance and regulation. The limited number of GH-secreting adenomas tested precludes a definitive conclusion regarding their in vitro leptin responsiveness. Fasting decreases both circulating leptin (28) and GH levels (29) in rodents, whereas feeding enhances both hormone levels. Adult human GH deficiency is associated with a decrease in body muscle mass and an increase in sc fat mass (30). Moreover, GH replacement therapy decreases fat mass in these patients while increasing lean body mass (31). Similarly, leptin replacement in ob/ob mice with total leptin deficiency also decreases body fat mass (2, 32). Thus, as leptin stimulates fetal GH release, GH may augment or mediate the metabolic effects exerted by leptin in utero. Recently, human leptin levels in umbilical cord blood at delivery were shown to correlate with birth weight (33, 34). Moreover, fetal GH receptors have been well characterized on several tissues (35, 36), indicating that in utero leptin may affect GH-mediated intrauterine growth patterns.

Interestingly, we have previously shown that IL-6 and other leptin-related cytokines stimulate human fetal ACTH as well as GH secretion (15). Thus, in utero, leptin and cytokines dependent on related receptors have similar signaling capabilities, resulting in enhanced secretion of human GH. Leptin-mediated fetal somatotroph function is thus a further determinant of intrauterine fetal pituitary cytokine response. In addition to the well known regulators of GH, GHRH, somatostatin, and insulin-like growth factor I, novel peptides, including GH-releasing peptides (37) and leptin, appear to participate in the complex regulation of human fetal GH secretion. Fetal GH, which participates in metabolic and prenatal somatic development as well as homeostasis, is therefore regulated by integrated neuroendocrine hormonal and cytokine signals.


    Footnotes
 
1 This work was supported by NIH Grants DK-50238 (to S.M.), DA-00276 (to T.C.F.), and HD-33907 (to D.A.M.) and by the Doris Factor Molecular Endocrinology Laboratory. Back

2 Charles. E. Culpeper fellow. Back

Received April 9, 1998.

Revised July 7, 1998.

Accepted July 20, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM. 1994 Positional cloning of the mouse obese gene and its human homologue. Nature. 372:425–432.[CrossRef][Medline]
  2. Pelleymounter MA, Cullen MJ, Baker MB, et al. 1995 Effects of the obese gene product on body weight regulation in ob/ob mice. Science. 269:540–543.[Abstract/Free Full Text]
  3. Campfield LA, Smith FJ, Guisez Y, Devos R, Burn P. 1995 Recombinant mouse OB protein: evidence for a peripheral signal linking adiposity and central neural networks. Science. 269:546–549.[Abstract/Free Full Text]
  4. Tartalgia LA, Dembski M, Weng X, et al. 1995 Identification and expression cloning of a leptin receptor, OB-R. Cell. 83:1263–1271.[CrossRef][Medline]
  5. Fei H, Okano HJ, Li C, et al. 1997 Anatomic localization of alternatively spliced leptin receptors (Ob-R) in mouse brain and other tissues. Proc Natl Acad Sci USA. 94:7001–7005.[Abstract/Free Full Text]
  6. White DW, Tartalgia LA. 1996 Leptin and OB-R: body weight regulation by a cytokine receptor. Cytokine Growth Factor Rev. 7:303–309.[CrossRef][Medline]
  7. Ghilardi N, Ziegler S, Wiestner A, Stoffel R, Heim MH, Skoda RC. 1996 Defective STAT signaling by the leptin receptor in diabetic mice. Proc Natl Acad Sci USA. 93:6231–6235.[Abstract/Free Full Text]
  8. Vaisse C, Halaas JL, Horvath CM, Darnell Jr JE, Stoffel M, Friedman JM. 1996 Leptin activation of Stat3 in the hypothalamus of wild-type and ob/ob mice but not db/db mice. Nat Genet. 14:95–97.[CrossRef][Medline]
  9. Bennett BD, Solar GP, Yuan JQ, Mathias J, Thomas GR, Matthews W. 1996 A role for leptin and its cognate receptor in hematopoiesis. Curr Biol. 6:1170–1180.[CrossRef][Medline]
  10. Asa SL, Kovacs K, Horvath E, et al. 1988 Human fetal adenohypophysis. Electron microscopy and ultrastructural immunocytochemical analysis. Neuroendocrinology. 48:423–431.[Medline]
  11. Asa SL, Kovacs K, Singer W. 1991 Human fetal adenohypophysis: morphological and functional analysis in vitro. Neuroendocrinology. 53:562–572.[Medline]
  12. Goodyer CG, Branchaud CL, Lefebvre Y. 1993 Effects of growth hormone (GH)-releasing factor and somatostatin on GH secretion from early to midgestation human fetal pituitaries. J Clin Endocrinol Metab. 76:1259–1264.[Abstract]
  13. Williams T, Berelowitz M, Joffe SN, et al. 1984 Impaired growth hormone responses to growth hormone-releasing factor in obesity. A pituitary defect reversed with weight reduction. N Engl J Med. 311:1403–1407.[Abstract]
  14. Cohen CB, Jonsen Ar. 1993 National Advisory Panel on Ethics in reproduction. Policy forum: the future of the fetal tissue bank. Science. 262:1663–1665.[Free Full Text]
  15. Shimon I, Yan X, Ray DW, Melmed S. 1997 Cytokine-dependent gp130 receptor subunit regulates human fetal pituitary adrenocorticotropin hormone and growth hormone. J Clin Invest. 100:357–363.[Medline]
  16. Kishimoto T, Taga T, Akira S. 1994 Cytokine signal transduction. Cell. 76:253–262.[CrossRef][Medline]
  17. Baumann H, Morella KK, White DW, et al. 1996 The full-length leptin receptor has signaling capabilities of interleukin 6-type cytokine receptors. Proc Natl Acad Sci USA. 93:8374–8378.[Abstract/Free Full Text]
  18. Mercer JG, Hoggard N, Williams LM, Lawrence CB, Hannah LT, Trayhurn P. 1996 Localization of leptin receptor mRNA and the long form splice variant (OB-Rb) in mouse hypothalamus and adjacent brain regions by in situ hybridization. FEBS Lett. 387:113–116.[CrossRef][Medline]
  19. Zamorano PL, Mahesh VB, De Sevilla LM, Chorich LP, Bhat GK, Brann DW. 1997 Expression and localization of the leptin receptor in endocrine and neuroendocrine tissues of the rat. Neuroendocrinology. 65:223–228.[CrossRef][Medline]
  20. Chebab FF, Lim ME, Lu R. 1996 Correction of the sterility defect in homozygous obese female mice by treatment with the human recombinant leptin. Nat Genet. 12:318–320.[CrossRef][Medline]
  21. Yu WH, Kimura M, Walczewska A, Karanth S, McCann SM. 1997 Role of leptin in hypothalamic-pituitary function. Proc Natl Acad Sci USA. 94:1023–1028.[Abstract/Free Full Text]
  22. Chehab FF, Mounzih K, Lu R, Lim ME. 1997 Early onset of reproductive function in normal female mice treated with leptin. Science. 275:88–90.[Abstract/Free Full Text]
  23. Ahima RX, Dushay J, Flier SN, Prabakaran D, Flier JS. 1997 Leptin accelerates the onset of puberty in normal female mice. J Clin Invest. 99:391–395.[Medline]
  24. Barash IA, Cheung CC, Weigle DS, et al. 1996 Leptin is a metabolic signal to the reproductive system. Endocrinology. 137:3144–3147.[Abstract]
  25. Licinio J, Mantzoros C, Negaro AB, et al. 1997 Human leptin levels are pulsatile and inversely related to pituitary-adrenal function. Nat Med. 3:575–579.[CrossRef][Medline]
  26. Carro E, Senaris R, Considine RV, Casanueva FF, Dieguez C. 1997 Regulation of in vivo growth hormone secretion by leptin. Endocrinology. 138:2203–2206.[Abstract/Free Full Text]
  27. Quintela M, Senaris R, Heiman ML, Casanueva FF, Dieguez C. 1997 Leptin inhibits in vitro hypothalamic somatostatin secretion and somatostatin mRNA levels. Endocrinology. 138:5641–5644.[Abstract/Free Full Text]
  28. Frederich RC, Lollmann B, Hamann A, et al. 1996 Expression of ob mRNA and its encoded protein in rodents. Impact of nutrition and obesity. J Clin Invest. 96:1658–1663.
  29. Brogan RS, Fife SK, Conley LK, Giustina A, Wehrenberg WB. 1997 Effects of food deprivation on the GH axis: immunocytochemical and molecular analysis. Neuroendocrinology. 65:129–135.[Medline]
  30. Hoffman DM, O’Sullivan AJ, Freund J, Ho KK. 1995 Adults with growth hormone deficiency have abnormal body composition but normal energy metabolism. J Clin Endocrinol Metab. 80:72–77.[Abstract]
  31. Salomon F, Cuneo RC, Hesp RC, Sonksen PH. 1989 The effects of treatment with recombinant human growth hormone on body composition and metabolism in adults with growth hormone deficiency. N Engl J Med. 321:1797–1803.[Abstract]
  32. Halaas JL, Gajiwala KS, Maffei M, et al. 1995 Weight-reducing effects of the plasma protein encoded by the obese gene. Science. 269:543–546.[Abstract/Free Full Text]
  33. Harigaya A, Nagashima K, Nako Y, Morikawa A. 1997 Relationship between concentration of serum leptin and fetal growth. J Clin Endocrinol Metab. 82:3281–3284.[Abstract/Free Full Text]
  34. Koistinen HA, Koivisto VA, Andersson S, et al. 1997 Leptin concentration in cord blood correlates with intrauterine growth. J Clin Endocrinol Metab. 82:3328–3330.[Abstract/Free Full Text]
  35. Pantaleon M, Whiteside EJ, Harvey MB, Barnard RT, Waters MJ. 1997 Functional GH receptors and GH are expressed by preimplantation mouse embryos: a role for GH in early embryogenesis? Proc Natl Acad Sci USA. 94:5125–5130.[Abstract/Free Full Text]
  36. Simard M, Manthos H, Giaid A, Lefebvre, Goodyer CG. 1996 Ontogeny of GH receptors in human tissues: an immunohistochemical study. J Clin Endocrinol Metab. 81:3097–3102.[Abstract]
  37. Shimon I, Yan X, Melmed S. 1998 Human fetal pituitary expresses functional growth hormone (GH) releasing peptide receptors. J Clin Endocrinol Metab. 83:174–178.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Endocr. Rev.Home page
J. D. Veldhuis, J. N. Roemmich, E. J. Richmond, A. D. Rogol, J. C. Lovejoy, M. Sheffield-Moore, N. Mauras, and C. Y. Bowers
Endocrine Control of Body Composition in Infancy, Childhood, and Puberty
Endocr. Rev., February 1, 2005; 26(1): 114 - 146.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
L. L. Anderson, S. Jeftinija, and C. G. Scanes
Growth Hormone Secretion: Molecular and Cellular Mechanisms and In Vivo Approaches
Experimental Biology and Medicine, April 1, 2004; 229(4): 291 - 302.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
I. A. McDuffie, N. Akhter, and G. V. Childs
Regulation of Leptin mRNA and Protein Expression in Pituitary Somatotropes
J. Histochem. Cytochem., February 1, 2004; 52(2): 263 - 273.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
H. Watanobe and S. Habu
Leptin Regulates Growth Hormone-Releasing Factor, Somatostatin, and alpha -Melanocyte-Stimulating Hormone But Not Neuropeptide Y Release in Rat Hypothalamus In Vivo: Relation with Growth Hormone Secretion
J. Neurosci., July 15, 2002; 22(14): 6265 - 6271.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. M. Ahmad, R. Guzder, A. M. Wallace, J. Thomas, W. D. Fraser, and J. P. Vora
Circadian and Ultradian Rhythm and Leptin Pulsatility in Adult GH Deficiency: Effects of GH Replacement
J. Clin. Endocrinol. Metab., August 1, 2001; 86(8): 3499 - 3506.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
A. Lacroix, N. N'Diaye, J. Tremblay, and P. Hamet
Ectopic and Abnormal Hormone Receptors in Adrenal Cushing's Syndrome
Endocr. Rev., February 1, 2001; 22(1): 75 - 110.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
R. Heptulla, A. Smitten, B. Teague, W. V. Tamborlane, Y.-Z. Ma, and S. Caprio
Temporal Patterns of Circulating Leptin Levels in Lean and Obese Adolescents: Relationships to Insulin, Growth Hormone, and Free Fatty Acids Rhythmicity
J. Clin. Endocrinol. Metab., January 1, 2001; 86(1): 90 - 96.
[Abstract] [Full Text]


Home page
Biol. Reprod.Home page
M. C. Henson and V. D. Castracane
Leptin in Pregnancy
Biol Reprod, November 1, 2000; 63(5): 1219 - 1228.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
J. Iqbal, S. Pompolo, R. V. Considine, and I. J. Clarke
Localization of Leptin Receptor-Like Immunoreactivity in the Corticotropes, Somatotropes, and Gonadotropes in the Ovine Anterior Pituitary
Endocrinology, April 1, 2000; 141(4): 1515 - 1520.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. M. Hileman, D. D. Pierroz, and J. S. Flier
Leptin, Nutrition, and Reproduction: Timing Is Everything
J. Clin. Endocrinol. Metab., February 1, 2000; 85(2): 804 - 807.
[Full Text]


Home page
EndocrinologyHome page
L. Jin, S. Zhang, B. G. Burguera, M. E. Couce, R. Y. Osamura, E. Kulig, and R. V. Lloyd
Leptin and Leptin Receptor Expression in Rat and Mouse Pituitary Cells
Endocrinology, January 1, 2000; 141(1): 333 - 339.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. Jin, B. G. Burguera, M. E. Couce, B. W. Scheithauer, J. Lamsan, N. L. Eberhardt, E. Kulig, and R. V. Lloyd
Leptin and Leptin Receptor Expression in Normal and Neoplastic Human Pituitary: Evidence of a Regulatory Role for Leptin on Pituitary Cell Proliferation
J. Clin. Endocrinol. Metab., August 1, 1999; 84(8): 2903 - 2911.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shimon, I.
Right arrow Articles by Melmed, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shimon, I.
Right arrow Articles by Melmed, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals