| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
INSERM U36 (P.M., K.M.C., X.J,. P.C., L.P.), Collège de France, 75005 Paris, France; Department of Medicine and Experimental Oncology (F.V., P.M.), University of Turin, Italy; Baker Medical Research Institute (K.M.C.), Prahran, 3181 Victoria, Australia; Service de Biochimie (B.A-F.), Hôpital de la Pitié-Salpétrière, 75651 Paris, France; and Harry S. Truman Memorial Hospital (C.G-S., M.F.), Department of Internal Medicine, Columbia Missouri 65201-5297
Address all correspondence and requests for reprints to: Leigh Pascoe, Fondation Jean Dausset CEPH, 27 rue Juliette Dodu, 75010 Paris, France. E-mail: leigh{at}cephb.fr
 |
Abstract |
|---|
 Top Abstract IntroductionPatients and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
-hydroxylase activity) to the zona
fasciculata/reticularis leads to a functional zonation of the synthesis
of aldosterone and cortisol to those zones, respectively. The two 93%
identical CYP11B enzymes are encoded by two genes with identical
exon/intron structures (4), which are located 40 kilobases (kb) apart
(5, 6) on chromosome 8q22 (7, 8). The normal zonation of aldosterone synthesis is disturbed in the dominantly inherited hypertensive syndrome, glucocorticoid suppressible hyperaldosteronism (GSH) (9, 10). This disease is caused by the presence of a hybrid CYP11B gene that has CYP11B1 sequences, including the promoter, at the 5' end of the gene and CYP11B2 sequences at the 3' end (5, 6, 11). The hybrid genes are believed to have arisen from unequal crossing over between the two CYP11B genes in previous meioses. The presence of the CYP11B1 promoter ensures expression of the hybrid gene throughout the cortex, under the control of ACTH, whereas the coding sequences from CYP11B2 lead to inappropriate synthesis of aldosterone as well as the normally rare steroids, 18-hydroxycortisol and 18-oxocortisol. The latter two steroids are characteristic of the disease (12, 13, 14, 15, 16). In this article we show that the hybrid CYP11B genes detected in GSH encode hybrid enzymes with the capacity to catalyze the synthesis of these two steroids from their precursor, 11-deoxycortisol.
We have previously shown that only 2 of the 35 amino acid differences distinguishing the CYP11B1 and CYP11B2 enzymes are responsible for the additional efficient 18-hydroxylase and 18-oxidase activities possessed by CYP11B2 but not CYP11B1 (17). The amino acid substitution S288G in CYP11B1 confers on it an efficient 18-hydroxylase activity, and the additional substitution V320A then confers the 18-oxidase activity required for aldosterone synthesis, when DOC is used as the substrate. These amino acids are encoded in exons 5 and 6 of CYP11B2, respectively. In this study we show that the same two substitutions also confer on the CYP11B1 enzyme the additional capacity to synthesize 18-hydroxycortisol and 18-oxocortisol from an 11-deoxycortisol precursor. However, the efficiency of synthesis of these steroids is poor when only the S-288 and V-320 residues of CYP11B1 are replaced by those of CYP11B2. More efficient synthesis of 18-oxocortisol occurs with the substitution of all 10 of the amino acid residue differences encoded in exons 4, 5, and 6 of CYP11B2 into the CYP11B1 enzyme. These data show that in addition to the unequal crossing over events between the CYP11B1 and CYP11B2 genes that cause GSH, gene conversions of CYP11B1 involving exons 4, 5, and 6 can potentially cause a novel form of GSH and low renin hypertension. Gene conversion events of this type would not be detected by the Southern blot screening protocol for GSH (11) if only the EcoRI restriction enzyme were used.
We have therefore investigated whether gene conversion of the CYP11B genes is observed in the groups of hypertensive patients in which GSH is sometimes identified by genetic screening. The individuals studied included 103 low renin hypertensive patients, 218 patients with primary hyperaldosteronism, and 90 normal individuals. Those with primary aldosteronism were included because increased levels of 18-hydroxycortisol and 18-oxocortisol, in addition to aldosterone, are detected in the plasma of these individuals (18). The PCR screening strategy implemented was designed to permit identification of GSH caused by inheritance of a hybrid CYP11B gene, whether it had been generated by an unequal crossing over or a gene conversion. The two types of hybrid gene were subsequently distinguished by Southern blot analyses and additional PCR reactions. In the samples studied, we found four cases of classical GSH, a high level of gene conversion and polymorphism, but no conversions involving exons 4, 5, and 6, which would be expected to lead to these forms of hypertension or GSH. We conclude that if such gene conversions do exist, they are not a common cause of GSH, low renin essential hypertension, or primary hyperaldosteronism.
|
Patients and Methods |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
The subjects investigated in this study comprised 103 low-renin hypertensive patients, 218 patients diagnosed with primary aldosteronism, and 90 normal control individuals of French Caucasian origin. The study was approved by a local review committee, and all subjects gave informed consent. Plasma renin activity in the low renin subgroup was <0.3 ng angiotensin I/mL per h in blood samples taken after 2 h clinostatism. Primary hyperaldosteronism was diagnosed by standard clinical features (19).
Generation of hybrid complementary DNA (cDNA) constructs and transfection of COS cells
Hybrid constructs were made by PCR mutagenesis and cloned into the expression vector pCMV4 as previously described (2, 20). Plasmid DNA was transfected into COS-7 cells using cationic liposomes (Lipofectamine, Gibco BRL, Gaithersburg, MD) and incubated with radioactively labeled or unlabeled DOC or 11-deoxycortisol as previously described (2, 17). The resulting steroids were analyzed by thin-layer chromatography (TLC) in experiments performed with radioactive substrates as previously described (2), or by RIA in those performed with unlabeled precursors (21). Radioactive products were also quantified by scanning the TLC plates with a ß-scanner.
Detection of gene-conversion in exon 5 of CYP11B1
Genomic DNA, prepared from peripheral blood leukocytes, was amplified by long PCR (Expand Long Template PCR System, Boehringer Mannheim, Indianapolis, IN) using a sense primer corresponding to sequence from the promoter region of CYP11B1 (TTTGAATTCTCGAAGGCAAGGCACCAG) and an antisense primer specific to exon 5 of CYP11B2 (TGCCACGATGCCTGTGTAGTG), according to the manufacturer’s recommendations. Specifically, reactions were performed in thin-walled 0.2-mL tubes in a gene Amp PCR System 2400 thermocycler (PE Applied Biosystems) with samples being denatured at 94 C for 2 min and then subjected to 35 cycles of 94 C for 10 sec, 65 C for 30 sec, and 68 C for 3 min, with the extension phase increasing by 10 sec each cycle. Genomic DNA from a patient previously diagnosed with GSH was used as a positive control for this reaction to amplify the expected 3.6-kb PCR product. To distinguish between the classical hybrid gene, generated by an unequal crossing over, and a gene conversion, a second PCR reaction was performed. In this reaction the sense primer corresponded to sequence from the same region of exon 5 in CYP11B2 (CAACACTACACAGGCATCGTC) and the antisense primer to sequence from exon 8 of CYP11B1 (AGAGTAGAGGAACACGCGCAC), and amplification was performed with Amplitaq DNA polymerase (PE Applied Biosystems, Norwalk, CT) in the presence of 1.5 mM MgCl2. In this assay the reactions were denatured at 94 C for 1 min, followed by 35 cycles of 94 C for 1 min, 65 C for 1 min, and 72 C for 2 min, with the extension phase increasing by 5 sec each cycle. As a positive control for this reaction we used a cDNA construct with exons 1–3 and 7 and 8 from CYP11B1 and exons 5 and 6 from CYP11B2, as well as genomic DNA from an individual with a deletion hybrid gene containing exons 1–6 of CYP11B2 and exons 7–9 of CYP11B1.
Genomic Southern blotting
Genomic DNA (5 µg) was digested with BamHI,
subjected to electrophoresis in a 0.8% agarose gel and transferred to
nylon membranes in 10x SSC (1.5 M NaCl, 0.15 M
sodium citrate). Blots were hybridized with a PCR product containing
exons 3–6 of CYP11B1 cDNA that had been radioactively
labeled with -[32P]-dCTP by random priming (6). Final
stringent washes were at 65 C in 0.2x SSC/0.1%SDS.
Detection of gene conversion in intron 2 of CYP11B2
Conversion of most of intron 2 of CYP11B2 by sequence from CYP11B1 has been previously reported (22) and observed by us in unpublished studies. We tested a sample of 81 normal individuals for the presence of this conversion by PCR using a sense primer from intron 2 of CYP11B1 (GCAGAAAATCCCTCCCCCCTA) and an antisense primer corresponding to intron 3 of CYP11B2 (TGGGGCTGGACCTTCCCGCAT). The positive control for these reactions was an individual known to have a gene conversion of intron 2.
|
Results |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
We have previously shown that a cDNA with exons 1–3 and 7–9 of
CYP11B1 and exons 4–6 of CYP11B2 encodes an
enzyme with full aldosterone synthase activity (17), catalyzing
11ß-hydroxylation, 18-hydroxylation, and further 18-oxidation of DOC.
Further analysis of hybrid constructs in transient transfection assays
showed that a CYP11B1 enzyme with a glycine at position 288 and an
alanine at position 320 (the residues normally present at these
positions in the CYP11B2 enzyme) also has strong aldosterone synthase
activity (Fig. 1
). As shown in Fig. 1, the glycine at
position 288, which carries a small nonpolar side chain, is permissive
for an efficient 18-hydroxylase activity, but no significant 18-oxidase
activity is observed without the further substitution of an alanine at
position 320. CYP11B1 enzymes, having a serine at position 288, which
has a larger polar side chain, have a relatively inefficient
18-hydroxylase activity under the transfection conditions.
Consequently, CYP11B1 enzymes carrying only V320A (and not S288G) are
unable to synthesize aldosterone (17).
|
). These data suggest a permissive role for the
small glycine residue at position 288 of CYP11B2 in the efficient
catalysis of 18-hydroxylation of the 18 carbon of 17-deoxysteroid
substrates.
In contrast to transfection experiments using DOC as the substrate,
transfections using the 17-hydroxylated steroid precursor,
11-deoxycortisol, showed that CYP11B2 was relatively inefficient at
carrying out further 18-hydroxylation and 18-oxidation. As shown in
Fig. 1, experiments using DOC as the substrate typically result in
100% conversion to 18-hydroxylated forms, whereas those with
11-deoxycortisol (shown in Fig. 2) result in the
conversion of most of the substrate to cortisol during the 24-h
incubation period. Nevertheless, transfections with CYP11B2
cDNAs did produce easily detectable 18-hydroxycortisol and
18-oxocortisol (Fig. 2 and Table 1),
whereas those with CYP11B1 cDNA did not. Similarly, other
constructs containing the CYP11B1 sequence but with the
substitutions of the residues encoded in exons 4, 5, and 6, or with
S288G and V320A alone, produced detectable 18-hydroxycortisol and
18-oxocortisol. However, the level of conversion of 11-deoxycortisol to
18-oxocortisol was only 1.2% with the latter hybrid enzyme, compared
to the 18% observed with native CYP11B2. A 4-fold better conversion
(4.8%) was achieved with the CYP11B enzyme containing substitutions at
positions 285, 288, and 320, and 9.1% conversion was observed with the
hybrid enzyme containing the 10 residues encoded in exons 4, 5, and 6
of CYP11B2. No substantial 18-oxocortisol production was
detected in transfections using any of the cDNA constructs that did not
encode both a glycine at position 288 and an alanine at position
320.
|
|
and the thin-layer chromatograms shown in Fig. 2
shows that constructs with the 288G substitution produce greater
amounts of 18-hydroxycortisol than the CYP11B1 cDNA in
transfections, as well as the presence of several unidentified
steroids. Some of these unidentified steroids are a result of
metabolism of 11-deoxycortisol in these cells and are seen in
transfections performed with the vector alone. The unidentified steroid
labeled with a question mark in Fig. 2 is, like cortisol,
synthesized in cells transfected with any of the CYP11B
constructs. Its identity is not known, but it may correspond to
18-hydroxy-11-deoxycortisol, or 19-hydroxycortisol, compounds, which
are expected to be more polar than both 11-deoxycortisol and
cortisol. One of the features of patients with GSH and primary aldosteronism is their production of the normally rare 17-hydroxysteroids, 18-hydroxycortisol and 18-oxocortisol. Production of these steroids requires the 17-hydroxylase activity normally found in the adrenal zona fasciculata/reticularis (and not in the zona glomerulosa), as well as the C18 activities of CYP11B2, whose expression is normally limited to the adrenal zona glomerulosa. In our transfection experiments using the 17-hydroxylated precursor 11-deoxycortisol as a substrate, we found that the native CYP11B2 enzyme catalyzed the synthesis of these steroids, and that hybrid CYP11B1 enzymes having only a few residues from the central region of CYP11B2 could also produce them. Hybrid enzymes of this type could be produced by conversion of the CYP11B1 gene by sequences from exons 4, 5, and 6 of CYP11B2 and would result in the expression of the hybrid gene product in the zona fasciculata/reticularis where the native CYP11B1 enzyme is normally expressed. Consequently, we predict that a converted CYP11B1 gene, carrying, at a minimum, the mutations S288G and V320A, would also lead to GSH. Conversely, a gene conversion that resulted in the replacement of the CYP11B2 regulatory regions by those of CYP11B1 would also be expected to result in a GSH phenotype.
Detection of hybrid and converted CYP11B1 genes
We searched specifically for gene conversions involving exons 5
and 6 that could lead to a hybrid gene encoding an enzyme capable of
aldosterone synthesis. Because a glycine at position 288 was found to
be essential for permitting efficient C18 activity in CYP11B enzymes,
either with DOC or 11-deoxycortisol as a substrate, we used antisense
oligonucleotides containing this codon from CYP11B2,
together with a sense oligonucleotide containing upstream sequence from
the CYP11B1 promoter, in our primary PCR screen for hybrid
genes (Fig. 3). This PCR strategy was designed to detect
all recombination events that would result in the generation of a
hybrid CYP11B gene encoding enzymes with 18-oxocortisol and
aldosterone synthase activity, arising from either unequal crossing
over, gene conversion of CYP11B1 that introduced
CYP11B2 coding sequences from exons surrounding and
including exon 5, or from a gene conversion of CYP11B2 in
which promoter sequences from CYP11B1 were transferred into
CYP11B2. In a sample of 218 patients with primary
hyperaldosteronism and 103 low renin essential hypertensive patients, a
hybrid CYP11B gene segment was amplified from four of the
DNA samples in the former group and none in the latter (Fig. 3).
|
), except those
from the two control DNAs. Consequently, the positive results obtained
in the 5' PCR screen corresponded to patients with either gene
conversions of the promoter region of CYP11B2 or the
classical form of GSH.
These two possibilities were distinguished by Southern blot analyses
using the enzyme BamHI (Fig. 4), where the
duplication hybrid gene was detected in all four patients at half the
intensity of the wild-type sequences, as would be expected if the gene
had arisen from an unequal cross-over event. Our sample of low renin
essential hypertensive patients and patients with primary aldosteronism
was enriched for the normally rare GSH, because patients suspected of
having this disease are referred to our center by other investigators
for analysis.
|
).
|
|
Discussion |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
With DOC as the substrate, a CYP11B1 enzyme with the S288G and V320A substitutions synthesizes aldosterone as efficiently as the native CYP11B2 enzyme. However, when a 17-hydroxylated substrate is used, other residues in exons 4, 5, and 6 also affect the efficiency of catalysis at this position. Presumably, the amino acid substitutions involved induce conformational changes in the structure of the cytochrome P450 enzyme, affecting retention and presentation of the steroid precursor to the active heme group, which effects the catalysis. In addition to their implications about the structure and function of steroid cytochrome P450 enzymes, these results suggest constraints on the type of hybrid genes expected to lead to the inherited hypertensive syndrome GSH.
GSH is caused by the expression of an enzyme with C18 activities in the adrenal zona fasciculata/reticularis under the control of ACTH. This leads to hypersecretion of aldosterone and the steroids 18-hydroxycortisol and 18-oxocortisol under the influence of ACTH. The hybrid gene that causes the disease is normally formed by the juxtaposition of 5' sequences from the CYP11B1 gene and 3' coding sequences from the CYP11B2 gene as a result of an unequal cross-over in a previous meiosis. In this article we have demonstrated that a CYP11B1 gene containing sequence from exons 4, 5, and 6 of CYP11B2, which could result from a gene conversion event, can also encode an enzyme with C18 activities. In addition to being able to synthesize aldosterone from a DOC substrate, this hybrid enzyme is capable of catalyzing formation the normally rare steroids, 18-hydroxycortisol and 18-oxocortisol, which are overproduced in GSH and primary hyperaldosteronism (18). Because the converted gene is expected to be regulated like CYP11B1, we predict that such a gene would cause a novel form of GSH and that such patients could be found among those with primary aldosteronism or low renin essential hypertension. Our PCR-based primary screen revealed recombination of the CYP11B genes in four individuals with primary aldosteronism. Subsequent Southern blot analyses showed all these hybrid genes to have been generated by unequal crossing over.
Detection of CYP11B gene conversions is rendered difficult by the fact that exchanges between the two genes would not be expected to alter their 11ß-hydroxylase activity, because both encoded enzymes catalyze this activity. Nevertheless, several studies have noted the presence of CYP11B gene conversions involving intron 2 (22, 24), exons 3 and 4 (23), and exon 7 (20) of CYP11B2. In the present study we found a high frequency of the intron 2 gene conversion. Nevertheless, no examples of a gene conversion of CYP11B1 capable of causing GSH (i.e. involving exons 5 and 6) were detected among the 411 individual samples studied. We conclude that conversions of this type are at best rare and may not occur at all. If found, they would occur in patients with an unexplained phenotype similar to GSH or with low renin essential hypertension.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Current address: Fondation Jean Dausset CEPH, 27 rue Juliette Dodu,
75010 Paris, France.
Received February 17, 1998.
Revised June 10, 1998.
Accepted July 28, 1998.
|
References |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  P. Mulatero, C. Bertello, D. Rossato, G. Mengozzi, A. Milan, C. Garrone, G. Giraudo, G. Passarino, D. Garabello, A. Verhovez, et al. Roles of Clinical Criteria, Computed Tomography Scan, and Adrenal Vein Sampling in Differential Diagnosis of Primary Aldosteronism Subtypes J. Clin. Endocrinol. Metab., April 1, 2008; 93(4): 1366 - 1371. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. Auchus, D. W. Chandler, S. Singeetham, N. Chokshi, F. E. Nwariaku, B. L. Dolmatch, S. A. Holt, F. H. Wians Jr., S. C. Josephs, C. K. Trimmer, et al. Measurement of 18-Hydroxycorticosterone during Adrenal Vein Sampling for Primary Aldosteronism J. Clin. Endocrinol. Metab., July 1, 2007; 92(7): 2648 - 2651. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Mulatero, A. Milan, F. Fallo, G. Regolisti, F. Pizzolo, C. Fardella, L. Mosso, L. Marafetti, F. Veglio, and M. Maccario Comparison of Confirmatory Tests for the Diagnosis of Primary Aldosteronism J. Clin. Endocrinol. Metab., July 1, 2006; 91(7): 2618 - 2623. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Sanada, J. Yatabe, S. Midorikawa, S. Hashimoto, T. Watanabe, J. H. Moore, M. D. Ritchie, S. M. Williams, J. C. Pezzullo, M. Sasaki, et al. Single-Nucleotide Polymorphisms for Diagnosis of Salt-Sensitive Hypertension Clin. Chem., March 1, 2006; 52(3): 352 - 360. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. M. Freel, L. A. Shakerdi, E. C. Friel, A. M. Wallace, E. Davies, R. Fraser, and J. M. C. Connell Studies on the Origin of Circulating 18-Hydroxycortisol and 18-Oxocortisol in Normal Human Subjects J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4628 - 4633. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Mulatero, M. Stowasser, K.-C. Loh, C. E. Fardella, R. D. Gordon, L. Mosso, C. E. Gomez-Sanchez, F. Veglio, and W. F. Young Jr. Increased Diagnosis of Primary Aldosteronism, Including Surgically Correctable Forms, in Centers from Five Continents J. Clin. Endocrinol. Metab., March 1, 2004; 89(3): 1045 - 1050. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Mulatero, F. Rabbia, A. Milan, C. Paglieri, F. Morello, L. Chiandussi, and F. Veglio Drug Effects on Aldosterone/Plasma Renin Activity Ratio in Primary Aldosteronism Hypertension, December 1, 2002; 40(6): 897 - 902. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Mulatero, S. M. di Cella, T. A. Williams, A. Milan, G. Mengozzi, L. Chiandussi, C. E. Gomez-Sanchez, and F. Veglio Glucocorticoid Remediable Aldosteronism: Low Morbidity and Mortality in a Four-Generation Italian Pedigree J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3187 - 3191. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Mulatero, T. A. Williams, A. Milan, C. Paglieri, F. Rabbia, F. Fallo, and F. Veglio Blood Pressure in Patients with Primary Aldosteronism Is Influenced by Bradykinin B2 Receptor and {alpha}-Adducin Gene Polymorphisms J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3337 - 3343. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. Fardella, M. Pinto, L. Mosso, C. Gomez-Sanchez, J. Jalil, and J. Montero Genetic Study of Patients with Dexamethasone-Suppressible Aldosteronism without the Chimeric CYP11B1/CYP11B2 Gene J. Clin. Endocrinol. Metab., October 1, 2001; 86(10): 4805 - 4807. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Portrat, P. Mulatero, K. M. Curnow, J.-L. Chaussain, Y. Morel, and L. Pascoe Deletion Hybrid Genes, due to Unequal Crossing Over between CYP11B1 (11{beta}-Hydroxylase) and CYP11B2(Aldosterone Synthase) Cause Steroid 11{beta}-Hydroxylase Deficiency and Congenital Adrenal Hyperplasia J. Clin. Endocrinol. Metab., July 1, 2001; 86(7): 3197 - 3201. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Mulatero, F. Rabbia, and F. Veglio Paraneoplastic Hyperaldosteronism Associated with Non-Hodgkin's Lymphoma N. Engl. J. Med., May 17, 2001; 344(20): 1558 - 1559. [Full Text] [PDF]
|
|
|
|
|
|
Glucocorticoid-Remediable Aldosteronism J. Clin. Endocrinol. Metab., December 1, 1999; 84(12): 4341 - 4344. [Full Text]
|
|
|
|
|
|
C. Pilon, P. Mulatero, L. Barzon, F. Veglio, C. Garrone, M. Boscaro, N. Sonino, and F. Fallo Mutations in CYP11B1 Gene Converting 11{beta}-Hydroxylase into an Aldosterone-Producing Enzyme Are Not Present in Aldosterone-Producing Adenomas J. Clin. Endocrinol. Metab., November 1, 1999; 84(11): 4228 - 4231. [Abstract] [Full Text]
|
|
|
|
|
|
B. I. Cerame, R. S. Newfield, L. Pascoe, K. M. Curnow, S. Nimkarn, T. F. Roe, M. I. New, and R. C. Wilson Prenatal Diagnosis and Treatment of 11{beta}-Hydroxylase Deficiency Congenital Adrenal Hyperplasia Resulting in Normal Female Genitalia J. Clin. Endocrinol. Metab., September 1, 1999; 84(9): 3129 - 3134. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
