help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gitomer, W. L.
Right arrow Articles by Pak, C. Y. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gitomer, W. L.
Right arrow Articles by Pak, C. Y. C.
Right arrowPubmed/NCBI databases
*OMIM
*Compound via MeSH
*Substance via MeSH
*Genetics Home Reference
The Journal of Clinical Endocrinology & Metabolism Vol. 83, No. 10 3688-3694
Copyright © 1998 by The Endocrine Society


Original Studies

Mutations in the Genomic Deoxyribonucleic Acid for SLC3A1 in Patients with Cystinuria1

William L. Gitomer, Berenice Y. Reed, Lisa A. Ruml, Khashayar Sakhaee and Charles Y. C. Pak

Center for Mineral Metabolism and Clinical Research, University of Texas Southwestern Medical Center, Dallas, Texas 75235-8885

Address all correspondence and requests for reprints to: Dr. William L. Gitomer, Center for Mineral Metabolism and Clinical Research, 8885 University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, Texas 75235-8885. E-mail: william.gitomer{at}email.swmed.edu


    Abstract
 Top
 Abstract
 Introduction
 Experimental Subjects
 Materials and Methods
 Results
 Discussion
 References
 
Cystinuria is an inherited transport disorder characterized by defective renal resorption of cystine and other dibasic amino acids. We have studied the occurrence of mutations in the SLC3A1 gene, which codes for a dibasic amino acid transporter-like protein, in 33 unrelated cystinurics. We found mutations in 34 of the 66 chromosomes studied. There were 14 different mutations in our study population, 8 of which had not been previously described. Of these new mutations, 4 were missense mutations: G1934C, C1259G, T1607G, and G1373A. The other 4 mutations consisted of a single base insertion mutation (2022 ins T), a single base deletion mutation (163 del C), a 23-base deletion mutation (del 782A-804A), and a complex mutation that consisted of a 36-base deletion (del C431–3 to T463) and a duplication insertion of 468 T to 474 A after nucleotide 474.


    Introduction
 Top
 Abstract
 Introduction
 Experimental Subjects
 Materials and Methods
 Results
 Discussion
 References
 
CYSTINURIA is one of four genetic diseases described by Garrod in 1908 as examples of inborn errors of metabolism (1). It is characterized by an increased urinary excretion of cystine, arginine, lysine, and ornithine (2, 3). The increased excretion of cystine is due to a defect in the renal reabsorption mechanism(s) for the dibasic amino acids (4). The low urinary solubility of cystine results in the formation of cystine stones (5). Functionally, a patient who excretes more than 120 mmol cystine/mol creatinine in a 24-h urine collection is defined as having cystinuria (6). Cystinuria has been classified into subgroups based upon physiological observations of affected individuals and obligate carriers of the disease (7, 8). Type I cystinuria is inherited in an autosomal recessive manner, with heterozygous carriers having normal urinary dibasic amino acid profiles (6). Types II and III cystinuria are inherited in an incompletely recessive manner (7, 8), with heterozygotes having elevated, although usually not pathological, urinary excretion of dibasic amino acids. The observed dibasic amino aciduria is generally more pronounced in type II heterozygotes (7, 8); however, urinary dibasic amino acid excretion in heterozygotes cannot be used on its own to differentiate cystinuric subtypes, because the range of urinary dibasic amino acid excretion of type III heterozygotes overlaps with the high end of type I heterozygotes and the low end of type II heterozygotes (7, 8). Intestinal handling of dibasic amino acids further differentiates the three subtypes of cystinuria. An oral cystine load in patients with type III cystinuria will cause a temporal increase in the plasma cystine concentration, but not in patients with type I or II presentations (7, 8).

Complementary DNA isolated from rat kidney or intestine, when expressed in Xenopus oocytes, has been shown to induce sodium-independent transport of cystine (9). The human complementary DNA coding for this transport inducer, referred to as rBAT, D2H, and SLC3A1, has been isolated and sequenced (10, 11). Studies of genomic DNA have shown the gene to consist of 10 exons, ranging in size from 120–438 bp (12, 13, 14). To date, 29 different mutations (14, 15, 16, 17, 18, 19, 20, 21, 22) have been reported in the SLC3A1 gene in cystinuric patients. In this study we describe 8 previously unreported mutations in the same gene and report the frequency of occurrence of all 37 mutations in our cystinuric patient population.


    Experimental Subjects
 Top
 Abstract
 Introduction
 Experimental Subjects
 Materials and Methods
 Results
 Discussion
 References
 
Patients were recruited from the University of Texas Southwestern Stone Clinic and from outside patient referral. There were 16 males and 21 females in the group of patients studied. Among these patients were 4 pairs of siblings. Patients ranged in age from 3–75 yr at the time of disease diagnosis. One of the patients studied was Hispanic, 1 was Egyptian, and the rest were Caucasians. All patients but 1 had multiple cystine stones. The patient without cystine stones excreted an average of 137 ± 18 mmol cystine/mol creatinine (mean ± SD of 4 24-h urine collections). Heparinized blood and 24-h urine collections were obtained from the patients after informed consent was obtained. Subgrouping of the cystinuric chromosomes studied according to cystinuric subtype was performed based on the measurement of urinary cystine in samples from obligate heterozygotes when available.


    Materials and Methods
 Top
 Abstract
 Introduction
 Experimental Subjects
 Materials and Methods
 Results
 Discussion
 References
 
Urinary cystine was determined using a high performance liquid chromatography method based on the gradient elution of cystine from an anion exchange column using acetate and borate buffers and postcolumn derivatization with o-phthaldialdehyde and fluorometric detection (23). The cystine peak eluted with a retention time of 12.8 min and was well resolved from the surrounding peaks. The entire run-time for the method, including regeneration of the column was 30 min. The method was sensitive down to 10 µmol cystine/L, and the response was linear up to 100 µmol cystine/L (our manuscript in preparation).

DNA was extracted from ethylenediamine tetraacetate-treated whole blood or Epstein-Barr virus-transformed B lymphocytes (24) using Qiagen Blood and Cell Culture DNA kits (Chatsworth, CA). The promoter, exons, and intron-exon boundaries were first screened for mutations using a MisMatch Detect II kit (Ambion, Inc., Austin, TX) that was adapted from previously described ribonuclease (RNase) cleavage assays (25, 26). Genomic DNA was amplified using specific primer pairs with a T7 ribonucleic acid (RNA) polymerase promoter sequence (TAATACGACTCACTATAGGG) added to the 5'-end of the sense primer, and a SP6 RNA polymerase promoter sequence (ATTTAGGTGACACTATAGGA) added to the 5'-end of the antisense primer. Incubation of the resultant PCR product with either T7 or SP6 RNA polymerase resulted in synthesis of RNA complementary to either the sense or the antisense strand of DNA. RNA/RNA duplexes were made by hybridizing complementary wild-type and experimental transcripts, which were subjected to RNase digestion. Cleavage of the RNA duplex occurred at unpaired bases. Cleavage products were separated on native 2% agarose gels and detected under UV light in the presence of ethidium bromide. The primer pairs used were modifications of those described previously. Primers for the promoter region and exon 1 (12), primers for exons 2, 3, and 6–10 (21), and primers for exons 4 and 5 (14) were described previously.

Reagents for PCR reactions were obtained from Perkin-Elmer (Norwalk, CT), and PCR conditions were as previously described (12, 14, 21) with the following changes. Taq Gold polymerase (Perkin-Elmer) was used instead of Taq polymerase, and 1.5 mmol/L MgCl2 was used for all exons except 4 and 5, where 2.0 mmol/L MgCl2 was used. The thermal cycling conditions were an initial 12-min incubation at 95 C to activate the Taq Gold polymerase, then 35 cycles at 95 C for 1 min, at the annealing temperature for 2 min, and then at 72 C for 2 min. This was followed by a final 10-min incubation at 72 C. The annealing temperature was 57 C for all of the exons, except 1, 4, and 5. The promoter and exon 1 were amplified using an annealing temperature of 55 C, and exons 4 and 5 were amplified using an annealing temperature of 52 C.

PCR reaction products in which the RNA mismatch screening indicated that mutations were present were sequenced using an ABI Prism Automated DNA Sequencer (model 377, PE Applied Biosystems, Foster City, CA) using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer). The PCR reaction products were sequenced in both directions using the primers described above.

The restriction enzymes BsrI and BsmFI were obtained from New England Biolabs, Inc. (Beverly, MA). Restriction enzyme digests were performed using the conditions described by the manufacturer, with 5 µL PCR reaction product in a final volume of 10 µL. Two units of BsmFI (restriction site destroyed by G1934C mutation, exon 10) and 5 U BsrI (restriction site created by T1607G mutation, exon 9) were used per reaction.


    Results
 Top
 Abstract
 Introduction
 Experimental Subjects
 Materials and Methods
 Results
 Discussion
 References
 
We screened genomic DNA from 33 unrelated cystinurics (66 chromosomes) for mutations in the entire coding region of the SLC3A1 gene, all of the intron-exon boundaries of the gene, and 133 bases of the promoter region.

Mutation identification and sequencing

We used a RNA MisMatch Detect II kit to screen for mutations in PCR products derived from genomic DNA of our patients. Figure 1Go shows a 2% agarose gel illustrating the cleavage products that result when there is a mismatch between two strands of complementary RNA (the range of bases bracketed by the primers was -133 to 430+16, which corresponded to all of exon 1 and 133 nucleotides of the promoter region). Two different sets of cleavage products can be seen. One set of cleavage products occurs in lanes 1, 2, 9, and 10, and the other set occurs in lanes 3, 8, 11, and 12. Lane 6 contains the wild-type control. Subsequent sequencing of the PCR reaction products revealed that both sets of cleavage products were due to previously reported polymorphisms in exon 1. The first set of cleavage products was due to a C/A polymorphism at nucleotide 114 (15), and the second set was due to an A/T polymorphism at nucleotide 231 (18). Using the MisMatch methodology to first identify the presence of mutations followed by sequencing of the PCR products to characterize the mutations enabled us to identify 14 different mutations (Table 1Go) and 5 polymorphisms in our patient population. Eight of the mutations have not previously been reported. The polymorphisms present were A/C 114 (15), T/A 231 (18), 1136+3 del T (18), T/C 1332+7 (21), and A/G 1854 (18). Electropherograms demonstrating the new mutations are shown in Figs. 2Go and 3Go. Four of the new mutations were missense mutations (Fig. 2Go) that caused changes in amino acids that were conserved at these positions in the rat, rabbit, and human proteins. The missense mutations were a G to C change at nucleotide 1934 (Fig. 2AGo) that would be expected to cause a substitution of alanine for glycine 645 in the third intracellular domain of the expressed protein (Fig. 4Go), a C to G change at nucleotide 1259 (Fig. 2BGo) that would be expected to cause a substitution of cysteine for serine 420 in the second intracellular domain of the protein (Fig. 4Go), a G to T change at nucleotide 1607 (Fig. 2CGo) that would be expected to cause a substitution of glycine for valine 536 in the second extracellular domain of the protein (Fig. 4Go), and a G to A change at nucleotide 1373 (Fig. 2DGo) that would be expected to cause a substitution of glutamate for glycine 458 in the second intracellular domain of the protein (Fig. 4Go). The G1934C mutation destroys a BsmFI restriction site in exon 10, whereas the G1607T mutation creates a BsrI restriction site in exon 9. Using the appropriate restriction enzyme, exons 9 and 10 were screened in 48 control subjects for the G1934C and G1607T mutations, respectively. Neither of the mutations was observed in any of the control chromosomes studied (data not shown). As the other point mutations, S420C and G458E, did not alter restriction enzyme sites, exons 7 and 8 were screened using RNA MisMatch methodology. No RNase cleavage sites corresponding to either mutation were observed in the 46 control subjects studied (data not shown).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 1. A 2% agarose gel illustrating the cleavage products that result when there is a mismatch between 2 strands of complementary RNA (the range of bases bracketed by the primers was -133 to 430+16, which corresponded to all of exon 1 and 133 nucleotides of the promoter region). Two different sets of cleavage products can be seen. One set of cleavage products occurs in lanes 1, 2, 9, and 10, indicated by the 2 arrows on the left, and the other set occurs in lanes 3, 8, 11, and 12, indicated by the lower 2 arrows on the right. Lane 6 contains the wild-type control. The upper arrow on the right indicates the uncut heteroduplex.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Distribution of mutations in the SLC3A1 gene in unrelated cystinurics

 


View larger version (31K):
[in this window]
[in a new window]
 
Figure 2. Electropherograms of four novel missense mutations in the SLC3A1 gene. The upper row shows the wild-type sequence, and the bottom row shows the mutant sequence. Arrows indicate the locations of the mutant bases. All of the mutant sequences shown were heterozygous for the indicated mutations. The peaks are color coded: T, red; A, green; C, blue; and G, black.

 


View larger version (31K):
[in this window]
[in a new window]
 
Figure 3. Electropherograms of 4 novel insertion and/or deletion mutations in the SLC3A1 gene. The arrow in A indicates the site of the insertion of T. It should be noted that the sequence displayed in A is that of the antisense strand. The arrow in C indicates the site of the deletion of C. The arrows in D indicate the start and stop sites for the 23-nucleotide deletion present in this sample. The peaks are color coded: T, red; A, green; C, blue; and G, black.

 


View larger version (41K):
[in this window]
[in a new window]
 
Figure 4. The proposed structure of the SLC3A1 gene product based on theoretical hydrophobicity plots (21 ) and experimental analysis of the intracellular and extracellular domains of the rat protein using limited proteolysis and site-specific antibodies (14 ). The 14 different mutations that were found in our patient population are indicated. Numbers adjacent to the plasma membrane indicate the amino acid positions that bracket the transmembrane domains. This figure was adapted from the reports by Mosckovitz et al. (27 ), Gasparini et al. (16 ), and Gitomer and Pak (3 ).

 
The 4 other mutations (Fig. 3Go) consisted of a single base insertion mutation, ins 2022T (Fig. 3AGo and Table 2AGo), that resulted in missense mutations from codon 674 to 20 amino acids beyond the end of the wild-type coding sequence; a single base deletion mutation, del 163 C (Fig. 3CGo and Table 2CGo), that causes missense mutations in codons 55–103 and then termination of protein expression; a 23-base deletion mutation, del 782A-804A (Fig. 3DGo and Table 2DGo), that causes missense mutations in codons 262–276 and then termination of protein expression; and a complex mutation consisting of a 36-base deletion, del C431–3 to T463, and a duplication of T468-A474 inserted after nucleotide 474 (Fig. 3BGo and Table 2BGo) that should cause the deletion of exon 2 during RNA splicing and result in the deletion of amino acids 145–204 from the expressed protein. The patients were heterozygous for 3 of the 4 mutations (Fig. 3Go, A, C, and D) and were either homozygous or hemizygous for the final mutation (Fig. 3BGo). In Table 2Go, A, C, and D, the overlapping sequences for these mutations are given. In addition, the sequence showing the deletion and duplication insertion is given in Table 2BGo.


View this table:
[in this window]
[in a new window]
 
Table 2. Wild-type and mutation sequences of electropherograms in Fig. 3Go

 
Homozygosity vs. hemizygosity

Seven of the patients studied, including one sibling pair, appeared to be homozygous for observed mutations; however, only the parents of the siblings were available for study to confirm the homozygosity of their children. The presence of a deletion mutation on one chromosome at the same locus as a heterozygous mutation on the other chromosome will make the heterozygous mutation appear homozygous. Further studies will be required to define the mutation status of these patients. As we were unable to clarify whether these other five patients were homozygous or hemizygous due to the methodology used in this study, the population distribution of mutations was given as a range to reflect the uncertainty.

Previously reported mutations

The most prevalent mutation was found in 10 to 12 of 66 chromosomes examined, with 2 patients being either hemizygous or homozygous for this mutation. It is a missense mutation in which a cytidine is substituted for a thymidine at position 1400 of the messenger RNA, resulting in the substitution of threonine for methionine at position 467 of the expressed protein (Fig. 4Go). The next most prevalent mutation was found in 3 or 4 of 66 chromosomes examined. It was present in only 3 patients, including a pair of siblings. The siblings were shown to be homozygous for the mutation based on their parents being heterozygous for the mutation. The homozygous status of the other patient was uncertain. The mutation is a nonsense mutation in which a thymidine is substituted for a cytidine at position 808. One patient, who we have previously described (20), was homozygous or hemizygous for a deletion mutation encompassing exons 2 and 3. The 3 other previously reported mutations in our patient population were all present on only 1 chromosome (Table 1Go). These mutations were a 5'-splice mutation, 1500+1 G to T (19), and 2 missense mutations, R452W (14) and Y151N (21).

Mutation segregation with cystinuric subtype

In 9 of the unrelated patients studied, a 24-h urine collection was obtained from both parents; for 3 patients, this was obtained from 1 parent (Table 3Go). The chromosomes inherited from the corresponding parent were classified as type I if measured urinary cystine was less than 28 mmol cystine/mol creatinine (7, 8) or as nontype I if measured urinary cystine was 28 mmol cystine/mol creatinine or more (7, 8). Of the 21 chromosomes thus subtyped, 13 were classified as type I (Table 3Go). Of these 13 chromosomes, 8 contained mutations in the SLC3A1 gene.


View this table:
[in this window]
[in a new window]
 
Table 3. Classification of cystinuric subtype based on parental urinary cystine excretion

 

    Discussion
 Top
 Abstract
 Introduction
 Experimental Subjects
 Materials and Methods
 Results
 Discussion
 References
 
Twenty-nine different mutations in the SLC3A1 gene have been reported in patients with cystinuria (14, 15, 16, 17, 18, 19, 20, 21, 22). In this paper we describe 8 new mutations, the frequency of occurrence of all 37 mutations in the SLC3A1 gene in our patient population, and the segregation of mutations by cystinuric subtype.

Most of the mutations reported in the SLC3A1 gene occur in only 1 patient and often on only 1 chromosome (14, 15, 16, 17, 18, 19, 20, 21, 22). There are, however, 4 mutations that have previously been reported to occur in more than 1 unrelated patient, and in this paper we describe 3 more. The most prevalent mutation is M467T, which was first reported in a group of Italian and Spanish patients (15). These researchers found 6 of 36 (17%) cystinuric chromosomes with this mutation. The work of this group was extended in a later study (18) to include a larger patient population. They reported that the M467T mutation was present in 24% of the 50 cystinuric chromosomes examined. Horsford et al. (19) also described this mutation in a type I/III cystinuric patient and traced its origin to the proband’s Ukrainian/French mother. In our studies we found that this is also the most frequent mutation occurring in up to 12 of 66 (18%) chromosomes from unrelated patients with cystinuria, with 2 of the patients possibly being homozygous for the mutation.

The next most prevalent mutation reported to date is C808T, which appeared in 5 of 17 families (16). The defect was found in 4 Ashkenazi Jewish families and a Druze family. In all of the families, the cystinurics were homozygous for the mutation (16). We also found this mutation in 3 of the patients we studied. Two of the patients are siblings, and sequencing of parental DNA confirmed that both parents were heterozygous for the mutation. In addition, all 3 patients with the C808T mutation shared the same haplotype for 4 polymorphisms: A/A 114, T/T 231, del T/del T 1136+3, and C/C 1332+7. This consistency of polymorphisms in unrelated patients indicates that this mutation was likely to have spread from the same ancestral chromosome.

Two other mutations occurring in more than 1 unrelated cystinuric patient have been reported by Horsford et al. (19); each is reported in 2 unrelated cystinurics. The first mutation was a 5'-splice site mutation in the intron following base 1500 (1500+1, G to T), and the other mutation was a deletion of a GA dinucleotide following base 974. Both of these mutations occurred in 2 of 25 chromosomes examined (19). In our study we observed 1 chromosome with the splice site mutation and none with the GA dinucleotide deletion. The patient who was heterozygous for the splice site mutation had a M467T mutation on their other chromosome, and it was shown that these mutations were derived from the proband’s grandfathers (data not shown).

Three of the 8 new mutations we report in this paper occur in at least 2 unrelated patients. The 163 del C mutation was found in 4 patients studied. Two of these patients were siblings. All 4 of the patients were heterozygous for the mutation and had no other identified mutation. All of the patients shared the same haplotype for 2 polymorphisms, C/C 114 and T/T 1136+3, whereas 3 patients had a T/T haplotype at nucleotide 231; the other patient’s haplotype was A/A. The S420C missense mutation and the 2022 ins T mutation were both found in 2 sets of unrelated patients. Both sets of patients were heterozygous for the mutations. One of the patients with the 2022 ins T mutation also had the Y151N missense mutation, whereas both of the patients with the S420C missense mutation also had the M467T missense mutation. Of interest was the fact that 1 of these patients appeared to be homozygous for the M467T mutation. Even if this patient was hemizygous for the M467T mutation, it would still indicate that this patient had 3 mutations in the SLC3A1 gene. The presence of 3 mutations on 2 chromosomes introduces the possibility that the S420C mutation was a polymorphism even though it was not found in 92 control chromosomes; it will require further study to clarify this point.

In our patient population, only 34 of the 66 cystinuric chromosomes studied had mutations in the SLC3A1 gene. In previous studies, mutations in the SLC3A1 gene were reported to be present only in type I chromosomes (18, 19, 21). Furthermore, type II and possibly type III cystinuria have been shown by linkage analysis to be caused by an as yet unidentified gene on chromosome 19 (28, 29). Thus, as we were not able to segregate all of our cystinuric patients by subtype, it is likely that some of the patients with no mutation(s) in the SLC3A1 gene were type I/II, II/II, I/III, or III/III cystinurics.

However, in previous studies, 40–60% of the chromosomes classified as type I had no mutation in the SLC3A1 gene (18, 19, 21). In our studies, we also found that 5 of 13 identified type I chromosomes did not have mutations in the SLC3A1 gene. The lack of identified mutations in the SLC3A1 gene in type I cystinuria could be due to mutations present in regions of the gene that were not screened, such as the 3'-noncoding region, or to the fact that the chromosomes were incorrectly classified as type I due to the overlap of urinary cystine excretion of type I and type III heterozygotes (7, 8). Also to be considered is the possibility that in some cases, the type I phenotype could be caused by mutations in a gene other than SLC3A1.

Of the 37 mutations in the SLC3A1 gene reported to date, only 7 have been shown to occur in at least 2 unrelated patients. In addition, these 7 mutations account for less than half of the total mutations found. This illustrates the genetic diversity of mutations that cause this disease. It also indicates that screening for specific defects within the SLC3A1 gene is likely to be unsuccessful and that prescreening for all possible mutations using the methodology outlined in this study followed by sequencing is a strategy that is more likely to succeed in identifying mutations in the gene.


    Acknowledgments
 
We thank Martha Lemke, Jared L. Richardson, and Nancy E. Tyler for expert technical assistance.


    Footnotes
 
1 This work was supported by USPHS Grants PO1-DK-20543 and MO1-RR-00633 and the Robert T. Hayes Center for Mineral Metabolism Research. Back

Received June 11, 1998.

Revised April 14, 1998.

Revised July 21, 1998.

Accepted July 28, 1998.


    References
 Top
 Abstract
 Introduction
 Experimental Subjects
 Materials and Methods
 Results
 Discussion
 References
 

  1. Garrod AE. 1908 The Croonian Lectures on inborn errors of metabolism. Lecture III. Lancet. 2:142–148.
  2. Segal S, Thier SO. 1995 Cystinuria. In: Scriver CR, Beaudet AL, Sly WS Valle D, eds. The metabolic and molecular bases of inherited disease, 7th Ed. New York: McGraw-Hill; 3581–3601.
  3. Gitomer WL, Pak CYC. 1996 Recent advances in the biochemical and molecular biological basis of cystinuria. J Urol. 156:1907–1912.[CrossRef][Medline]
  4. Dent CE, Senior B, Walshe JM. 1954 The pathogenesis of cystinuria. II. Polarographic studies of the metabolism of sulphur-containing amino-acids. J Clin Invest. 33:1216–1226.
  5. Wollaston WH. 1810 On cystic oxide: a new species of urinary calculus. Philos Trans R Soc Lond. 100:223–230.[Free Full Text]
  6. Harris H, Mittwoch U, Robson EB, Warren FL. 1955 Pattern of amino acid excretion in cystinuria. Ann Hum Genet. 19:196–208.[Medline]
  7. Rosenberg LE, Downing SE, Durant JL, Segal S. 1966 Cystinuria: biochemical evidence for three genetically distinct diseases. J Clin Invest. 45:365–371.
  8. Rosenberg LE, Durant JL, Albrecht I. 1966 Genetic Heterogeneity in cystinuria: evidence for allelism. Trans Assoc Am Physicians. 79:284–296.[Medline]
  9. Wells RG, Hediger MA. 1992 Cloning of a rat kidney cDNA that stimulates dibasic and neutral amino acid transport and has sequence similarity to glucosidases. Proc Natl Acad Sci USA. 89:5596–5600.[Abstract/Free Full Text]
  10. Bertran J, Werner A, Chillar-n J, et al. 1993 Expression cloning of a human renal cDNA that induces high affinity transport of L-cystine shared with dibasic amino acids in Xenopus oocytes. J Biol Chem. 268:14842–14849.[Abstract/Free Full Text]
  11. Lee W-S, Wells RG, Sabbag RV, Mohandas TK, Hediger MA. 1993 Cloning and chromosomal localization of a human kidney cDNA involved in cystine, dibasic, and neutral amino acid transport. J Clin Invest. 91:1959–1963.
  12. Pras E, Sood R, Raben N, Aksentijevich I, Chen X, Kastner DL. 1996 Genomic organization of SLC3A1, a transporter gene mutated in cystinuria. Genomics. 36:163–167.[CrossRef][Medline]
  13. Purroy J, Bisceglia L, Calonge MJ, et al. 1996 Genomic structure and organization of the human rBAT gene (SLC3A1) Genomics. 37:249–252.[CrossRef][Medline]
  14. Endsley JK, Phillips III JA, Hruska KA, Denneberg T, Carlson J, George Jr AL. 1997 Genomic organization of a human cystine transporter gene (SLC3A1) and identification of novel mutations causing cystinuria. Kidney Int. 51:1893–1899.[Medline]
  15. Calonge MJ, Gasparini P, Chillaron J, et al. 1994 Cystinuria caused by mutations in rBAT, a gene involved in the transport of cystine. Nat Genet. 6:420–425.[CrossRef][Medline]
  16. Pras E, Raben N, Golomb E, et al. 1995 Mutations in the SLC3A1 transporter gene in cystinuria. Am J Hum Genet. 56:1297–1303.[Medline]
  17. Miyamoto K, Katai K, Tatsumi S, et al. 1995 Mutations of the basic amino acid transporter gene associated with cystinuria. Biochem J. 310:951–955.
  18. Gasparini P, Calonge MJ, Bisceglia L, et al. 1995 Molecular genetics of cystinuria: identification of four new mutations and seven polymorphisms, and evidence for genetic heterogeneity. Am J Hum Genet. 57:781–788.[Medline]
  19. Horsford J, Saadi I, Raelson J, Goodyer PR, Rozen R. 1996 Molecular genetics of cystinuria in French Canadians: identification of four novel mutations in type I patients. Kidney Int. 49:1401–1406.[Medline]
  20. Gitomer WL, Reed BY, Ruml LA, Pak CYC. A 335 base deletion in the mRNA coding for SLC3AI isolated from a patient with cystinuria. Hum Mutat. 000(Suppl 1):S69–S71.
  21. Bisceglia L, Calonge MJ, Dello Strologo L, et al. 1996 Molecular analysis of the cystinuria disease gene: identification of four new mutations, one large deletion, and one polymorphism. Hum Genet. 98:447–451.[CrossRef][Medline]
  22. Pras E, Golomb E, Drake C, Aksentijevich I, Katz G, Kastner DL. 1998 A splicing mutation (891+4 A to G) in SLC3A1 leads to exon 4 skipping and causes cystinuria in a Moslem Arab family. Hum Mutat. 000(Suppl 1):S28–S30.
  23. Ashworth RB. 1987 Ion-exchange separation of amino acids with postcolumn orthophthalaldehyde detection. J Assoc Official Anal Chemists. 70:248–252.
  24. Neitzel H. 1986 A routine method for the establishment of permanent growing lymphoblastoid cell lines. Hum Genet. 73:320–326.[CrossRef][Medline]
  25. Myers RM, Larin Z, Maniatis T. 1985 Detection of single base substitutions by ribonuclease cleavage at mismatches in RNA:DNA duplexes. Science. 230:1242–1246.[Abstract/Free Full Text]
  26. Winter E, Yamamoto F, Almoguera C, Perucho M. 1985 A method to detect and characterize point mutations in transcribed genes. Proc Natl Acad Sci USA. 82:7575–7579.[Abstract/Free Full Text]
  27. Mosckovitz R, Yan N, Heimer E, Felix A, Tate SS, Undenfriend S. 1993 Characterization of the rat neutral and basic amino acid transporter utilizing anti-peptide antibodies. Proc Natl Acad Sci USA. 90:4022–4026.[Abstract/Free Full Text]
  28. Bisceglia L, Calonge MJ, Totaro A, et al. 1997 Localization, by linkage analysis, of the cystinuria type III gene to chromosome 19q13.1. Am J Hum Genet. 60:611–616.[Medline]
  29. Wartenfeld R, Golomb E, Katz G, et al. 1997 Molecular analysis of cystinuria in Libyan Jews: exclusion of the SLC3A1 gene and mapping of a new locus on 19q. Am J Hum Genet. 60:617–624.[Medline]



This article has been cited by other articles:


Home page
J. Med. Genet.Home page
M Font-Llitjos, M Jimenez-Vidal, L Bisceglia, M Di Perna, L de Sanctis, F Rousaud, L Zelante, M Palacin, and V Nunes
New insights into cystinuria: 40 new mutations, genotype-phenotype correlation, and digenic inheritance causing partial phenotype
J. Med. Genet., January 1, 2005; 42(1): 58 - 68.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
H. Quinones, R. Collazo, and O. W. Moe
The dopamine precursor L-dihydroxyphenylalanine is transported by the amino acid transporters rBAT and LAT2 in renal cortex
Am J Physiol Renal Physiol, July 1, 2004; 287(1): F74 - F80.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
C. A. Wagner, F. Lang, and S. Broer
Function and structure of heterodimeric amino acid transporters
Am J Physiol Cell Physiol, October 1, 2001; 281(4): C1077 - C1093.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gitomer, W. L.
Right arrow Articles by Pak, C. Y. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gitomer, W. L.
Right arrow Articles by Pak, C. Y. C.
Right arrowPubmed/NCBI databases
*OMIM
*Compound via MeSH
*Substance via MeSH
*Genetics Home Reference


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals