help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mulatero, P.
Right arrow Articles by Pascoe, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mulatero, P.
Right arrow Articles by Pascoe, L.
The Journal of Clinical Endocrinology & Metabolism Vol. 83, No. 11 3996-4001
Copyright © 1998 by The Endocrine Society


Original Studies

Recombinant CYP11B Genes Encode Enzymes that Can Catalyze Conversion of 11-Deoxycortisol to Cortisol, 18-Hydroxycortisol, and 18-Oxocortisol1

P. Mulatero, K. M. Curnow, B. Aupetit-Faisant, M. Foekling, C. Gomez-Sanchez, F. Veglio, X. Jeunemaitre, P. Corvol and L. Pascoe2

INSERM U36 (P.M., K.M.C., X.J,. P.C., L.P.), Collège de France, 75005 Paris, France; Department of Medicine and Experimental Oncology (F.V., P.M.), University of Turin, Italy; Baker Medical Research Institute (K.M.C.), Prahran, 3181 Victoria, Australia; Service de Biochimie (B.A-F.), Hôpital de la Pitié-Salpétrière, 75651 Paris, France; and Harry S. Truman Memorial Hospital (C.G-S., M.F.), Department of Internal Medicine, Columbia Missouri 65201-5297

Address all correspondence and requests for reprints to: Leigh Pascoe, Fondation Jean Dausset CEPH, 27 rue Juliette Dodu, 75010 Paris, France. E-mail: leigh{at}cephb.fr


    Abstract
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
CYP11B1 (11ß-hydroxylase) and CYP11B2 (aldosterone synthase) are 93% identical mitochondrial enzymes that both catalyze 11ß-hydroxylation of steroid hormones. CYP11B2 has the additional 18-hydroxylase and 18-oxidase activities required for conversion of 11-deoxycorticosterone to aldosterone. These two additional C18 conversions can be catalyzed by CYP11B1 if serine-288 and valine-320 are replaced by the corresponding CYP11B2 residues, glycine and alanine. Here we show that such a hybrid enzyme also catalyzes conversion of 11-deoxycortisol to cortisol, 18-hydroxycortisol, and 18-oxocortisol. These latter two steroids are present at elevated levels in individuals with glucocorticoid suppressible hyperaldosteronism (GSH) and some forms of primary aldosteronism. Their production by the recombinant CYP11B enzyme is enhanced by substitution of further amino acids encoded in exons 4, 5, and 6 of CYP11B2. A converted CYP11B1 gene, containing these exons from CYP11B2, would be regulated like CYP11B1, yet encode an enzyme with the activities of CYP11B2, thus causing GSH or essential hypertension. In a sample of 103 low renin hypertensive patients, 218 patients with primary aldosteronism, and 90 normotensive individuals, we found a high level of conversion of CYP11B genes and four cases of GSH caused by unequal crossing over but no gene conversions of the type expected to cause GSH.


    Introduction
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
THE terminal steps in the biosynthesis of cortisol and aldosterone in the human adrenal cortex are mediated by the enzymes CYP11B1 (11ß-hydroxylase) and CYP11B2 (aldosterone synthase), respectively (1, 2). CYP11B1 catalyzes 11ß-hydroxylation of 11-deoxycortisol to cortisol in the adrenal zona fasciculata/reticularis and of 11-deoxycorticosterone (DOC) to corticosterone (B) in both the zona glomerulosa and the zona fasciculata/reticularis (3). CYP11B2 is expressed exclusively in the zona glomerulosa, where it catalyzes the 11ß-hydroxylation of DOC to B, the further 18-hydroxylation of B to 18-hydroxycorticosterone (18OHB), and finally a further 18-oxidation of 18OHB to aldosterone. The limitation of the expression of CYP11B2 to the zona glomerulosa and of CYP17 (which has a 17{alpha}-hydroxylase activity) to the zona fasciculata/reticularis leads to a functional zonation of the synthesis of aldosterone and cortisol to those zones, respectively. The two 93% identical CYP11B enzymes are encoded by two genes with identical exon/intron structures (4), which are located 40 kilobases (kb) apart (5, 6) on chromosome 8q22 (7, 8).

The normal zonation of aldosterone synthesis is disturbed in the dominantly inherited hypertensive syndrome, glucocorticoid suppressible hyperaldosteronism (GSH) (9, 10). This disease is caused by the presence of a hybrid CYP11B gene that has CYP11B1 sequences, including the promoter, at the 5' end of the gene and CYP11B2 sequences at the 3' end (5, 6, 11). The hybrid genes are believed to have arisen from unequal crossing over between the two CYP11B genes in previous meioses. The presence of the CYP11B1 promoter ensures expression of the hybrid gene throughout the cortex, under the control of ACTH, whereas the coding sequences from CYP11B2 lead to inappropriate synthesis of aldosterone as well as the normally rare steroids, 18-hydroxycortisol and 18-oxocortisol. The latter two steroids are characteristic of the disease (12, 13, 14, 15, 16). In this article we show that the hybrid CYP11B genes detected in GSH encode hybrid enzymes with the capacity to catalyze the synthesis of these two steroids from their precursor, 11-deoxycortisol.

We have previously shown that only 2 of the 35 amino acid differences distinguishing the CYP11B1 and CYP11B2 enzymes are responsible for the additional efficient 18-hydroxylase and 18-oxidase activities possessed by CYP11B2 but not CYP11B1 (17). The amino acid substitution S288G in CYP11B1 confers on it an efficient 18-hydroxylase activity, and the additional substitution V320A then confers the 18-oxidase activity required for aldosterone synthesis, when DOC is used as the substrate. These amino acids are encoded in exons 5 and 6 of CYP11B2, respectively. In this study we show that the same two substitutions also confer on the CYP11B1 enzyme the additional capacity to synthesize 18-hydroxycortisol and 18-oxocortisol from an 11-deoxycortisol precursor. However, the efficiency of synthesis of these steroids is poor when only the S-288 and V-320 residues of CYP11B1 are replaced by those of CYP11B2. More efficient synthesis of 18-oxocortisol occurs with the substitution of all 10 of the amino acid residue differences encoded in exons 4, 5, and 6 of CYP11B2 into the CYP11B1 enzyme. These data show that in addition to the unequal crossing over events between the CYP11B1 and CYP11B2 genes that cause GSH, gene conversions of CYP11B1 involving exons 4, 5, and 6 can potentially cause a novel form of GSH and low renin hypertension. Gene conversion events of this type would not be detected by the Southern blot screening protocol for GSH (11) if only the EcoRI restriction enzyme were used.

We have therefore investigated whether gene conversion of the CYP11B genes is observed in the groups of hypertensive patients in which GSH is sometimes identified by genetic screening. The individuals studied included 103 low renin hypertensive patients, 218 patients with primary hyperaldosteronism, and 90 normal individuals. Those with primary aldosteronism were included because increased levels of 18-hydroxycortisol and 18-oxocortisol, in addition to aldosterone, are detected in the plasma of these individuals (18). The PCR screening strategy implemented was designed to permit identification of GSH caused by inheritance of a hybrid CYP11B gene, whether it had been generated by an unequal crossing over or a gene conversion. The two types of hybrid gene were subsequently distinguished by Southern blot analyses and additional PCR reactions. In the samples studied, we found four cases of classical GSH, a high level of gene conversion and polymorphism, but no conversions involving exons 4, 5, and 6, which would be expected to lead to these forms of hypertension or GSH. We conclude that if such gene conversions do exist, they are not a common cause of GSH, low renin essential hypertension, or primary hyperaldosteronism.


    Patients and Methods
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Patients

The subjects investigated in this study comprised 103 low-renin hypertensive patients, 218 patients diagnosed with primary aldosteronism, and 90 normal control individuals of French Caucasian origin. The study was approved by a local review committee, and all subjects gave informed consent. Plasma renin activity in the low renin subgroup was <0.3 ng angiotensin I/mL per h in blood samples taken after 2 h clinostatism. Primary hyperaldosteronism was diagnosed by standard clinical features (19).

Generation of hybrid complementary DNA (cDNA) constructs and transfection of COS cells

Hybrid constructs were made by PCR mutagenesis and cloned into the expression vector pCMV4 as previously described (2, 20). Plasmid DNA was transfected into COS-7 cells using cationic liposomes (Lipofectamine, Gibco BRL, Gaithersburg, MD) and incubated with radioactively labeled or unlabeled DOC or 11-deoxycortisol as previously described (2, 17). The resulting steroids were analyzed by thin-layer chromatography (TLC) in experiments performed with radioactive substrates as previously described (2), or by RIA in those performed with unlabeled precursors (21). Radioactive products were also quantified by scanning the TLC plates with a ß-scanner.

Detection of gene-conversion in exon 5 of CYP11B1

Genomic DNA, prepared from peripheral blood leukocytes, was amplified by long PCR (Expand Long Template PCR System, Boehringer Mannheim, Indianapolis, IN) using a sense primer corresponding to sequence from the promoter region of CYP11B1 (TTTGAATTCTCGAAGGCAAGGCACCAG) and an antisense primer specific to exon 5 of CYP11B2 (TGCCACGATGCCTGTGTAGTG), according to the manufacturer’s recommendations. Specifically, reactions were performed in thin-walled 0.2-mL tubes in a gene Amp PCR System 2400 thermocycler (PE Applied Biosystems) with samples being denatured at 94 C for 2 min and then subjected to 35 cycles of 94 C for 10 sec, 65 C for 30 sec, and 68 C for 3 min, with the extension phase increasing by 10 sec each cycle. Genomic DNA from a patient previously diagnosed with GSH was used as a positive control for this reaction to amplify the expected 3.6-kb PCR product. To distinguish between the classical hybrid gene, generated by an unequal crossing over, and a gene conversion, a second PCR reaction was performed. In this reaction the sense primer corresponded to sequence from the same region of exon 5 in CYP11B2 (CAACACTACACAGGCATCGTC) and the antisense primer to sequence from exon 8 of CYP11B1 (AGAGTAGAGGAACACGCGCAC), and amplification was performed with Amplitaq DNA polymerase (PE Applied Biosystems, Norwalk, CT) in the presence of 1.5 mM MgCl2. In this assay the reactions were denatured at 94 C for 1 min, followed by 35 cycles of 94 C for 1 min, 65 C for 1 min, and 72 C for 2 min, with the extension phase increasing by 5 sec each cycle. As a positive control for this reaction we used a cDNA construct with exons 1–3 and 7 and 8 from CYP11B1 and exons 5 and 6 from CYP11B2, as well as genomic DNA from an individual with a deletion hybrid gene containing exons 1–6 of CYP11B2 and exons 7–9 of CYP11B1.

Genomic Southern blotting

Genomic DNA (5 µg) was digested with BamHI, subjected to electrophoresis in a 0.8% agarose gel and transferred to nylon membranes in 10x SSC (1.5 M NaCl, 0.15 M sodium citrate). Blots were hybridized with a PCR product containing exons 3–6 of CYP11B1 cDNA that had been radioactively labeled with {alpha}-[32P]-dCTP by random priming (6). Final stringent washes were at 65 C in 0.2x SSC/0.1%SDS.

Detection of gene conversion in intron 2 of CYP11B2

Conversion of most of intron 2 of CYP11B2 by sequence from CYP11B1 has been previously reported (22) and observed by us in unpublished studies. We tested a sample of 81 normal individuals for the presence of this conversion by PCR using a sense primer from intron 2 of CYP11B1 (GCAGAAAATCCCTCCCCCCTA) and an antisense primer corresponding to intron 3 of CYP11B2 (TGGGGCTGGACCTTCCCGCAT). The positive control for these reactions was an individual known to have a gene conversion of intron 2.


    Results
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Activities of hybrid CYP11B enzymes

We have previously shown that a cDNA with exons 1–3 and 7–9 of CYP11B1 and exons 4–6 of CYP11B2 encodes an enzyme with full aldosterone synthase activity (17), catalyzing 11ß-hydroxylation, 18-hydroxylation, and further 18-oxidation of DOC. Further analysis of hybrid constructs in transient transfection assays showed that a CYP11B1 enzyme with a glycine at position 288 and an alanine at position 320 (the residues normally present at these positions in the CYP11B2 enzyme) also has strong aldosterone synthase activity (Fig. 1Go). As shown in Fig. 1Go, the glycine at position 288, which carries a small nonpolar side chain, is permissive for an efficient 18-hydroxylase activity, but no significant 18-oxidase activity is observed without the further substitution of an alanine at position 320. CYP11B1 enzymes, having a serine at position 288, which has a larger polar side chain, have a relatively inefficient 18-hydroxylase activity under the transfection conditions. Consequently, CYP11B1 enzymes carrying only V320A (and not S288G) are unable to synthesize aldosterone (17).



View larger version (62K):
[in this window]
[in a new window]
 
Figure 1. Autoradiography of TLC of steroids produced in transient transfection assays with DOC as substrate. Recombinant CYP11B enzymes were expressed in COS-7 cells by transient transfection and incubated with 0.825 µmol/L DOC for 24 h. Hybrid CYP11B constructs with prefix B1 had inserts encoding mostly CYP11B1. Hybrid CYP11B1 constructs with prefix B1 had inserts encoding CYP11B1 except for the amino acid residues indicated after the prefix, which were mutated to those indicated by the single letter code. For example, B1.288G,320A encodes CYP11B1 except for the CYP11B2 residues of glycine at position 288 and alanine at position 320. Similarly, B2 indicates a construct that encodes CYP11B2 and pCMV4 refers to vector without an insert. 11ß-Hydroxylation of DOC produces B, and its subsequent 18-hydroxylation and 18-oxidation produce 18- hydroxycortisol (18OHB) and aldosterone (Aldo), respectively. An endogenous activity of the COS-7 cells converts some of the B to 11-dehydrocorticosterone (A). Enzymes with a glycine at position 288 have efficient 18-hydroxylase activity, whereas those with a serine (the CYP11B1 residue) or an alanine in that position have poor 18-hydroxylase activity.

 
To test whether it is the size or the polarity of the side chain in position 288 that is important for 18-hydroxylase activity, we constructed a mutant with an alanine, carrying a larger nonpolar group, in this position. In the transfection assay this also had inefficient 18-hydroxylase activity, suggesting that it is the small size of the glycine side chain rather than its lack of polarity that is important for determining the efficiency of the 18-hydroxylase activity of the encoded enzyme (Fig. 1Go). These data suggest a permissive role for the small glycine residue at position 288 of CYP11B2 in the efficient catalysis of 18-hydroxylation of the 18 carbon of 17-deoxysteroid substrates.

In contrast to transfection experiments using DOC as the substrate, transfections using the 17-hydroxylated steroid precursor, 11-deoxycortisol, showed that CYP11B2 was relatively inefficient at carrying out further 18-hydroxylation and 18-oxidation. As shown in Fig. 1Go, experiments using DOC as the substrate typically result in 100% conversion to 18-hydroxylated forms, whereas those with 11-deoxycortisol (shown in Fig. 2Go) result in the conversion of most of the substrate to cortisol during the 24-h incubation period. Nevertheless, transfections with CYP11B2 cDNAs did produce easily detectable 18-hydroxycortisol and 18-oxocortisol (Fig. 2Go and Table 1Go), whereas those with CYP11B1 cDNA did not. Similarly, other constructs containing the CYP11B1 sequence but with the substitutions of the residues encoded in exons 4, 5, and 6, or with S288G and V320A alone, produced detectable 18-hydroxycortisol and 18-oxocortisol. However, the level of conversion of 11-deoxycortisol to 18-oxocortisol was only 1.2% with the latter hybrid enzyme, compared to the 18% observed with native CYP11B2. A 4-fold better conversion (4.8%) was achieved with the CYP11B enzyme containing substitutions at positions 285, 288, and 320, and 9.1% conversion was observed with the hybrid enzyme containing the 10 residues encoded in exons 4, 5, and 6 of CYP11B2. No substantial 18-oxocortisol production was detected in transfections using any of the cDNA constructs that did not encode both a glycine at position 288 and an alanine at position 320.



View larger version (59K):
[in this window]
[in a new window]
 
Figure 2. Autoradiography of TLC of steroids produced in transient transfection assays with 11-deoxycortisol (S) as substrate. Recombinant CYP11B enzymes were expressed in COS-7 cells by transient transfection and incubated with 0.825 µmol/L S for 24 h. Hybrid CYP11B constructs with prefix B1 have inserts encoding mostly CYP11B1, except for the residues indicated after the prefix B1, which are specific to CYP11B2. For example, B1.248–339 encodes CYP11B1 except for CYP11B2 residues between positions 248 and 339. Similarly, B2 indicates a construct that encodes CYP11B2 and pCMV4 refers to the vector without an insert. 11ß-Hydroxylation of S produces cortisol (F), and its subsequent 18-hydroxylation and 18-oxidation produces 18-hydroxycortisol (18OHF) and 18-oxocortisol (18oxoF), respectively. Significant amounts of 18-oxocortisol are only produced by constructs encoding the CYP11B2 residues of glycine at position 288 and alanine at position 320.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Amounts of C18-modified steroid products (ng/mL) detected by RIA in medium from transiently transfected COS-7 cells that were incubated with unlabeled 0.825 µmol/L 11-deoxycortisol (S) or 0.825 µmol/L DOC substrate

 
Examination of Table 1Go and the thin-layer chromatograms shown in Fig. 2Go shows that constructs with the 288G substitution produce greater amounts of 18-hydroxycortisol than the CYP11B1 cDNA in transfections, as well as the presence of several unidentified steroids. Some of these unidentified steroids are a result of metabolism of 11-deoxycortisol in these cells and are seen in transfections performed with the vector alone. The unidentified steroid labeled with a question mark in Fig. 2Go is, like cortisol, synthesized in cells transfected with any of the CYP11B constructs. Its identity is not known, but it may correspond to 18-hydroxy-11-deoxycortisol, or 19-hydroxycortisol, compounds, which are expected to be more polar than both 11-deoxycortisol and cortisol.

One of the features of patients with GSH and primary aldosteronism is their production of the normally rare 17-hydroxysteroids, 18-hydroxycortisol and 18-oxocortisol. Production of these steroids requires the 17-hydroxylase activity normally found in the adrenal zona fasciculata/reticularis (and not in the zona glomerulosa), as well as the C18 activities of CYP11B2, whose expression is normally limited to the adrenal zona glomerulosa. In our transfection experiments using the 17-hydroxylated precursor 11-deoxycortisol as a substrate, we found that the native CYP11B2 enzyme catalyzed the synthesis of these steroids, and that hybrid CYP11B1 enzymes having only a few residues from the central region of CYP11B2 could also produce them. Hybrid enzymes of this type could be produced by conversion of the CYP11B1 gene by sequences from exons 4, 5, and 6 of CYP11B2 and would result in the expression of the hybrid gene product in the zona fasciculata/reticularis where the native CYP11B1 enzyme is normally expressed. Consequently, we predict that a converted CYP11B1 gene, carrying, at a minimum, the mutations S288G and V320A, would also lead to GSH. Conversely, a gene conversion that resulted in the replacement of the CYP11B2 regulatory regions by those of CYP11B1 would also be expected to result in a GSH phenotype.

Detection of hybrid and converted CYP11B1 genes

We searched specifically for gene conversions involving exons 5 and 6 that could lead to a hybrid gene encoding an enzyme capable of aldosterone synthesis. Because a glycine at position 288 was found to be essential for permitting efficient C18 activity in CYP11B enzymes, either with DOC or 11-deoxycortisol as a substrate, we used antisense oligonucleotides containing this codon from CYP11B2, together with a sense oligonucleotide containing upstream sequence from the CYP11B1 promoter, in our primary PCR screen for hybrid genes (Fig. 3Go). This PCR strategy was designed to detect all recombination events that would result in the generation of a hybrid CYP11B gene encoding enzymes with 18-oxocortisol and aldosterone synthase activity, arising from either unequal crossing over, gene conversion of CYP11B1 that introduced CYP11B2 coding sequences from exons surrounding and including exon 5, or from a gene conversion of CYP11B2 in which promoter sequences from CYP11B1 were transferred into CYP11B2. In a sample of 218 patients with primary hyperaldosteronism and 103 low renin essential hypertensive patients, a hybrid CYP11B gene segment was amplified from four of the DNA samples in the former group and none in the latter (Fig. 3Go).



View larger version (39K):
[in this window]
[in a new window]
 
Figure 3. PCR screen for gene conversions involving exon 5 of CYP11B1 and CYP11B2. Positions of oligonucleotides 1–4 used in PCR amplification screens are shown at bottom of figure. Amplification with oligonucleotides 1S (CYP11B1) and 2A (CYP11B2) are expected to amplify a 3.6-kb product when a hybrid gene is present in genomic DNA. Three positive amplifications can be seen in lanes 2, 7, and 11 (positive control). Amplifications with oligonucleotides 3S (CYP11B2) and 4A (CYP11B1) are expected to give a 1.6-kb product when a hybrid gene containing exon 5 from CYP11B2 and exon 8 from CYP11B1 is present. The only positive results obtained are shown at right of figure and they correspond to positive genomic (1.6 kb) and cDNA (500 bp) controls. Positions of oligonucleotides used to detect conversion of intron 2 of CYP11B1 (5S (CYP11B2) and 6A (CYP11B1)) are also shown.

 
To distinguish gene conversion of CYP11B1 with exon 5 and surrounding regions from gene conversion of the CYP11B2 promoter or the presence of a hybrid gene that had arisen as a result of unequal crossing over, we amplified the four genomic DNA samples that were positive in the 5' end screen (oligonucleotides 1S and 2A) with a sense oligonucleotide from exon 5 and an antisense oligonucleotide from exon 8 (assuming that gene conversions generally involve regions of <2 kb). No hybrid segments were amplified when these oligonucleotides (3S and 4A) were used (Fig. 3Go), except those from the two control DNAs. Consequently, the positive results obtained in the 5' PCR screen corresponded to patients with either gene conversions of the promoter region of CYP11B2 or the classical form of GSH.

These two possibilities were distinguished by Southern blot analyses using the enzyme BamHI (Fig. 4Go), where the duplication hybrid gene was detected in all four patients at half the intensity of the wild-type sequences, as would be expected if the gene had arisen from an unequal cross-over event. Our sample of low renin essential hypertensive patients and patients with primary aldosteronism was enriched for the normally rare GSH, because patients suspected of having this disease are referred to our center by other investigators for analysis.



View larger version (85K):
[in this window]
[in a new window]
 
Figure 4. Genomic Southern blot of BamHI digested DNA from patients suspected of having glucocorticoid-suppressible hyperaldosteronism. Lane 1, size standard; lane 2, normal DNA control; and lanes 3 to 6, DNA that was positive in the 1S-2A PCR screen. Presence of a 6.3-kb band in lanes 3–6, which is at half the intensity of the 8.5- and 4.5-kb bands, indicates the presence of a duplication hybrid gene resulting from an unequal cross-over in a previous meiosis in all of these patients.

 
Although no gene conversions expected to result in GSH or low renin hypertension were detected, gene conversions do occur in the CYP11B genes (20, 22, 23, 24). Indeed, the high similarity between the two gene sequences is probably maintained in part by genetic recombination between them. In our sample of 90 normal individuals we found that 33% of the chromosomes carried the allele of CYP11B2 containing the intron 2 gene conversion (Fig. 5Go).



View larger version (49K):
[in this window]
[in a new window]
 
Figure 5. PCR screen for gene conversion of intron 2 of CYP11B2. In the common gene conversion of CYP11B2, most of intron 2 is replaced by that of intron 2 from CYP11B1. In that case, a PCR amplification reaction using mixed oligonucleotides from CYP11B1 and CYP11B2 (see Patients and Methods and oligonucleotides 5S and 6A in Fig. 3Go) will amplify a 0.5-kb product. Some positive and negative results are shown in lanes 2–16.

 

    Discussion
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
The transfection results presented in this study emphasize the importance of the glycine and alanine residues at positions 288 and 320, respectively, in the efficient oxidation of the 18 carbon in steroid biosynthesis. In particular, enzymes without these two residues were unable to catalyze synthesis of either aldosterone or 18-oxocortisol and catalyzed reduced amounts of 18OHB or 18-hydroxycortisol in our experiments. Other studies have reported that the V320A substitution alone is sufficient to enable the CYP11B1 enzyme to catalyze limited aldosterone synthesis (25, 26). However in those studies the CYP11B1 enzyme used differed from that used in the present study by containing the polymorphic substitutions V78I and V386A and an added carboxyterminal epitope, and bovine adrenodoxin was used as the only cofactor. The reason for the different results is not evident, but both studies highlight the importance of the alanine at position 320 for 18-oxidation, and the fact that other residues can also influence enzyme activity.

With DOC as the substrate, a CYP11B1 enzyme with the S288G and V320A substitutions synthesizes aldosterone as efficiently as the native CYP11B2 enzyme. However, when a 17-hydroxylated substrate is used, other residues in exons 4, 5, and 6 also affect the efficiency of catalysis at this position. Presumably, the amino acid substitutions involved induce conformational changes in the structure of the cytochrome P450 enzyme, affecting retention and presentation of the steroid precursor to the active heme group, which effects the catalysis. In addition to their implications about the structure and function of steroid cytochrome P450 enzymes, these results suggest constraints on the type of hybrid genes expected to lead to the inherited hypertensive syndrome GSH.

GSH is caused by the expression of an enzyme with C18 activities in the adrenal zona fasciculata/reticularis under the control of ACTH. This leads to hypersecretion of aldosterone and the steroids 18-hydroxycortisol and 18-oxocortisol under the influence of ACTH. The hybrid gene that causes the disease is normally formed by the juxtaposition of 5' sequences from the CYP11B1 gene and 3' coding sequences from the CYP11B2 gene as a result of an unequal cross-over in a previous meiosis. In this article we have demonstrated that a CYP11B1 gene containing sequence from exons 4, 5, and 6 of CYP11B2, which could result from a gene conversion event, can also encode an enzyme with C18 activities. In addition to being able to synthesize aldosterone from a DOC substrate, this hybrid enzyme is capable of catalyzing formation the normally rare steroids, 18-hydroxycortisol and 18-oxocortisol, which are overproduced in GSH and primary hyperaldosteronism (18). Because the converted gene is expected to be regulated like CYP11B1, we predict that such a gene would cause a novel form of GSH and that such patients could be found among those with primary aldosteronism or low renin essential hypertension. Our PCR-based primary screen revealed recombination of the CYP11B genes in four individuals with primary aldosteronism. Subsequent Southern blot analyses showed all these hybrid genes to have been generated by unequal crossing over.

Detection of CYP11B gene conversions is rendered difficult by the fact that exchanges between the two genes would not be expected to alter their 11ß-hydroxylase activity, because both encoded enzymes catalyze this activity. Nevertheless, several studies have noted the presence of CYP11B gene conversions involving intron 2 (22, 24), exons 3 and 4 (23), and exon 7 (20) of CYP11B2. In the present study we found a high frequency of the intron 2 gene conversion. Nevertheless, no examples of a gene conversion of CYP11B1 capable of causing GSH (i.e. involving exons 5 and 6) were detected among the 411 individual samples studied. We conclude that conversions of this type are at best rare and may not occur at all. If found, they would occur in patients with an unexplained phenotype similar to GSH or with low renin essential hypertension.


    Acknowledgments
 
We thank S. Portrat and Y. Morel for the kind gift of DNA from a patient with a deletion hybrid CYP11B gene used as a control in this study.


    Footnotes
 
1 This work was supported by a Bourse de Recherche from the IPSEN Foundation for Therapeutic Research and a grant from the Fondation pour la Recherche Medicale (to L.P.) and by a Fellowship from the Australian Foundation for High Blood Pressure Research (to K.M.C.). Back

2 Current address: Fondation Jean Dausset CEPH, 27 rue Juliette Dodu, 75010 Paris, France. Back

Received February 17, 1998.

Revised June 10, 1998.

Accepted July 28, 1998.


    References
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 

  1. Kawamoto T, Mitsuuchi Y, Ohnishi T, et al. 1990 Cloning and expression of a cDNA for human cytochrome P-450aldo as related to primary aldosteronism. Biochem Biophys Res Commun. 173:309–316.[CrossRef][Medline]
  2. Curnow KM, Tusie-Luna MT, Pascoe L, et al. 1991 The product of the CYP11B2 gene is required for aldosterone biosynthesis in the human adrenal cortex. Mol Endocrinol. 5:1513–1522.[Abstract/Free Full Text]
  3. Pascoe L, Jeunemaitre X, Lebrethon MC, et al. 1995 Glucocorticoid-suppressible hyperaldosteronism and adrenal tumors occurring in a single French pedigree. J Clin Invest. 96:2236–2246.
  4. Mornet E, Dupont J, Vitek A, White PC. 1989 Characterization of two genes encoding human steroid 11 beta-hydroxylase (P-450(11) beta). J Biol Chem. 264:20961–20967.[Abstract/Free Full Text]
  5. Lifton RP, Dluhy RG, Powers M, et al. 1992 Hereditary hypertension caused by chimaeric gene duplications and ectopic expression of aldosterone synthase. Nat Genet. 2:66–74.[CrossRef][Medline]
  6. Pascoe L, Curnow KM, Slutsker L, et al. 1992 Glucocorticoid-suppressible hyperaldosteronism results from hybrid genes created by unequal crossovers between CYP11B1 and CYP11B2. Proc Natl Acad Sci USA. 89:8327–8331.[Abstract/Free Full Text]
  7. Chua SC, Szabo P, Vitek A, Grzeschik KH, John M, White PC. 1987 Cloning of cDNA encoding steroid 11 beta-hydroxylase (P450c11). Proc Natl Acad Sci USA. 84:7193–7197.[Abstract/Free Full Text]
  8. Wagner MJ, Ge Y, Siciliano M, Wells DE. 1991 A hybrid cell mapping panel for regional localization of probes to human chromosome 8. Genomics. 10:114–125.[CrossRef][Medline]
  9. Sutherland DJA, Ruse JL, Laidlaw JC. 1966 Hypertension, increased aldosterone secretion and low plasma renin activity relieved by dexamethasone. Can Med Assoc J. 95:1109–1119.[Medline]
  10. New MI, Peterson RE. 1967 A new form of congenital adrenal hyperplasia. J Clin Endocrinol Metab. 27:300–305.[Free Full Text]
  11. Lifton RP, Dluhy RG, Powers M, et al. 1992 A chimaeric 11 beta-hydroxylase/aldosterone synthase gene causes glucocorticoid-remediable aldosteronism and human hypertension. Nature. 355:262–265.[CrossRef][Medline]
  12. Chu MD, Ulick SJ. 1982 Isolation and identification of 18-hydroxycortisol from the urine of patients with primary aldosteronism. J Biol Chem. 257:2218–2224.[Free Full Text]
  13. Ulick SJ, Chu MD, Land MJ. 1983 Biosynthesis of 18-oxocortisol by aldosterone-producing adrenal tissue. J Biol Chem. 258:5498–5502.[Abstract/Free Full Text]
  14. Gomez-Sanchez CE, Montgomery M, Ganguly A, et al. 1984 Elevated urinary excretion of 18-oxocortisol in glucocorticoid-suppressible aldosteronism. J Clin Endocrinol Metab. 59:1022–1024.[Abstract/Free Full Text]
  15. Ulick SJ, Chan CK, Gill GR, et al. 1990 Defective fasciculata zone function as the mechanism of glucocorticoid-remediable aldosteronism. J Clin Endocrinol Metab. 71:1151–1157.[Abstract/Free Full Text]
  16. Rich GM, Ulick SJ, Cook S, Wang JF, Lifton RP, Dluhy RG. 1992 Glucocorticoid-remediable aldosteronism in a large kindred: clinical spectrum and diagnosis using a characteristic biochemical phenotype. Ann Intern Med. 257:2218–2224.
  17. Curnow KM, Mulatero P, Emeric-Blanchouin N, Aupetit-Faisant B, Corvol P, Pascoe L. 1997 The amino acid substitutions Ser288Gly and Val320Ala convert the cortisol producing enzyme, CYP11B1, into an aldosterone producing enzyme [letter]. Nat Struct Biol. 4:32–35.[CrossRef][Medline]
  18. Ulick S, Blumenfeld JD, Atlas SA, Wang JZ, Vaughan Jr ED. 1993 The unique steroidogenesis of the aldosteronoma in the differential diagnosis of primary aldosteronism. J Clin Endocrinol Metab. 76:873–878.[Abstract]
  19. Litchfield WR, Dluhy RG. 1995 Primary aldosteronism. Endocrinol Metab Clin North Am. 24:593–612.[Medline]
  20. Pascoe L, Curnow KM, Slutsker L, Rosler A, White PC. 1992 Mutations in the human CYP11B2 (aldosterone synthase) gene causing corticosterone methyloxidase II deficiency. Proc Natl Acad Sci USA. 89:4996–5000.[Abstract/Free Full Text]
  21. Aupetit-Faisant B, Battaglia C, M Zenatti M, Emeric-Blanchouin N, Legrand JC. 1993 Hypoaldosteronism accompanied by normal or elevated mineralocorticoid pathway steroid: a marker of adrenal carcinoma. J Clin Endocrinol Metab. 76:38–43.[Abstract]
  22. White PC, Slutsker L. 1995 Haplotype analysis of CYP11B2. Endocr Res. 21:437–442.[Medline]
  23. Fardella CE, Hum DW, Rodriguez H, et al. 1996 Gene conversion in the CYP11B2 gene encoding P450c11AS is associated with, but does not cause, the syndrome of corticosterone methyloxidase II deficiency. J Clin Endocrinol Metab. 81:321–326.[Abstract]
  24. Brand E, Chatelain N, Mulatero P, et al. 1998 Evaluation of the aldosterone synthase (CYP11B2) gene in human essential hypertension. Hypertension. 32:198–204.[Abstract/Free Full Text]
  25. Bottner B, Denner K, Bernhardt R. 1998 Conferring aldosterone synthesis to human CYP11B1 by replacing key amino acid residues with CYP11B2-specific ones. Eur J Biochem. 252:458–466.[Medline]
  26. Bottner B, Bernhardt R. 1996 Changed ratios of glucocorticoids/mineralocorticoids caused by point mutations in the putative I-helix regions of CYP11B1 and CYP11B2. Endocr Res. 22:455–461.[Medline]



This article has been cited by other articles:


Home page
Eur J EndocrinolHome page
F Morello, D Schiavone, G Mengozzi, C Bertello, C C Liew, D Bisbocci, P Mulatero, and F Veglio
Adrenal endothelin-1 levels are not associated with aldosterone secretion in primary aldosteronism
Eur. J. Endocrinol., March 1, 2009; 160(3): 453 - 458.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. Mulatero, C. Bertello, D. Rossato, G. Mengozzi, A. Milan, C. Garrone, G. Giraudo, G. Passarino, D. Garabello, A. Verhovez, et al.
Roles of Clinical Criteria, Computed Tomography Scan, and Adrenal Vein Sampling in Differential Diagnosis of Primary Aldosteronism Subtypes
J. Clin. Endocrinol. Metab., April 1, 2008; 93(4): 1366 - 1371.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. J. Auchus, D. W. Chandler, S. Singeetham, N. Chokshi, F. E. Nwariaku, B. L. Dolmatch, S. A. Holt, F. H. Wians Jr., S. C. Josephs, C. K. Trimmer, et al.
Measurement of 18-Hydroxycorticosterone during Adrenal Vein Sampling for Primary Aldosteronism
J. Clin. Endocrinol. Metab., July 1, 2007; 92(7): 2648 - 2651.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. Mulatero, A. Milan, F. Fallo, G. Regolisti, F. Pizzolo, C. Fardella, L. Mosso, L. Marafetti, F. Veglio, and M. Maccario
Comparison of Confirmatory Tests for the Diagnosis of Primary Aldosteronism
J. Clin. Endocrinol. Metab., July 1, 2006; 91(7): 2618 - 2623.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
H. Sanada, J. Yatabe, S. Midorikawa, S. Hashimoto, T. Watanabe, J. H. Moore, M. D. Ritchie, S. M. Williams, J. C. Pezzullo, M. Sasaki, et al.
Single-Nucleotide Polymorphisms for Diagnosis of Salt-Sensitive Hypertension
Clin. Chem., March 1, 2006; 52(3): 352 - 360.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
E. M. Freel, L. A. Shakerdi, E. C. Friel, A. M. Wallace, E. Davies, R. Fraser, and J. M. C. Connell
Studies on the Origin of Circulating 18-Hydroxycortisol and 18-Oxocortisol in Normal Human Subjects
J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4628 - 4633.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. Mulatero, M. Stowasser, K.-C. Loh, C. E. Fardella, R. D. Gordon, L. Mosso, C. E. Gomez-Sanchez, F. Veglio, and W. F. Young Jr.
Increased Diagnosis of Primary Aldosteronism, Including Surgically Correctable Forms, in Centers from Five Continents
J. Clin. Endocrinol. Metab., March 1, 2004; 89(3): 1045 - 1050.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
P. Mulatero, F. Rabbia, A. Milan, C. Paglieri, F. Morello, L. Chiandussi, and F. Veglio
Drug Effects on Aldosterone/Plasma Renin Activity Ratio in Primary Aldosteronism
Hypertension, December 1, 2002; 40(6): 897 - 902.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. Mulatero, S. M. di Cella, T. A. Williams, A. Milan, G. Mengozzi, L. Chiandussi, C. E. Gomez-Sanchez, and F. Veglio
Glucocorticoid Remediable Aldosteronism: Low Morbidity and Mortality in a Four-Generation Italian Pedigree
J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3187 - 3191.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. Mulatero, T. A. Williams, A. Milan, C. Paglieri, F. Rabbia, F. Fallo, and F. Veglio
Blood Pressure in Patients with Primary Aldosteronism Is Influenced by Bradykinin B2 Receptor and {alpha}-Adducin Gene Polymorphisms
J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3337 - 3343.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. E. Fardella, M. Pinto, L. Mosso, C. Gomez-Sanchez, J. Jalil, and J. Montero
Genetic Study of Patients with Dexamethasone-Suppressible Aldosteronism without the Chimeric CYP11B1/CYP11B2 Gene
J. Clin. Endocrinol. Metab., October 1, 2001; 86(10): 4805 - 4807.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Portrat, P. Mulatero, K. M. Curnow, J.-L. Chaussain, Y. Morel, and L. Pascoe
Deletion Hybrid Genes, due to Unequal Crossing Over between CYP11B1 (11{beta}-Hydroxylase) and CYP11B2(Aldosterone Synthase) Cause Steroid 11{beta}-Hydroxylase Deficiency and Congenital Adrenal Hyperplasia
J. Clin. Endocrinol. Metab., July 1, 2001; 86(7): 3197 - 3201.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
P. Mulatero, F. Rabbia, and F. Veglio
Paraneoplastic Hyperaldosteronism Associated with Non-Hodgkin's Lymphoma
N. Engl. J. Med., May 17, 2001; 344(20): 1558 - 1559.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Glucocorticoid-Remediable Aldosteronism
J. Clin. Endocrinol. Metab., December 1, 1999; 84(12): 4341 - 4344.
[Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
C. Pilon, P. Mulatero, L. Barzon, F. Veglio, C. Garrone, M. Boscaro, N. Sonino, and F. Fallo
Mutations in CYP11B1 Gene Converting 11{beta}-Hydroxylase into an Aldosterone-Producing Enzyme Are Not Present in Aldosterone-Producing Adenomas
J. Clin. Endocrinol. Metab., November 1, 1999; 84(11): 4228 - 4231.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
B. I. Cerame, R. S. Newfield, L. Pascoe, K. M. Curnow, S. Nimkarn, T. F. Roe, M. I. New, and R. C. Wilson
Prenatal Diagnosis and Treatment of 11{beta}-Hydroxylase Deficiency Congenital Adrenal Hyperplasia Resulting in Normal Female Genitalia
J. Clin. Endocrinol. Metab., September 1, 1999; 84(9): 3129 - 3134.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mulatero, P.
Right arrow Articles by Pascoe, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mulatero, P.
Right arrow Articles by Pascoe, L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals