help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ace, C. I.
Right arrow Articles by Okulicz, W. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ace, C. I.
Right arrow Articles by Okulicz, W. C.
The Journal of Clinical Endocrinology & Metabolism Vol. 83, No. 10 3569-3573
Copyright © 1998 by The Endocrine Society

Original Studies

A Progesterone-Induced Endometrial Homolog of a New Candidate Tumor Suppressor, DMBT11

Christopher I. Ace and William C. Okulicz

Departments of Obstetrics and Gynecology and Physiology, University of Massachusetts Medical School, Worcester, Massachusetts 01655

Address all correspondence and requests for reprints to: William C. Okulicz, Ph.D., Department of Obstetrics and Gynecology, University of Massachusetts Medical School, 55 Lake Avenue North, Worcester, Massachusetts 01655. E-mail: william.okulicz{at}banyan.ummed.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have previously prepared and characterized a subtracted library enriched for endometrial progesterone (P)-dependent genes in the rhesus monkey. One of the fragment clones (H3) that we selected for sequencing from this library was found to be homologous to human DMBT1, a recently isolated member of the scavenger receptor cysteine-rich superfamily and a new putative tumor suppressor. In this report, we provide evidence that H3 is the rhesus monkey homolog of DMBT1. Additional sequence data of H3 (1071 bp) showed a striking homology with DMBT1 (92% identical). Semiquantitative kinetic PCR of estrogen-dominant vs. P-dominant endometrial complementary DNA populations showed that the H3 gene was up-regulated 5-fold by normal secretory P levels. In situ hybridization with unique probes to H3 confirmed the up-regulation by P in the endometrium and a restricted expression in the stromal compartment. Another recent report suggested the presence of an endometrial tumor suppressor in the same chromosomal region as DMBT1 (10q23–26); deletions in this region were associated with endometrial cancers. Together, these studies potentially provide a molecular link to the protective effect of the action of P on unopposed estrogen exposure in reproductive tract cancers in women.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THE CHANGING pattern of estradiol (E) and progesterone (P) secretion during the primate menstrual cycle governs the hormonal regulation of endometrial growth, differentiation, shedding, and reconstruction that is an essential component of continued reproductive competence (1, 2). Our research efforts have focused on P-induced genes that play important roles in the proper maturation of the primate (rhesus monkey) endometrium that permit embryo implantation. Because of the variation in natural cycles among animals, we have used artificial menstrual cycles to obtain more precisely timed endometrial biopsies for analysis. The development and use of artificial menstrual cycles in the rhesus monkey were first described by Hodgen (3). These studies showed that simulation of the menstrual cycle by the timed insertion and removal of SILASTIC brand implants (Dow Corning Corp., Midland, MI) of E or P was sufficient to allow the endometrium to support implantation and eventual delivery (in vitrofertilization and surrogate transfer). Our previously published studies (4, 5, 6, 7) have described in detail the protocols for creation of adequate (will support implantation) and inadequate (will not support implantation) cycles. These studies showed that the hormone levels produced by these protocols are coincident with those observed in the natural menstrual cycle of the rhesus monkey (4).

Using the rhesus monkey model described above, we have previously reported the isolation of an endometrial complementary DNA (cDNA) fragment, H3, from a P-dependent subtracted library (Psub.cDNA) (8). This fragment was isolated by virtue of its elevated representation in P-dominant (secretory phase) cDNA (PcDNA; days 21–23) compared to E-dominant (proliferative phase) cDNA (EcDNA; days 9–13). Subsequent cloning and sequencing (678 bp) allowed us to search DNA and protein databases for homologies. Initially, the only homologies obtained were to several glycoproteins, such as bovine gallbladder mucin, ebnerin, hensin, and ductin, that contained internal tandem repeats and cysteine-rich repeats (9, 10, 11, 12). Several stretches within the H3 obtained sequence did not show significant homology, and one particular sequence of 60 nucleotides was without any match in the GenBank database. Very recently, however, a follow-up GenBank search indicated highly significant homology with the putative tumor suppressor gene, DMBT1 (13). The present study provides data to show that H3 is the rhesus monkey homolog of the candidate tumor suppressor gene, DMBT1.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
cDNA populations and subtracted library

We have previously described the procedure for obtaining E- (normal proliferative phase), P- (normal/adequate secretory phase) and I- (inadequate secretory phase) cDNA populations (4, 5, 6, 7). Construction of a P-dependent library (Psub.cDNA) from which H3 was isolated was performed by subtractive hybridization of EcDNA from PcDNA (8).

Sequence analysis and oligonucleotides

Automated DNA sequencing services were provided by the Nucleic Acids Facility at University of Massachusetts Medical School. DNA and protein homology searches were performed using BLAST programs provided by NCBI (blast@ncbi.nlm.nih.gov). H3 primers for semiquantitative PCR were 5'- AGACAGCTGGGGTGTGGACGTGCAGTTTCA (upper) and 5'- GTTGCAGCCACCTTCAAGCTGGACATCTCT (lower); the product is 408 bp.

Primers for amplification of overlapping and extended 5'-sequence of H3 were 5'-CTACTACGACAGATTGGTGGCATCCAACAA (upper) and 5'-GTGGCGTTGAGAAAAGGAGCAGGTGTCGAT (lower). The product was 761 bp, 293 bp of which were previously sequenced and 468 bp of which were new upstream sequence.

PCR analysis

Twenty nanograms of template cDNA were amplified in 100-µL reactions containing 0.5 µmol/L primers, 0.25 mmol/L deoxy-NTPs, 1.5 mmol/L magnesium chloride, 1 x buffer (PCR Buffer, Sigma Chemical Co., St. Louis, MO) and 2 U Tfl polymerase (Epicenter Technologies, Madison, WI) in a thermal cycler (95 C, 1 min; 55 C, 1 min; 70 C, 2 min) for 22 cycles. PCR was repeated three times to ensure reproducibility. Products were analyzed on a 1% ethidium bromide-stained agarose gel after electrophoresis, and comparative quantitation was performed by densitometric analysis of photographed gels.

In situ hybridization

Oligonucleotides used for in situ hybridization were: 5'-ATCGACACCTGCTCCTTTTCTCAACGCCAC (sense) and 5'-GTGGCGTTGAGAAAAGGAGCAGGTGTCGAT (antisense). These specific oligonucleotide probes were designed to a unique region of H3 and DMBT1 (see below). Biotinylation procedures were conducted with the Fast-Tag system according to manufacturer’s specifications (Vector Laboratories, Inc., Burlingame, CA). Probes were diluted to a final concentration of 125 ng/mL in hybridization buffer (BioGenex Laboratories, Inc., San Ramon, CA).

Frozen endometrial tissue sections were cut (6 µm) and placed on Fro-tissuer (Zymed Laboratories, Inc., South San Francisco, CA)-treated slides and fixed in 4% paraformaldehyde for 30 min at room temperature. After fixation, slides were washed in phosphate-buffered saline (PBS; 5 min at room temperature), treated for 20 min with proteinase K (1 µg/mL) at 37 C, washed in PBS, and hybridized overnight at 37 C within a humidified chamber. Slides were washed and incubated with mouse antibiotin antibody and subsequently with goat antimouse antibody (BioGenex Laboratories, Inc.) for 20 min each at room temperature with a PBS wash following each step. Slides were next treated with streptavidin-conjugated horseradish peroxidase for 30 min at room temperature, with biotinyl-tyramide complex for 10 min at room temperature, and with an additional streptavidin-conjugated horseradish peroxidase treatment for 30 min at room temperature according to the manufacturer’s specifications (New England Nuclear, Boston, MA) with a PBS wash following each step. Slides were then treated with diaminobenzidine substrate (Vector Laboratories, Inc.) for 3–10 min at room temperature and washed in distilled water at room temperature to stop the reaction. Slides were then dehydrated, cleared in xylene, and coverslipped for viewing and photography.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
To obtain more sequence data for H3 and a more definitive identification, we attempted rapid amplification of cDNA ends (RACE)-PCR using P-dependent populations as template. This approach proved unsuccessful, but we were able to amplify (by conventional PCR) a 761-bp 5'-fragment containing an additional 468 bp of sequence upstream of H3 using an internal unique H3 3'-primer (see below) and a 5'-primer designed from the published sequence of DMBT1 (total nucleotide sequence of 1071 bp). This fragment was also strikingly homologous (92% identical) to DMBT1, indicating that H3 is indeed the monkey homolog of DMBT1. The assembled sequence and alignment of the P-dependent endometrial H3 gene fragments and the putative tumor-suppressor DMBT1 are shown in Fig. 1Go. The assembled sequence of H3 is 1071 bp and contains a DMBT1 homologous threonine-rich region and a scavenger receptor cysteine-rich region flanked by two complement subcomponents Clr/Cls, Uegt, Bmpl (CUB) domains (14, 15). Interestingly, CUB domains are also found in egg-binding spermadhesins of the acrosome and in proteins that participate in pattern formation during embryogenesis and organogenesis (16). All of these homologous regions lie in the carboxyl coding region of the putative protein. Importantly, a unique coding region of 60 nucleotides in the rhesus monkey homolog (as noted above) was also specifically noted in the sequence of the DMBT1 gene (Fig. 1Go). Indeed, this unique coding region prompted our hesitation in the assignment of this gene fragment to any specific class or family of genes in the GenBank database. The unique sequence (confined to H3 and DMBT1) was used as a target for the design of in situ hybridization probes (see below) and for the 3'-primer design in 5'-extension PCR (see above and Materials and Methods). The above properties of the sequence of our H3 clone and its homology to that of the DMBT1 gene provide strong support that our H3 gene fragment is the rhesus monkey homolog of the human DMBT1 gene, a candidate tumor suppressor gene.



View larger version (61K):
[in this window]
[in a new window]
  		Figure 1. Alignment of sequences H3 (no. 1–359) and DMBT1 (no. 1118–1475). Vertical lines show identical homology (92%), and plus signs denote amino acids with conserved reactivity. The threonine-rich (TTT) region, the scavenger receptor cysteine-rich (SRCR) cysteine-rich region, the CUB domains, and the region unique to DMBT1 and H3 are indicated. Nomenclature was taken from the report by Mollenhauer et al. (13 ).

 
As noted above, our H3 gene fragment was isolated from a P-dependent endometrial subtracted library, and we now provide further evidence for its induction by P in Fig. 2AGo. Semiquantitative PCR analysis of three hormone-specific cDNA populations [EcDNA, PcDNA, and inadequate cDNA (IcDNA)] showed that H3 gene expression was highly up-regulated in PcDNA (5-fold) compared to EcDNA or IcDNA. Figure 2BGo is a restriction enzyme digest of the PCR product and demonstrates that the PCR product exhibits the expected fragment sizes of the H3 sequence. The induction of H3 in PcDNA compared to IcDNA suggests that an adequate level of P is required for its expression during a normal secretory phase.



View larger version (74K):
[in this window]
[in a new window]
  		Figure 2. A, Semiquantitative PCR using H3-specific primers with proliferative phase (E-dominant) cDNA (lane 1), secretory phase (P-dominant) cDNA (lane 2), secretory phase inadequate (deficient in P) cDNA (lane 3), and P-induced subtracted cDNA (lane 4). Lane 5 is a marker, and the PCR product is 408 bp. B, The H3 PCR product (lane 1) has been digested with BspMI (lane 2) and results in the expected fragment sizes of 213 and 195 bp.

 
We next examined the endometrial cell types that express the H3 gene by in situ hybridization. Sense and antisense probes were designed within the unique sequence noted above. Figure 3Go shows that in E-dominant (day 13) endometrium there is little or no detectable expression of the H3 gene (Fig. 3AGo), whereas a sharp increase in expression is observed in P-dominant (day 23) endometrium (Fig. 3BGo). No significant staining was observed when the corresponding sense probe was incubated with day 13 (Fig. 3CGo) or day 23 (Fig. 3DGo) endometrial tissue. The expression of H3 shows a cell-type specific up-regulation, as it is observed predominantly in stromal cells of the endometrium.



View larger version (107K):
[in this window]
[in a new window]
  		Figure 3. In situ hybridization of the H3 gene in E- and P-dominant endometrial tissue from the rhesus monkey. E-dominant (day 13; A) and P-dominant (day 23; B) endometria incubated with antisense oligonucleotide or sense oligonucleotide (C and D, respectively). Gl, Endometrial gland; S, stroma. Magnification, x200.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Our data have shown that the H3 gene fragment is the rhesus monkey homology of the putative tumor suppressor gene, DMBT1 (13). We have also shown this gene is highly up-regulated by P by both semiquantitative kinetic PCR analysis and in situ hybridization. Interestingly, the expression of this gene appears to be cell type specific, as it is only detectable in endometrial stromal cells. This is perhaps not surprising, because endometrial stromal cells retain P receptor immunoreactivity, whereas most epithelial cells lose receptor immunoreactivity in the human and rhesus monkey secretory phase (5, 17, 18, 19). Therefore, during the secretory phase, stromal cells are the most likely targets for P-dependent changes in gene expression.

Mollenhauer et al. (13) examined the expression of DMBT1 in several human tissues and, surprisingly, did not detect it in the uterus. This is probably due to the fact that an adequate secretory phase endometrium (normal P level) may be required for expression and detection of DMBT1. Our data not only verify its presence in the primate endometrium, but also establish the hormonal induction of this gene by P.

It is perhaps not surprising that tumor suppressor genes would be activated by P, as proliferation is inhibited in many cell types during the secretory phase as differentiation proceeds (7, 20). Our previous studies in the rhesus monkey endometrium have documented the striking zonal changes in cell proliferation that occur during the changeover from an E- to a P-dominant endometrium (21, 22). Proliferation in zones I, II, and III during peak E levels was dramatically suppressed during the midsecretory phase, whereas proliferation in zone IV of the basalis increased. We have also previously shown that the tumor suppressor TGFB2 and its receptor messenger ribonucleic acid are increased by P in normal secretory endometria (23).

Peiffer et al. (24) have shown that of 37 endometrial cancers examined, the highest proportion (40%) exhibited deletions in chromosome 10 location 10q25.2–26.3, which correlates well with the DMBT1 deletion location 10q25.3–26.1 in brain tumors. The researchers speculated a role for a tumor suppressor gene in this location in the development and progression of endometrial cancer. Taken together with our observations on the tissue localization and hormonal regulation of H3 and DMBT1, these data lead us to speculate that deletions of DMBT1 sequences in the human endometrium may also be responsible for a significant percentage of endometrial cancers. Other endometrial cancers that exhibit no deletions in this region could nonetheless be caused by mutations in this tumor suppressor gene as well as disruptions in unrelated genes.


   Acknowledgments
 
The authors thank Dr. C. Longcope and J. Tast and Eric Merithew for their help and support of this work.


   Footnotes
 
1 This work was supported in part by a grant from the NICHHD (HD-31620, to W.C.O.). Back

Received May 20, 1998.

Accepted July 2, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Wynn RM. 1989 The human endometrium. Cyclic and gestational changes. In: Wynn RM, Jollie WP, eds. Biology of the uterus, 2nd ed. New York: Plenum Press; 289–331.
  2. Maslar IA. 1988 The progestational endometrium. Semin Reprod Endocrinol. 6:115–128.
  3. Hodgen GD. 1983 Surrogate embryo transfer combined with estrogen-progesterone therapy in monkeys. Implantation, gestation, and delivery without ovaries. JAMA. 250:2167–2171.[Abstract]
  4. Longcope C, Bourget C, Meciak PA, et al. 1988 Estrogen dynamics in the female rhesus monkey. Biol Reprod. 39:561–565.[Abstract]
  5. Okulicz WC, Savasta AM, Hoberg LM, Longcope C. 1990 Biochemical and immunohistochemical analyses of estrogen and progesterone receptors in the rhesus monkey uterus during the proliferative and secretory phases of artificial menstrual cycles. Fertil Steril. 53:913–920.[Medline]
  6. Okulicz WC, Balsamo M, Tast J. 1993 Progesterone regulation of endometrial estrogen receptor and proliferation during the late proliferative and secretory phase in artificial menstrual cycles in the rhesus monkey. Biol Reprod. 49:24–32.[Abstract]
  7. Okulicz WC, Balsamo M. 1993 A double immunofluorescent method for the simultaneous analysis of progesterone-dependent changes in proliferation (Ki-67) and the estrogen receptor in the rhesus endometrium. J Reprod Fertil. 99:545–549.[Abstract]
  8. Ace CI, Balsamo M, Le LT, Okulicz WC. 1994 Isolation of progesterone-dependent complementary deoxyribonucleic acid fragments from rhesus monkey endometrium by sequential subtractive hybridization and polymerase chain reaction amplification. Endocrinology. 134:1305–1309.[Abstract]
  9. Nunes DP, Keates AC, Afdhal NH, Offner GD. 1995 Bovine gall-bladder mucin contains two distinct tandem repeating sequences: evidence for scavenger receptor cysteine-rich repeats. Biochem J. 310:41–48.
  10. Li XJ, Synder SH. 1995 Molecular cloning of Ebnerin, a von Ebner’s gland protein associated with taste buds. J Biol Chem. 270:17674–17679.[Abstract/Free Full Text]
  11. Takito J, Hikita C, Al-Awqati Q. 1996 Hensin, a new collecting duct protein involved in the in vitro plasticity of intercalated cell polarity. J Clin Invest. 98:2324–2331.[Medline]
  12. Cheng H, Bjerknes M, Chen H. 1996 CRP-ductin: a gene expressed in intestinal crypts and in pancreatic and hepatic ducts. Anat Rec. 244:327–343.[CrossRef][Medline]
  13. Mollenhauer J, Wiemann S, Scheurlen W, et al. 1997 DMBT1, a new member of the SRCR superfamily, on chromosome 10q25.3–26.1 is deleted in malignant brain tumours. Nat Genet. 17:32–39.[CrossRef][Medline]
  14. Kanan J, Nayeem N, Binns RM, Chain BM. 1997 Mechanisms for variability in a member of the scavenger-receptor cysteine-rich superfamily. Immunogenetics. 46:276–282.[CrossRef][Medline]
  15. Freeman M, Ashkenas J, Rees DJ, et al. 1990 An ancient, highly conserved family of cysteine-rich protein domains revealed by cloning type I and type II murine macrophage scavenger receptors. Proc Natl Acad Sci USA. 87:8810–8814.[Abstract/Free Full Text]
  16. Bork P, Beckmann G. 1993 The CUB domain a widespread module in developmentally regulated proteins. J Mol Biol. 231:539–545.[CrossRef][Medline]
  17. Press MF, Udove JA, Greene GL. 1988 Progesterone receptor distribution in the human endometrium. Am J Pathol. 131:112–124.[Abstract]
  18. Lessey BA, Killam AP, Metzger DA, Haney AF, Greene GL, McCarty Jr KS. 1988 Immunohistochemical analysis of human uterine estrogen and progesterone receptors throughout the menstrual cycle. J Clin Endocrinol Metab. 67:334–340.[Abstract]
  19. Hild-Petito S, Verhage HG, Fazleabas AT. 1992 Immunocytochemical localization of estrogen and progestin receptors in the baboon (Papio anubis) uterus during implantation and pregnancy. Endocrinology. 130:2343–2353.[Abstract]
  20. Okulicz WC, Ace CI, Scarrell R. 1997 Zonal changes in proliferation in the rhesus endometrium during the late secretory phase and menses. Proc Soc Exp Biol Med. 214:132–138.[Abstract]
  21. Padykula HA, Coles LG, McCracken JA, King NW, Longcope C, Kaiserman-Abramof IR. 1984 A zonal pattern of cell proliferation and differentiation in the rhesus endometrium during the estrogen surge. Biol Reprod. 31:1103–1118.[Abstract]
  22. Padykula HA, Coles LG, Okulicz WC, et al. 1989 The basalis of the primate endometrium: a bifunctional germinal compartment. Biol Reprod. 40:681–690.[Abstract]
  23. Ace CI, Okulicz WC. 1995 Differential gene regulation by estrogen and progesterone in the primate endometrium. Mol Cell Endocrinol. 115:95–103.[CrossRef][Medline]
  24. Peiffer SL, Herzog TJ, Tribune DJ, Mutch DG, Gersell DJ, Goodfellow PJ. 1995 Allelic loss of sequences from the long arm of chromosome 10 and replication errors in endometrial cancers. Cancer Res. 55:1922–1926.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
G. Cannon, Y. Yi, H. Ni, E. Stoddard, D. A. Scales, D. I. Van Ryk, I. Chaiken, D. Malamud, and D. Weissman
HIV Envelope Binding by Macrophage-Expressed gp340 Promotes HIV-1 Infection
J. Immunol., August 1, 2008; 181(3): 2065 - 2070.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
G. L. Mutter, M.-C. Lin, J. T. Fitzgerald, J. B. Kum, and C. Eng
Changes in Endometrial PTEN Expression throughout the Human Menstrual Cycle
J. Clin. Endocrinol. Metab., June 1, 2000; 85(6): 2334 - 2338.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ace, C. I.
Right arrow Articles by Okulicz, W. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ace, C. I.
Right arrow Articles by Okulicz, W. C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals