| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Center for Mineral Metabolism and Clinical Research, University of Texas Southwestern Medical Center, Dallas, Texas 75235-8885
Address all correspondence and requests for reprints to: Dr. William L. Gitomer, Center for Mineral Metabolism and Clinical Research, 8885 University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, Texas 75235-8885. E-mail: william.gitomer{at}email.swmed.edu
 |
Abstract |
|---|
 Top Abstract IntroductionExperimental SubjectsMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionExperimental SubjectsMaterials and MethodsResultsDiscussionReferences |
|---|
Complementary DNA isolated from rat kidney or intestine, when expressed in Xenopus oocytes, has been shown to induce sodium-independent transport of cystine (9). The human complementary DNA coding for this transport inducer, referred to as rBAT, D2H, and SLC3A1, has been isolated and sequenced (10, 11). Studies of genomic DNA have shown the gene to consist of 10 exons, ranging in size from 120–438 bp (12, 13, 14). To date, 29 different mutations (14, 15, 16, 17, 18, 19, 20, 21, 22) have been reported in the SLC3A1 gene in cystinuric patients. In this study we describe 8 previously unreported mutations in the same gene and report the frequency of occurrence of all 37 mutations in our cystinuric patient population.
|
Experimental Subjects |
|---|
|
TopAbstractIntroductionExperimental SubjectsMaterials and MethodsResultsDiscussionReferences |
|---|
|
Materials and Methods |
|---|
|
TopAbstractIntroductionExperimental SubjectsMaterials and MethodsResultsDiscussionReferences |
|---|
DNA was extracted from ethylenediamine tetraacetate-treated whole blood or Epstein-Barr virus-transformed B lymphocytes (24) using Qiagen Blood and Cell Culture DNA kits (Chatsworth, CA). The promoter, exons, and intron-exon boundaries were first screened for mutations using a MisMatch Detect II kit (Ambion, Inc., Austin, TX) that was adapted from previously described ribonuclease (RNase) cleavage assays (25, 26). Genomic DNA was amplified using specific primer pairs with a T7 ribonucleic acid (RNA) polymerase promoter sequence (TAATACGACTCACTATAGGG) added to the 5'-end of the sense primer, and a SP6 RNA polymerase promoter sequence (ATTTAGGTGACACTATAGGA) added to the 5'-end of the antisense primer. Incubation of the resultant PCR product with either T7 or SP6 RNA polymerase resulted in synthesis of RNA complementary to either the sense or the antisense strand of DNA. RNA/RNA duplexes were made by hybridizing complementary wild-type and experimental transcripts, which were subjected to RNase digestion. Cleavage of the RNA duplex occurred at unpaired bases. Cleavage products were separated on native 2% agarose gels and detected under UV light in the presence of ethidium bromide. The primer pairs used were modifications of those described previously. Primers for the promoter region and exon 1 (12), primers for exons 2, 3, and 6–10 (21), and primers for exons 4 and 5 (14) were described previously.
Reagents for PCR reactions were obtained from Perkin-Elmer (Norwalk, CT), and PCR conditions were as previously described (12, 14, 21) with the following changes. Taq Gold polymerase (Perkin-Elmer) was used instead of Taq polymerase, and 1.5 mmol/L MgCl2 was used for all exons except 4 and 5, where 2.0 mmol/L MgCl2 was used. The thermal cycling conditions were an initial 12-min incubation at 95 C to activate the Taq Gold polymerase, then 35 cycles at 95 C for 1 min, at the annealing temperature for 2 min, and then at 72 C for 2 min. This was followed by a final 10-min incubation at 72 C. The annealing temperature was 57 C for all of the exons, except 1, 4, and 5. The promoter and exon 1 were amplified using an annealing temperature of 55 C, and exons 4 and 5 were amplified using an annealing temperature of 52 C.
PCR reaction products in which the RNA mismatch screening indicated that mutations were present were sequenced using an ABI Prism Automated DNA Sequencer (model 377, PE Applied Biosystems, Foster City, CA) using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer). The PCR reaction products were sequenced in both directions using the primers described above.
The restriction enzymes BsrI and BsmFI were obtained from New England Biolabs, Inc. (Beverly, MA). Restriction enzyme digests were performed using the conditions described by the manufacturer, with 5 µL PCR reaction product in a final volume of 10 µL. Two units of BsmFI (restriction site destroyed by G1934C mutation, exon 10) and 5 U BsrI (restriction site created by T1607G mutation, exon 9) were used per reaction.
|
Results |
|---|
|
TopAbstractIntroductionExperimental SubjectsMaterials and MethodsResultsDiscussionReferences |
|---|
Mutation identification and sequencing
We used a RNA MisMatch Detect II kit to screen for mutations in
PCR products derived from genomic DNA of our patients. Figure 1
shows a 2% agarose gel illustrating
the cleavage products that result when there is a mismatch between two
strands of complementary RNA (the range of bases bracketed by the
primers was -133 to 430+16, which corresponded to all of exon 1 and
133 nucleotides of the promoter region). Two different sets of cleavage
products can be seen. One set of cleavage products occurs in lanes 1,
2, 9, and 10, and the other set occurs in lanes 3, 8, 11, and 12. Lane
6 contains the wild-type control. Subsequent sequencing of the PCR
reaction products revealed that both sets of cleavage products were due
to previously reported polymorphisms in exon 1. The first set of
cleavage products was due to a C/A polymorphism at nucleotide 114 (15),
and the second set was due to an A/T polymorphism at nucleotide 231
(18). Using the MisMatch methodology to first identify the presence of
mutations followed by sequencing of the PCR products to characterize
the mutations enabled us to identify 14 different mutations (Table 1) and 5 polymorphisms in our patient
population. Eight of the mutations have not previously been reported.
The polymorphisms present were A/C 114 (15), T/A 231 (18), 1136+3 del T
(18), T/C 1332+7 (21), and A/G 1854 (18). Electropherograms
demonstrating the new mutations are shown in Figs. 2 and 3.
Four of the new mutations were missense mutations (Fig. 2) that caused
changes in amino acids that were conserved at these positions in the
rat, rabbit, and human proteins. The missense mutations were a G to C
change at nucleotide 1934 (Fig. 2A) that would be expected to cause a
substitution of alanine for glycine 645 in the third intracellular
domain of the expressed protein (Fig. 4),
a C to G change at nucleotide 1259 (Fig. 2B) that would be expected to
cause a substitution of cysteine for serine 420 in the second
intracellular domain of the protein (Fig. 4), a G to T change at
nucleotide 1607 (Fig. 2C) that would be expected to cause a
substitution of glycine for valine 536 in the second extracellular
domain of the protein (Fig. 4), and a G to A change at nucleotide 1373
(Fig. 2D) that would be expected to cause a substitution of glutamate
for glycine 458 in the second intracellular domain of the protein (Fig. 4). The G1934C mutation destroys a BsmFI restriction site in
exon 10, whereas the G1607T mutation creates a BsrI
restriction site in exon 9. Using the appropriate restriction enzyme,
exons 9 and 10 were screened in 48 control subjects for the G1934C and
G1607T mutations, respectively. Neither of the mutations was observed
in any of the control chromosomes studied (data not shown). As the
other point mutations, S420C and G458E, did not alter restriction
enzyme sites, exons 7 and 8 were screened using RNA MisMatch
methodology. No RNase cleavage sites corresponding to either mutation
were observed in the 46 control subjects studied (data not shown).
|
|
|
|
|
) consisted of a single base insertion
mutation, ins 2022T (Fig. 3A and Table 2A), that resulted in missense mutations
from codon 674 to 20 amino acids beyond the end of the wild-type coding
sequence; a single base deletion mutation, del 163 C (Fig. 3C and Table 2C), that causes missense mutations in codons 55–103 and then
termination of protein expression; a 23-base deletion mutation, del
782A-804A (Fig. 3D and Table 2D), that causes missense mutations in
codons 262–276 and then termination of protein expression; and a
complex mutation consisting of a 36-base deletion, del C431–3 to T463,
and a duplication of T468-A474 inserted after nucleotide 474 (Fig. 3B
and Table 2B) that should cause the deletion of exon 2 during RNA
splicing and result in the deletion of amino acids 145–204 from the
expressed protein. The patients were heterozygous for 3 of the 4
mutations (Fig. 3, A, C, and D) and were either homozygous or
hemizygous for the final mutation (Fig. 3B). In Table 2, A, C, and D,
the overlapping sequences for these mutations are given. In addition,
the sequence showing the deletion and duplication insertion is given in
Table 2B.
|
Seven of the patients studied, including one sibling pair, appeared to be homozygous for observed mutations; however, only the parents of the siblings were available for study to confirm the homozygosity of their children. The presence of a deletion mutation on one chromosome at the same locus as a heterozygous mutation on the other chromosome will make the heterozygous mutation appear homozygous. Further studies will be required to define the mutation status of these patients. As we were unable to clarify whether these other five patients were homozygous or hemizygous due to the methodology used in this study, the population distribution of mutations was given as a range to reflect the uncertainty.
Previously reported mutations
The most prevalent mutation was found in 10 to 12 of 66
chromosomes examined, with 2 patients being either hemizygous or
homozygous for this mutation. It is a missense mutation in which a
cytidine is substituted for a thymidine at position 1400 of the
messenger RNA, resulting in the substitution of threonine for
methionine at position 467 of the expressed protein (Fig. 4). The next
most prevalent mutation was found in 3 or 4 of 66 chromosomes examined.
It was present in only 3 patients, including a pair of siblings. The
siblings were shown to be homozygous for the mutation based on their
parents being heterozygous for the mutation. The homozygous status of
the other patient was uncertain. The mutation is a nonsense mutation in
which a thymidine is substituted for a cytidine at position 808. One
patient, who we have previously described (20), was homozygous or
hemizygous for a deletion mutation encompassing exons 2 and 3. The 3
other previously reported mutations in our patient population were all
present on only 1 chromosome (Table 1). These mutations were a
5'-splice mutation, 1500+1 G to T (19), and 2 missense mutations, R452W
(14) and Y151N (21).
Mutation segregation with cystinuric subtype
In 9 of the unrelated patients studied, a 24-h urine collection
was obtained from both parents; for 3 patients, this was obtained from
1 parent (Table 3). The chromosomes
inherited from the corresponding parent were classified as type I if
measured urinary cystine was less than 28 mmol cystine/mol creatinine
(7, 8) or as nontype I if measured urinary cystine was 28 mmol
cystine/mol creatinine or more (7, 8). Of the 21 chromosomes thus
subtyped, 13 were classified as type I (Table 3). Of these 13
chromosomes, 8 contained mutations in the SLC3A1 gene.
|
|
Discussion |
|---|
|
TopAbstractIntroductionExperimental SubjectsMaterials and MethodsResultsDiscussionReferences |
|---|
Most of the mutations reported in the SLC3A1 gene occur in only 1 patient and often on only 1 chromosome (14, 15, 16, 17, 18, 19, 20, 21, 22). There are, however, 4 mutations that have previously been reported to occur in more than 1 unrelated patient, and in this paper we describe 3 more. The most prevalent mutation is M467T, which was first reported in a group of Italian and Spanish patients (15). These researchers found 6 of 36 (17%) cystinuric chromosomes with this mutation. The work of this group was extended in a later study (18) to include a larger patient population. They reported that the M467T mutation was present in 24% of the 50 cystinuric chromosomes examined. Horsford et al. (19) also described this mutation in a type I/III cystinuric patient and traced its origin to the proband’s Ukrainian/French mother. In our studies we found that this is also the most frequent mutation occurring in up to 12 of 66 (18%) chromosomes from unrelated patients with cystinuria, with 2 of the patients possibly being homozygous for the mutation.
The next most prevalent mutation reported to date is C808T, which appeared in 5 of 17 families (16). The defect was found in 4 Ashkenazi Jewish families and a Druze family. In all of the families, the cystinurics were homozygous for the mutation (16). We also found this mutation in 3 of the patients we studied. Two of the patients are siblings, and sequencing of parental DNA confirmed that both parents were heterozygous for the mutation. In addition, all 3 patients with the C808T mutation shared the same haplotype for 4 polymorphisms: A/A 114, T/T 231, del T/del T 1136+3, and C/C 1332+7. This consistency of polymorphisms in unrelated patients indicates that this mutation was likely to have spread from the same ancestral chromosome.
Two other mutations occurring in more than 1 unrelated cystinuric patient have been reported by Horsford et al. (19); each is reported in 2 unrelated cystinurics. The first mutation was a 5'-splice site mutation in the intron following base 1500 (1500+1, G to T), and the other mutation was a deletion of a GA dinucleotide following base 974. Both of these mutations occurred in 2 of 25 chromosomes examined (19). In our study we observed 1 chromosome with the splice site mutation and none with the GA dinucleotide deletion. The patient who was heterozygous for the splice site mutation had a M467T mutation on their other chromosome, and it was shown that these mutations were derived from the proband’s grandfathers (data not shown).
Three of the 8 new mutations we report in this paper occur in at least 2 unrelated patients. The 163 del C mutation was found in 4 patients studied. Two of these patients were siblings. All 4 of the patients were heterozygous for the mutation and had no other identified mutation. All of the patients shared the same haplotype for 2 polymorphisms, C/C 114 and T/T 1136+3, whereas 3 patients had a T/T haplotype at nucleotide 231; the other patient’s haplotype was A/A. The S420C missense mutation and the 2022 ins T mutation were both found in 2 sets of unrelated patients. Both sets of patients were heterozygous for the mutations. One of the patients with the 2022 ins T mutation also had the Y151N missense mutation, whereas both of the patients with the S420C missense mutation also had the M467T missense mutation. Of interest was the fact that 1 of these patients appeared to be homozygous for the M467T mutation. Even if this patient was hemizygous for the M467T mutation, it would still indicate that this patient had 3 mutations in the SLC3A1 gene. The presence of 3 mutations on 2 chromosomes introduces the possibility that the S420C mutation was a polymorphism even though it was not found in 92 control chromosomes; it will require further study to clarify this point.
In our patient population, only 34 of the 66 cystinuric chromosomes studied had mutations in the SLC3A1 gene. In previous studies, mutations in the SLC3A1 gene were reported to be present only in type I chromosomes (18, 19, 21). Furthermore, type II and possibly type III cystinuria have been shown by linkage analysis to be caused by an as yet unidentified gene on chromosome 19 (28, 29). Thus, as we were not able to segregate all of our cystinuric patients by subtype, it is likely that some of the patients with no mutation(s) in the SLC3A1 gene were type I/II, II/II, I/III, or III/III cystinurics.
However, in previous studies, 40–60% of the chromosomes classified as type I had no mutation in the SLC3A1 gene (18, 19, 21). In our studies, we also found that 5 of 13 identified type I chromosomes did not have mutations in the SLC3A1 gene. The lack of identified mutations in the SLC3A1 gene in type I cystinuria could be due to mutations present in regions of the gene that were not screened, such as the 3'-noncoding region, or to the fact that the chromosomes were incorrectly classified as type I due to the overlap of urinary cystine excretion of type I and type III heterozygotes (7, 8). Also to be considered is the possibility that in some cases, the type I phenotype could be caused by mutations in a gene other than SLC3A1.
Of the 37 mutations in the SLC3A1 gene reported to date, only 7 have been shown to occur in at least 2 unrelated patients. In addition, these 7 mutations account for less than half of the total mutations found. This illustrates the genetic diversity of mutations that cause this disease. It also indicates that screening for specific defects within the SLC3A1 gene is likely to be unsuccessful and that prescreening for all possible mutations using the methodology outlined in this study followed by sequencing is a strategy that is more likely to succeed in identifying mutations in the gene.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received June 11, 1998.
Revised April 14, 1998.
Revised July 21, 1998.
Accepted July 28, 1998.
|
References |
|---|
|
TopAbstractIntroductionExperimental SubjectsMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  M Font-Llitjos, M Jimenez-Vidal, L Bisceglia, M Di Perna, L de Sanctis, F Rousaud, L Zelante, M Palacin, and V Nunes New insights into cystinuria: 40 new mutations, genotype-phenotype correlation, and digenic inheritance causing partial phenotype J. Med. Genet., January 1, 2005; 42(1): 58 - 68. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Quinones, R. Collazo, and O. W. Moe The dopamine precursor L-dihydroxyphenylalanine is transported by the amino acid transporters rBAT and LAT2 in renal cortex Am J Physiol Renal Physiol, July 1, 2004; 287(1): F74 - F80. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. A. Wagner, F. Lang, and S. Broer Function and structure of heterodimeric amino acid transporters Am J Physiol Cell Physiol, October 1, 2001; 281(4): C1077 - C1093. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
