| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Institut National de la Santé et de la Recherche Médicale (V.G., B.T., S.L., J.-C.N., C.S.), INSERM U439, Pathologie Moléculaire des Récepteurs Nucléaires, 34090 Montpellier, France; Unité BEDR (S.L., C.S.), Hôpital Lapeyronie, 34295 Montpellier, France; and Unité Endocrinologie Pédiatrique (C.S.), Hôpital A. de Villeneuve, 34295 Montpellier, France
Address all correspondence and requests for reprints to: Prof. Charles Sultan, INSERM U439, 70 rue de Navacelles, 34090 Montpellier, France. E-mail: chsultan{at}u439.montp.inserm.fr
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-dihydrotestosterone (DHT). These effects are mediated by the
androgen receptor (AR), which belongs to the steroid hormone receptor
family (1). Defects in the AR gene can cause androgen insensitivity
syndromes (AISs), with a wide spectrum of phenotypes, ranging from the
complete female phenotype in 46,XY subjects (complete AIS) to
partial androgen resistance [or partial AIS (PAIS)] (2). For many
years, the diagnosis of androgen resistance was based on family
history, karyotyping, endocrine studies, and measurement of androgen
binding in genital skin fibroblasts of patients. Sequencing of the
coding segment of the AR gene has revealed the genetic basis of
androgen resistance in a number of pedigrees. Abnormalities of the AR
gene have been identified in the eight exons and can vary from complete
or partial gene deletions to, most often, single base mutations
(3). The AR is an androgen-dependent transcription factor composed of four major domains (4): the aminoterminal transcription activation domain; the DNA-binding domain, which interacts with a specific DNA sequence; the hinge region, which includes the nuclear localization signal; and the carboxyterminal ligand-binding domain (LBD). The unliganded AR is located in the cytoplasm and is complexed with a dimer of heat shock proteins 90 and other chaperone proteins. Androgen binding induces the dissociation of AR from the complex and a conformational change that facilitates receptor dimerization, nuclear transport, and interaction with the target DNA sequences. Binding of the AR to the androgen-responsive element triggers transcriptional activity events that ultimately lead to the biological response of the androgen. A single amino acid substitution in the AR may thus partially or completely affect the mechanism of AR action. For many investigators, the activity of these mutants was evaluated by in vitro techniques, to establish the relationship between the genetic mutation identified in the AR gene and the phenotype observed in the patient. After recreation of the mutant receptor by in vitro mutagenesis techniques, the different properties of AR (such as androgen binding, DNA binding, and transactivation) were usually analyzed in mammalian cells by (respectively) transient transfection, DNA mobility shift assay, and cotransfection assay. The use of AR mutants within a three-dimensional model of the DNA-binding domain has also proved to be a valuable alternative approach for this analysis (5, 6).
With classical in vitro assays, however, the relationship between receptor function and clinical phenotype is not always established. It has been admitted that the mutant receptors that completely lack the ability to transactivate androgen-responsive reporter gene are associated with complete AIS, but the partial form of androgen resistance is less well defined. The transcriptional assay can be difficult to interpret, owing to potential artifacts caused by the transfection method itself, such as in the level of AR expressed in transfected cells. The overexpression of AR in transient transfection is thus able to hide some of the AR defects (7).
Nuclear transfer (which is a limitation step in the mechanism of AR action) was, until recently, not usually studied by in vitro techniques. We developed a model based on a fusion protein between the AR and the green fluorescent protein (GFP) to analyze the trafficking of the receptor in a single cell (8). This model has now been applied to AR mutants to evaluate the trafficking capacity of two mutants in the LBD of AR and to determine the usefulness of this method as a complementary tool in the investigation of patients with PAIS.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We studied two mutations detected in patients with PAIS: the R840C substitution described in a grade 3, according to Quigley (2), [our group (unpublished data) and Refs. 9, 10, 11 ]; and the G743V substitution detected by our group in a grade 6 (12) and by Nakao et al. in a grade 4 (13). An identical amino acid substitution may produce different phenotypes in different kindreds, which would explain the difference in phenotype for the G743V substitution. Moreover, one patient was referred in the neonatal period (12), and the other was examined in the postpubertal period (13).
The G743V mutation was recreated in the AR gene sequence cloned in pCMV-5 by site-directed oligonucleotide mutagenesis using the Altered Sites In Vitro Mutagenesis System (Promega Corp., Madison, WI) with the primer 5' CAGTATTCCTGGATGGTGCTCATGGTG 3', as previously described (14). The construction of the R840C mutant was a gift from Dr. T. R. Brown (Department of Population Dynamics, Johns Hopkins University, Baltimore, MD). The construction of the AR mutants (G743V and R840C) fused to GFP was obtained in the same manner as for GFP-AR-del4, as previously described (8). Briefly, the mutated AR complementary DNA was isolated from pCMV-5-hAR mutants by XmaI-XbaI digestion and inserted at the cognate sites of pS65T-C1-GFP plasmid (CLONTECH, Palo Alto, CA). GFP was fused at the amino terminal of digested AR. The different constructs, named (respectively) GFP-AR-G743V and GFP-AR-R840C, were verified by enzymatic digestion and sequencing of the open reading frame.
Cell culture for GFP analysis
The GFP-AR-transfected cells were first cultured at 37 C and then at 30 C for at least 30 h before protein analyses because: 1) mammalian cells expressing GFP exhibit stronger fluorescence when grown at temperatures lower than 37 C (15); and 2) when cells were maintained at 37 C, GFP-AR did not transactivate the reporter gene, although efficient transactivation by GFP-AR was seen when the incubation temperature was shifted to 30 C (8), as was also described for the fusion protein GFP-glucocorticoid receptor (16).
Immunoblot
COS-7 cells were cultured in DMEM (Gibco BRL, Cergy Pontoise, France) and 10% FCS, penicillin (100 U/mL), and streptomycin (100 µg/mL). Then, 100-mm dishes of cells (109 cells) were transfected with 10 µg plasmid by the calcium phosphate DNA precipitation method. Twenty-four hours after transfection, cells were cultured for 30 h at 30 C (8). The cells were lysed directly in the dish with 50 µL lysis buffer [160 mmol/L Tris (pH 6.9), 200 mmol/L dithiothreitol (DTT), 4% SDS, 20% glycerol, 0.004% bromophenol blue] in the presence of protease inhibitors (1 mmol/L phenylmethlysulfonylflouride, 0.05 mmol/L leupeptin, 0.01 mmol/L pepstatin). The lysate was boiled for 10 min, and cellular debris was pelleted at 13,000 x g for 10 min. An equivalent of 108 cells for each extract was subjected to SDS PAGE and Western transfer by electroblotting. Nitrocellulose filters were saturated in TBS [20 mmol/L Tris-HCl (pH 7.4), 500 mmol/L NaCl] plus 10% milk and 0.05% Tween-20 at room temperature. Filters were then incubated with the polyclonal anti-AR antibody (SpO61) (diluted 1:2000) (17) and peroxidase-conjugated antirabbit IgG (diluted 1:5000; Amersham, Les Ulis, France). Blots were developed using the ECL chemiluminescent detection system (Amersham).
Androgen-binding and dissociation assay
To determine the androgen-binding characteristics of the GFP-AR mutants (compared with the wild-type), COS-7 cells were transfected in 12-well dishes with 0.1 µg GFP-AR wild-type or mutants and 0.1 µg pCMV-ß-galactosidase. After 12 h at 37 C and then 30 h at 30 C, transfected cells were incubated in duplicate for 2 h at 37 C with various concentrations (0.05–3 nmol/L) of [3H]R1881 (total binding); and duplicate wells were incubated, together with 100 nmol/L unlabeled R1881 (nonspecific binding). After incubation, cells were placed on ice for 10 min and washed twice with cold PBS. The cells were harvested in lysis buffer: 25 mmol/L Tris-H3PO4 (pH 7.8), 2 mmol/L DTT, 2 mmol/L EDTA, 1% TritonX-100, and 10% glycerol. Aliquots were used for radioactivity measurement, ß-galactosidase activity, and protein assay. After subtraction of nonspecific binding from total binding, the dissociation constants (Kd) and the maximum androgen-binding sites (Bmax) were derived from Scatchard plots.
To determine the dissociation rate of the ligand-receptor complex in COS-7 cells containing either GFP-AR wild-type or mutants, cells (in groups of six wells each) were incubated in quadruplicate for 2 h at 37 C with 4 nmol/L tritiated ligand; and duplicate wells were incubated together with 100 nmol/L radioinert androgen. Specific androgen binding was measured in duplicate wells, and the labeling medium in two other wells was replaced by a chase medium containing 1000-fold excess of radioinert androgen. The cells were lysed after 0, 30, 60, and 90 min; and the percentage of remaining specific androgen binding was plotted semilogarithmically against time.
Transcriptional activity
COS-7 cells were then transfected in 6-well dishes with 0.15 µg GFP-AR wild-type or mutants; 2 µg p-mouse-mammary-tumor-virus-luciferase (MMTV-luc) (18), used as androgen-regulated gene; and 0.25 µg pCMV-ß-galactosidase. Twelve hours after transfection, the cells were incubated with various concentrations of R1881 (10-12–10-7 mol/L) for 30 h at 30 C. Transfected cells were lysed as described above. The luciferase activity was measured by the reaction of lysate with the luciferin solution: 270 µmol/L Coenzyme A, 470 µmol/L luciferin, 530 µmol/L ATP, 20 mmol/L Tris-H3PO4, 1.05 mmol/L MgCl2, 2.7 mmol/L MgSO4, 0.1 mmol/L EDTA, and 33 mmol/L DTT. Luciferase activity was measured on an LKB luminometer (LKB Instruments, Rockville, MD). Each incubation was performed in duplicate. The results were expressed using the induction factor, and we calculated the concentration of R1881 for which the half-maximal induction (EC50) was reached.
Microscopic analysis and kinetics
COS-7 cells were transfected on 2x2 cm2 Lab-tek Chamber Slides (Nunc Inc., Naperville, IL) with 2 µg of wild-type or mutant GFP-AR. These chamber slides have the depth of a coverslip. Twenty-four hours after transfection, the cells were cultured at 30 C for at least 30 h. The living cells were observed directly on the chamber slide using an inverted fluorescence microscope (Diaphot 200, Nikon, Champigny-sur-Marne, France) with a fluorescein isothiocyanate filter. This microscope was coupled to a CCD camera (Night Owl, EGG-Berthold, La Garenne-Colombes, France) to record cells. The cells were first observed without hormone and after DHT addition into the same chamber. Cells were maintained at 37 C during the kinetics studies, in the presence of DHT at the concentration of 10-9, 10-7, or 10-6 mol/L. The same cell was analyzed and recorded after 15, 30, 60, and 120 min. Thus, the same living cell was studied in the absence and presence of hormone. Cells were then maintained at 37 C overnight, and other cells were observed. Because of the known metabolism of DHT in COS-7 cells, we made a new addition of DHT for overnight incubation. For quantification of the nuclear/cytoplasmic ratio, the data were collected and quantitated using NIH-image software. For each set of conditions, the intensities of pixels were summed within the individual nuclei and the total cellular areas and were corrected for background fluorescence. The percentages of nuclear fluorescence were calculated and pooled for each point.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To compare the levels of different GFP-AR expression, the
immunoblot was performed on extracts from transfected cells. Immunoblot
analysis of total cellular lysates revealed the expression of a protein
of 130 kDa, for both mutant receptors, in concentrations almost
equivalent to those of GFP-AR-wt (Fig. 1
).
|
, Table 1). The Bmax values of both mutants were
similar to that of GFP-AR-wt. The same results were obtained with AR
mutants not fused to GFP (data not shown). As demonstrated for the
wild-type (8), the GFP tag on the N-terminal domain of the various AR
mutants does not alter the ligand-binding characteristics. At 37 C, the
G743V substitution resulted in an increase in the dissociation rate of
the ligand-receptor complex, compared with the wild-type receptor (Fig. 3). Half R1881-GFP-AR-G743V complexes
were dissociated after 17 min. The dissociation rate of GFP-AR-R840C
was slightly increased, in comparison with wild-type (30 min
vs. 42 min).
|
|
|
The transcriptional activation capacity of the normal and mutant
AR was measured by the ability to transactivate the androgen-responsive
gene (MMTV-luc) in cotransfection assays in COS-7 cells. As shown in
Fig. 4, the GFP-AR-wt caused a
hormone-dependent induction of transcription in COS-7 cells that was
maximal at 10-11 mol/L R1881. The hormone-response curve
of GFP-AR-G743V and GFP-AR-R840C was shifted in EC50 to
10-10 mol/L, but the same maximal luciferase activity was
obtained. Both mutants were inactive at low concentration of androgen
and acquired the ability to transactivate only at high concentration to
attain a maximal transactivation activity similar to the wild-type
receptor.
|
Kinetics studies were performed in COS-7 cells transfected by
GFP-AR mutants, in the presence of hormone, to define the capacity of
androgens to induce nuclear import of AR mutants. The transfected cells
(about 10% of the total cells) were rapidly visualized by their
fluorescence. All the ARs were localized in the cytoplasm in the
absence of hormone. The same cell was observed and recorded after 15,
30, 60, and 120 min of incubation with DHT at 37 C. The cells were
maintained at 37 C overnight, and several cells were recorded. Figure 5 shows an example of the kinetics
obtained with incubation of 10-9 mol/L DHT for GFP-AR-wt,
GFP-AR-R840C, and GFP-AR-G743V. The same kinetics studies were
performed with 10-7 and 10-6 mol/L. For each
incubation time, we quantified the percentage of nuclear fluorescence
vs. total fluorescence (Fig. 6).
|
|
). The GFP-AR-wt and both mutants
entered rapidly into the nucleus. Half the receptors were nuclear after
20 min, and the nuclear import process was complete after 60 min for
GFP-AR-wt and GFP-AR-R840C and 120 min for GFP-AR-G743V.
The GFP-AR-wt entered into the nucleus with a similar rate, in the
presence of DHT 10-7 mol/L, but the maximal nuclear
transfer was slightly reduced (Fig. 6B). Concerning the mutants, 50%
of GFP-AR-G743V and GFP-AR-R840C were nuclear after 54 min and 46 min,
respectively. The nuclear transfer was saturated after 70% of nuclear
GFP-AR-R840C and 52% of imported GFP-AR-G743V.
In the presence of a physiological concentration of DHT
(10-9 mol/L) (Fig. 6C), the GFP-AR-wt transfer was
stabilized after 120 min with 84% of transferred receptor. The
GFP-AR-R840C entered into the nucleus in a slow process (50% attained
after 90 min) and reached a low maximal transfer. GFP-AR-G743V was
nuclear in a low proportion after 120 min (26%) and attained 50%
after overnight incubation.
Thus, as a function of DHT concentration, the rate of GFP-AR-wt nuclear import was constant, but the maximal nuclear transfer slightly decreased. Concerning the G743V and R840C mutations, which are associated with PAIS and decreased androgen-binding affinity, supraphysiological concentrations of DHT were capable of inducing nuclear import, with a rate identical to that of wild-type. This rate decreased severely as a function of DHT concentration, and was greater for GFP-AR-G743V than for GFP-AR-R840C.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The two substitutions have been previously described in a grade 3 concerning the substitution arginine 840 in cysteine (9, 10, 11) and a more severe grade 4 for the G743V (13), according to Quigley’s description (2). In transient transfection assays, both mutant receptors displayed a decreased equilibrium-binding affinity for androgen, compared with normal receptor and were fully effective in transcriptional activation (but only at high concentration of androgen). These results explained the abnormal function of AR in these patients but did not permit us to differentiate the severity of the phenotype. Moreover, the androgen-binding characteristics revealed a faster dissociation of androgen for GFP-AR-G743V than for GFP-AR-R840C. These dissociation rates reflect the relative instability of the hormone-receptor complex of G743V and R840C, as for most of the LBD-AR mutants (21). With the GFP-AR model, the impact of this androgen-binding deficit was evaluated on the cytoplasmic-nuclear trafficking of the AR mutants. When the cells were incubated, in presence of a high concentration of DHT (10-6 mol/L), the kinetics of GFP-AR-R840C was indistinguishable from the kinetics of normal receptor, whereas the GFP-AR-G743V was nuclear later. At 10-7 mol/L DHT, the nuclear import of GFP-AR-G743V and R840C decreased partially. In the presence of a physiological concentration of DHT (10-9 mol/L) and after 1-h incubation, a low proportion of GFP-AR-R840C was nuclear, whereas the amount of GFP-AR-G743V was barely detectable. Surprisingly, at this concentration, their capacity to transactivate was maximal and was equivalent to wild-type AR. This reflects the fact that only a few activated receptors were sufficient to fully transactivate the reporter gene. Also, because of the overexpression of AR in transfected cells (intracellular receptor concentration of 10-8–10-7 mol/L), the transactivation assay does not take the total number of receptors into account and, thus, does not reveal the real defect in the AR action. This would explain the difficulty of detecting differences in activity among mutants associated with PAIS. In contrast, the GFP-AR model reproduced the functional properties of AR, such as the apparent androgen-binding affinity; and when applied to AR mutants, this in vitro assay was more relevant to the behavior of mutated AR, which suggests that it may be a complementary tool in the study of the AR mutants detected in AIS.
The G743V and R840C mutations induced a comparable decrease in affinity, but G743V showed a higher dissociation rate than R840C, as mentioned above. This could be caused by a more open conformation of the androgen-binding site, which would increase both dissociation and association rates. This increase in exchange rate leads to more activated receptor in an unbound state, which at low hormone concentration, has two impacts: 1) a decrease in the receptor traffic rate caused by switching between activated and nonactivated forms; and 2) an increase in denaturation, because it is known that activated receptor is more unstable in the absence of hormone (22). This would explain the slower kinetics of G743V vs. R840C, and it is interesting to note here that translocation was more relevant to phenotype than the transactivation assay. Indeed, our data show a direct relationship between the characteristics of nuclear transfer and the severity of PAIS. Although the trafficking analysis should be reserved for LBD mutations, it could be useful to study alterations either in the kinetics of ligand association and dissociation or in the stability of activated receptor.
In conclusion, these data clearly demonstrated a direct and proportional relationship between the androgen-binding dissociation and the nuclear transfer of AR, in terms of quantitative and kinetic parameters and the GFP-AR model points out the dynamics of the androgen binding. In addition, the nuclear transfer characteristics of the two mutants were in agreement with the expression of the degree of androgen insensitivity. Trafficking of the receptor could thus provide complementary insight into the structure-function relationship of the AR in patients with PAIS.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received April 17, 1998.
Accepted June 5, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  N. Kaku, K.-i. Matsuda, A. Tsujimura, and M. Kawata Characterization of Nuclear Import of the Domain-Specific Androgen Receptor in Association with the Importin {alpha}/{beta} and Ran-Guanosine 5'-Triphosphate Systems Endocrinology, August 1, 2008; 149(8): 3960 - 3969. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. L. Cutress, H. C. Whitaker, I. G. Mills, M. Stewart, and D. E. Neal Structural basis for the nuclear import of the human androgen receptor J. Cell Sci., April 1, 2008; 121(7): 957 - 968. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. He, R. T. Gampe Jr., A. T. Hnat, J. L. Faggart, J. T. Minges, F. S. French, and E. M. Wilson Probing the Functional Link between Androgen Receptor Coactivator and Ligand-binding Sites in Prostate Cancer and Androgen Insensitivity J. Biol. Chem., March 10, 2006; 281(10): 6648 - 6663. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Kawate, Y. Wu, K. Ohnaka, R.-H. Tao, K.-i. Nakamura, T. Okabe, T. Yanase, H. Nawata, and R. Takayanagi Impaired Nuclear Translocation, Nuclear Matrix Targeting, and Intranuclear Mobility of Mutant Androgen Receptors Carrying Amino Acid Substitutions in the Deoxyribonucleic Acid-Binding Domain Derived from Androgen Insensitivity Syndrome Patients J. Clin. Endocrinol. Metab., November 1, 2005; 90(11): 6162 - 6169. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Poujol, S. Lumbroso, B. Terouanne, J.-M. A. Lobaccaro, W. Bourguet, and C. Sultan Pathophysiology of Androgen Insensitivity Syndromes: Molecular and Structural Approaches of Natural and Engineered Androgen Receptor Mutations at Amino Acid 743 J. Clin. Endocrinol. Metab., December 1, 2002; 87(12): 5793 - 5800. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. James, I. U. Agoulnik, J. M. Harris, G. Buchanan, W. D. Tilley, M. Marcelli, D. J. Lamb, and N. L. Weigel A Novel Androgen Receptor Mutant, A748T, Exhibits Hormone Concentration-Dependent Defects in Nuclear Accumulation and Activity Despite Normal Hormone-Binding Affinity Mol. Endocrinol., December 1, 2002; 16(12): 2692 - 2705. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H Poukka, U Karvonen, N Yoshikawa, H Tanaka, J. Palvimo, and O. Janne The RING finger protein SNURF modulates nuclear trafficking of the androgen receptor J. Cell Sci., January 9, 2000; 113(17): 2991 - 3001. [Abstract] [PDF]
|
|
|
|
|
|
A. Racz and J. Barsony Hormone-dependent Translocation of Vitamin D Receptors Is Linked to Transactivation J. Biol. Chem., July 2, 1999; 274(27): 19352 - 19360. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
