The Journal of Clinical Endocrinology & Metabolism Vol. 82, No. 8 2566-2569
Copyright © 1997 by The Endocrine Society
Endocrinological Oncology |
Different Expression Patterns of Somatostatin Receptor Subtypes in Cultured Epithelial Cells from Human Normal Prostate and Prostate Cancer1
Antonio A. Sinisi,
Antonio Bellastella,
Domenico Prezioso,
Maria R. Nicchio,
Tullio Lotti,
Marco Salvatore and
Daniela Pasquali
Istituto di Endocrinologia (A.A.S., A.B., Da.P., M.R.N.),
Facoltà di Medicina, Seconda Università di Napoli; and
Istituto di Urologia (Do.P., T.L.) and Dipartimento di Medicina
Nucleare (M.S.), Università Federico II, 80131 Napoli,
Italy
Address all correspondence and requests for reprints to: Antonio Bellastella, M.D., Istituto di Endocrinologia, Seconda Università di Napoli, Via Pansini 5, 80131, Napoli, Italy.
 |
Abstract
|
|---|
The transcripts of five SRIH receptor subtypes (SSTR1, SSTR2, SSTR3,
SSTR4, and SSTR5) were investigated by RT-PCR in epithelial cells (EC)
and stromal cells (SC) from primary cultures of five normal human
prostates and six prostate cancers. Primary cultures of prostate EC
were established in serum-free keratynocyte medium with 5% FCS,
epidermal growth factor, and bovine pituitary extract; SC were cultured
in MEM with 10% FCS. Total RNA was extracted from EC and SC using a
modified guanidine thiocyanate method. RT-PCR was performed after
deoxyribonuclease treatment, using SSTR1-, SSTR2-, SSTR3-, SSTR4-, and
SSTR5-specific primers and adding glyceraldehyde-3-phosphate
dehydrogenase-specific primers as internal control. A PCR product of
the expected size of 334 bp, corresponding to SSTR1, was expressed only
in EC from prostate cancer, whereas the expected 461-bp product of
SSTR2 was found only in EC from normal prostate. SSTR3 messenger RNA
was undetectable in normal and cancer EC, whereas SSTR4 and SSTR5 were
present in both cell types. SSTR1, SSTR2, SSTR3, SSTR4, and SSTR5
messenger RNAs were not expressed in SC from both normal and cancer
prostates. The RT-PCR method clearly demonstrated SSTRs’ expression in
the human prostate EC in vitro with differences between
normal and tumoral samples. Our results may explain the ineffectiveness
of some SSTR2 selective SRIH analogues in the treatment of prostate
cancer and suggest that the absence of SSTR2 could represent a growth
advantage in prostate cancer.
|
Introduction
|
|---|
A ROLE for SRIH in the control of prostate
growth or function has been evidenced, even if its mechanism is still
under discussion (1, 2, 3, 4). A direct effect of SRIH caused by the presence
of specific receptors has been demonstrated in the Dunning rat tumor
(5). In humans, the presence of SRIH receptors (SSTRs) in normal
prostate and in prostate cancer, investigated using SRIH analogue
binding assay, gave contradictory results (6, 7, 8). Recently, five SSTR
genes have been cloned and partially characterized (9, 10, 11, 12, 13, 14) that codify
for SSTR subtypes and are variably expressed in brain, pituitary, and
several endocrine and nonendocrine peripheral tissues (13, 14). The
presence of messenger RNA (mRNA) for SSTR1 in prostate cancer and of
mRNA for SSTR2 subtype in normal prostate tissues, with localization of
binding in the smooth muscles surrounding the gland, has been
demonstrated using in situ hybridization technique together
with radioligand assay (15). The aim of our study was to evaluate the
expression of SSTR1–5 gene subtypes by a highly sensitive method of
analysis (RT-PCR) in an isolated cell system represented by epithelial
cells (EC) and stromal cells (SC) from primary cultures of normal human
prostate and prostate cancer.
|
Materials and Methods
|
|---|
Cell cultures
Five normal human prostate tissues were collected from patients
(53–72 yr old) who had undergone radical cistectomy for bladder
cancer. Prostate cancer tissues were obtained from six patients (54–70
yr old) who had undergone radical prostatectomy for previously
untreated carcinoma of the prostate. After prostatectomy, a
wedge-shaped specimen of the fresh prostate was cut. A sample of the
tissue was submitted for pathological examination to confirm the
prostate origin, the diagnosis, and the absence of other diseases. All
tumor specimens were moderately differentiated adenocarcinomas: four
had Gleason grades between 2–3, the others between 3–3 and 3–4,
respectively; the epithelial/stroma proportion did not vary between
five cancer and control prostate tissues; only one cancer specimen with
Gleason score 7 had evidence of stroma invasiveness. Only specimens
containing 100% normal or cancer prostate cells were used to establish
primary cultures, according to a previously described method (16).
Prostate EC and SC were separated by centrifugation of minced and
collagenase (Collagenase IV, Gibco-BRL, Milan, Italy, 10 mg/mL)
digested tissues. The EC were plated on serum-free keratinocyte medium
(Gibco-BRL) supplemented with bovine pituitary extract (10 mg/mL),
epidermal growth factor (10 ng/mL), cholera toxin (10 ng/mL), 5% FCS,
and antibiotics (fungizon and penicillin-streptomycin). SC were
cultured on MEM supplemented with 10% FCS and antibiotics. At
confluence, cultures were passaged after trypsin treatment. Cell
culture purity was assessed by immunocytochemical staining with
monoclonal antibodies specific for cytokeratin (Boehringer, Mannheim,
Germany) as a marker for EC and for vimentin (Boehringer) for SC. At
first passage, the purity of the EC and SC cultures was near 95% and
100%, respectively.
RNA isolation
RNA was isolated from the cultures at first passage (for EC) or
at second/third passage (for SC). Total RNA was recovered with the use
of RNAZOL B kit (Cinna/Biotecx Laboratories, Houston, TX). Residual DNA
was removed by ribonuclease-free deoxyribonuclease (DNase) I treatment
(Promega, Florence, Italy).
RT-PCR
RNAs were reversely transcribed using 5 µg of total RNA in the
presence of RT (Superscript, BRL, 200 U) at 37 C for 1.5 h,
according to the protocol of the manufacturer. The reaction was stopped
by incubation at 95 C for 5 min. To obtain negative control for the
amplification reactions, we carried out an RNA transcription without
addition of RT. Complementary DNA (600 ng), obtained by reverse
transcription of RNAs, was amplified in the total vol of 50 µL Tris
HCl (10 mmol), 1.5 mmol MgCl2, and 50 mmol KCl (pH 8.3), 100 ng of
primers, deoxynucleotides triphosphate (0.2 mmol), and 2.5 U
Taq DNA polymerase (Boehringer). The reaction was carried
out in a DNA thermal cycler (Perkin-Elmer/Cetus, Milan, Italy). PCR was
started by a 3-min denaturation at 95 C, followed by 45 cycles of 1-min
annealing at 60 C, 2-min extension at 72 C, and 30 sec denaturation at
95 C. The PCR products were analyzed by electrophoresis on 1.2% or
1.5% agarose gel. We used 5'-3'end oligonucleotides for SSTR1, SSTR2,
SSTR3, SSTR4, and SSTR5 as described (17, 18). In each PCR reaction,
100 ng of primers of GAPDH, as internal control. For GAPDH, primer
sequences from the published DNA sequence of glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) gene were added (19): 5'
GACCCCTTCATTGACCTCAACTACATG3' (sense); 5' GTCCACCACCCTGTTGCTGTAGCC3'
(antisense). The identity of PCR products was confirmed by comparing
the size of the product with the size expected from the gene sequence.
SSTR1 and SSTR2 PCR products were further confirmed by restriction
analysis. Ten microliters of SSTR1 and SSTR2 PCR products were digested
using APA I and PVU II (Promega), respectively, at 37 C for 2 h,
and the digested products with the controls were separated on 2%
agarose gel. Moreover SSTR1 and SSTR2 amplimers were subjected to
direct sequencing (Sequenase, Amersham, Milan, Italy).
|
Results
|
|---|
We found that a PCR product of the expected size of 334 bp,
corresponding to SSTR1, was expressed only in EC from prostate cancers
(Fig. 1
), whereas the expected 461-bp product of SSTR2
was found in EC from normal prostates (Fig. 2). SSTR3
mRNA was undetectable in normal and cancer EC, whereas SSTR4 (247 bp)
and SSTR5 (221 bp) were present in both (see Fig. 4 and Fig. 5). SSTR1
and SSTR2 (Fig. 3), SSTR3, SSTR4 mRNAs (Fig. 4), and SSTR5 (Fig. 5) were not expressed
in SC from both normal and cancer prostates. The 876-bp product of
GAPDH was detectable in each PCR reaction. The treatment with DNase and
the coamplification of the GAPDH gene containing introns excluded
genomic DNA contaminations. Moreover, we did not find any products in
control amplifications performed in the absence of complementary DNA
(Figs. 1 and 2). The identification by restriction analysis of SSTR1
and SSTR2 RT-PCR products is shown in Fig. 6.
View larger version (49K):
[in this window]
[in a new window]
|
Figure 1. SSTR1 and GAPDH RT-PCR products, separated
on a 1.2% agarose gel, obtained in EC from five normal prostate and
six cancer prostate samples. Lanes 2–6 show the absence of SSTR1 (334
bp) in EC from normal prostates; lanes 7–12 show the presence of SSTR1
(334 bp) in EC from prostate cancers. GAPDH (876 bp) is present in all
samples. Lane 1, Puc 18 Hinf DNA ladder; lane 14, 100-bp DNA ladder;
lane 13, negative control.
|
|
View larger version (48K):
[in this window]
[in a new window]
|
Figure 2. SSTR2 and GAPDH RT-PCR products, separated
on a 1.2% agarose gel, obtained in EC from five normal prostate and
six prostate cancer samples. Lanes 2–6 show the presence of SSTR2 (461
bp) in EC from normal prostates; lanes 7–12 show the absence of SSTR2
in EC from prostate cancers. GAPDH (876 bp) is present in all samples.
Lane 1, 100-bp DNA ladder; lane 13, negative control.
|
|
View larger version (34K):
[in this window]
[in a new window]
|
Figure 4. SSTR3, SSTR4, and GAPDH RT-PCR products,
separated on a 1.5% agarose gel, obtained in representative cell
samples from human normal prostate and prostate cancer. SSTR4 (247 bp)
is expressed in EC from normal prostate (lane 3) and from prostate
cancer (lane 5); SSTR3 is absent in EC from normal prostate and
prostate cancer (lanes 2 and 4, respectively); SSTR3 and SSTR4 were
absent in SC from normal prostate (lanes 7 and 8) and prostate cancer
(lanes 9 and 10); GAPDH was present in all samples. Lane 1, 100-bp DNA
ladder.
|
|
View larger version (53K):
[in this window]
[in a new window]
|
Figure 5. SSTR5 and GAPDH RT-PCR products, separated
on a 1.5% agarose gel, obtained in EC from two normal prostates (lanes
2 and 4) and two prostate cancers (lanes 3 and 5). SSTR5 is absent in
SC from normal prostate (lanes 7 and 9) and prostate cancer (lanes 8
and 10); GAPDH was present in all samples. Lanes 1 and 6, 100-bp DNA
ladder.
|
|
View larger version (32K):
[in this window]
[in a new window]
|
Figure 3. RT-PCR for SSTR1, SSTR2, and GAPDH in SC of
representative normal prostate and prostate cancer samples. RT-PCR
products were separated in 1.2% agarose gel. Lanes 2–5 show the
presence of GAPDH (876 bp) and the absence of SSTR1 and SSTR2 in SC
from normal prostate (lanes 2 and 3) and prostate cancer (lanes 4 and
5); lanes 6 and 7 are included as positive controls for SSTR1 (lane 6)
and SSTR2 (lane 7) amplification.
|
|
View larger version (108K):
[in this window]
[in a new window]
|
Figure 6. Identification of SSTR1 and SSTR2 by
restriction analisys: Lanes 1 and 4, 100-bp DNA ladder; Lanes 2 and 5,
SSTR1 and SSTR2; Lanes 3 and 6 show the change in appearance of RT-PCR
products of SSTR1 and SSTR2 after digestion with restriction enzymes
APAI and PVUII, respectively.
|
|
|
Discussion
|
|---|
The RT-PCR method clearly demonstrated SSTRs’ expression in the
cultured human prostate EC with differences between normal and cancer
samples. So far, the presence of SSTRs has been evaluated in human
prostate and prostate cancer by binding assay, with contradictory
results (6, 7, 8). In fact, either absent or low-affinity SRIH binding has
been reported in postmortem prostate homogenates (6, 8); in prostate
cancer biopsies, no labeled octreotide binding was observed (6); in
prostate cancer homogenates, either absent or high-affinity SRIH-14
binding was reported (6, 7). High-affinity receptors for SRIH have been
detected in rat prostate tumor (Dunning R3327) (5, 8). Recently, it has
been demonstrated that SSTR comprises a family of structurally related
proteins encoded by at least five genes (9, 10, 11, 12, 13, 14). The expression of
these genes has been established in some human endocrine tumors (17, 18, 20, 21, 22). Expression of SSTR2 mRNA in six benign prostate tissues
and SSTR1 mRNA in eight prostate cancers have been reported by Reubi
et al. (15) using in situ hybridization on
cryostat sections. By using a combination of in vitro
receptor autoradiography with labeled octreotide and SRIH-28 as
radioligands and in situ hybridization techniques, these
authors localized the SSTRs in the smooth muscles of the stroma of all
normal and hyperplastic prostate cryostat sections examined. In this
study, by using RT-PCR technique, we show that cultured human prostate
EC, but not SC, express SSTRs. Furthermore, we investigated and
detected, for the first time, the expression of SSTR4 and SSTR5 in both
normal and cancer-cultured epithelial prostate cells. Even if we
studied a limited number of samples, the results were univocal and
suggested that SSTR mRNAs are present in the hormone-dependent
glandular compartment. The apparent discrepancy between our data and
the findings of Reubi et al. (15) may be caused by the
different methodological approaches used. In our study, the higher
sensitivity of RT-PCR analysis may explain the evidence of SSTR
transcripts in EC. Moreover, stromal cell primary cultures at second or
third passage in serum-containing medium, used by us for RT-PCR,
probably were devoid of smooth muscle cells, in which SSTR have been
localized previously by in situ hybridization (15). In fact,
these culture conditions are unable to maintain smooth muscle cells
vs. fibroblasts (23). Thus, our data indicate that cultured
stromal fibroblasts, from either normal or prostate cancer, do not
express SSTRs, but it cannot be excluded that other SC, as smooth
muscle cells, contain SSTRs in vivo. In line with the
findings of Reubi et al. (15), we demonstrate a significant
difference in regulation of SSTR subtypes between normal and cancer
cells. In our study, normal prostate EC express SSTR2, SSTR4, and
SSTR5, whereas cancer EC express SSTR1, SSTR4, and SSTR5 subtypes. The
different expression patterns of the five SSTR genes investigated by us
under identical experimental conditions exclude that our RT-PCR results
might be a consequence of ectopic transcription. The pretreatment of
RNAs with DNase, the absence of PCR products when RNA preparation was
directly amplified, and the coamplification of GAPDH in each PCR
reaction indicate that the products detected were not caused by the
amplification of genomic DNA, because SSTR genes are intronless.
Thereafter, our data confirm that RT-PCR is a reliable and specific
technique in detecting the expression of SSTR genes in tissues and
cells, as suggested by other authors (17, 18, 21).
SRIH analogues have been shown to inhibit the growth of transplanted
Dunning rat prostate tumors (2, 3). Regression of the prostate
epithelium and proliferation of connective tissue have been observed by
adding SRIH to luteinizing hormone/releasing hormone analogues in the
treatment of prostate cancer (3). It has been suggested that these
effects may result from a direct action at glandular level, or from an
indirect action on local growth factors or on GH and PRL circulating
levels (4). Our findings suggest that SRIH may act as hormone on
prostate EC also, even if normal and prostate cancer EC display
different SSTR gene expression and may be target for SRIH analogues
with different receptor affinity. Exact functions mediated by different
SSTR subtypes is not yet clearly established, but several findings
suggest that SSTR1 and SSTR2 subtypes may be responsible for the
antiproliferative effects of SRIH (13, 14). Thus, absence of SSTR2
expression on cancer cells could represent a condition of growth
advantage, as suggested in other human cancer types (22). Moreover, our
data may explain the lack of results in the treatment of prostate
cancer with some SRIH analogues (1, 24, 25) with high affinity for
SSTR2 subtype, and suggest the need to look for new analogues with high
affinity for SSTR1.
|
Acknowledgments
|
|---|
The authors thank Drs. Ch. Sultan and C. Boudon (INSERM U439,
Montpellier, France) for their help and advice in setting up primary
cultures of prostate cells.
|
Footnotes
|
|---|
1 This research was supported by grants from AIRC (AIRC 1994) and from
CNR (AI95.0020) to A. A. Sinisi. 
Received January 13, 1997.
Revised March 13, 1997.
Accepted April 30, 1997.
|
References
|
|---|
-
Schally AV, Redding TW. 1987 Somatostatin
analogs as adjuncts to agonists of luteinizing hormone-releasing
hormone in the treatment of experimental prostate cancer. Proc Natl
Acad Sci USA. 84:7275–7279.[Abstract/Free Full Text]
-
Siegel RA, Tolcsvai L, Rudin M. 1988 Partial
inhibition of the growth of transplanted Dunning rat prostate tumors
with the long-acting somatostatin analogue sandostatin (SMS 201–995). Cancer Res. 48:4651–4655.[Abstract/Free Full Text]
-
Zalatnai A, Paz-Bouza JI, Redding TW, Schally AV. 1988 Histologic changes in the rat prostate cancer model after
treatment with somatostatin analogs and D-Trp-6-LH-RH. Prostate. 12:85–98.[Medline]
-
Manni A, Boucher AE, Demers LM, et al. 1990 Somatostatin analogues in the treatment of breast and prostate cancer. J Steroid Biochem Mol Biol. 37:1083–1087.[CrossRef][Medline]
-
Kadar T, Redding TW, Den-David M, Schally AV. 1988 Receptors for prolactin, somatostatin, and luteinizing hormone
releasing hormone in experimental prostate cancer after treatment with
analogs of luteinizing hormone releasing hormone and somatostatin. Proc
Natl Acad Sci USA. 85:890–894.[Abstract/Free Full Text]
-
Fekete M, Redding TW, Comaru-Schally AM, et al. 1989 Receptors for luteinizing hormone-releasing hormone, somatostatin,
prolactin and epidermal growth factor in rat and human prostate cancer
and in benign prostate hyperplasia. Prostate. 14:191–208.[Medline]
-
Reubi JC, Maurer R, von Werder K, Torhost J, Klijn JGM,
Lamberts SWJ. 1987 Somatostatin receptors in human endocrine
tumors. Cancer Res. 47:551–558.[Abstract/Free Full Text]
-
Srkalovic G, Cai RZ, Schally AV. 1990 Evaluation
of receptors for somatostatin in various tumors using different
analogs. J Clin Endocrinol Metab. 70:661–669.[Abstract]
-
Yamada Y, Post SR, Wang K, Tager HS, Bell GI, Seino
S. 1992 Cloning and functional characterization of a family of
human and mouse somatostatin receptors expressed in brain,
gastrointestinal tract, and kidney. Proc Natl Acad Sci USA. 89:251–255.[Abstract/Free Full Text]
-
Yasuda K, Rens-Domiano S, Breder CD, et al. 1992 Cloning of a novel somatostatin receptor, SSTR3, that is coupled to
adenylate cyclase. J Biol Chem. 267:20422–20428.[Abstract/Free Full Text]
-
Xu Y, Song J, Bruno JF, Berelowitz M. 1993 Molecular cloning and sequencing of human somatostatin receptor hSSTR4. Biochem Biophys Res Commun. 193:648–652.[CrossRef][Medline]
-
O’Carroll A-M, Raynor K, Lolait SJ, Reisine T. 1994 Characterization of cloned human somatostatin receptor SSTR5. Mol
Pharmacol. 46:291–298.[Abstract]
-
Reisine T, Bell GI. 1995 Molecular biology of
somatostatin receptors. Endocr Rev. 16:427–442.[CrossRef][Medline]
-
Lewin MJM, Le Romancer M. 1996 Somatostatin
receptors. In: Scarpignato C, ed. Octreotide: from basic science to
clinical medicine. Basel: Karger; 23–34.
-
Reubi JC, Waser B, Schaer J-C, Markwalder R. 1995 Somatostatin receptors in human prostate and prostate cancer. J Clin Endocrinol Metab. 80:2806–2814.[Abstract]
-
Boudon C, Rodier G, Lechevallier E, Mottet N, Barenton
B, Sultan Ch. 1996 Secretion of insulin-like growth factors and
their binding proteins by human normal and hyperplastic prostatic cells
in primary culture. J Clin Endocrinol Metab. 81:612–617.[Abstract]
-
Vikic-Topic S, Raisch KP, Kvols LK, Vuk-Pavlovic S. 1995 Expression of somatostatin receptor subtypes in breast carcinoma,
carcinoid tumor, and renal cell carcinoma. J Clin Endocrinol
Metab. 80:2974–2979.[Abstract/Free Full Text]
-
Kubota A, Yamada Y, Kagimoto S, et al. 1994 Identification of somatostatin receptor subtypes and an implication for
the efficacy of somatostatin analogue SMS 201–995 in treatment of
human endocrine tumors. J Clin Invest. 93:1321–1325.
-
Tso JY, Sun X-H, Kao T, Reece KS, Wu R. 1985 Isolation and characterization of rat and human
glyceraldehyde-3-phosphate dehydrogenase cDNAs: genomic complexity and
molecular evolution of the gene. Nucleic Acids Res. 13:2485–2502.[Abstract/Free Full Text]
-
Reubi JC, Schaer JC, Waser B, Mengod G. 1994 Expression and localization of somatostatin receptor SSTR1, SSTR2, and
SSTR3 messenger RNAs in primary human tumors using in situ
hybridization. Cancer Res. 54:3455–3459.[Abstract/Free Full Text]
-
Eden PA, Taylor JE. 1993 Somatostatin receptor
subtype gene expression in human and rodent tumors. Life Sci. 53:85–90.[CrossRef][Medline]
-
Buscail L, Saint-Laurent N, Chastre E, et al. 1996 Loss of SSTR2 somatostatin receptor gene expression in human pancreatic
and colorectal cancer. Cancer Res. 56:1823–1827.[Abstract/Free Full Text]
-
Sato JD, Hayashi I, Hayashi J, et al. 1994 Specific
cell types and their requirements. In: Davis JM, ed. Basic cell
culture. Oxford/New York: Oxford University Press; 181–222.
-
Parmar H, Charlton CD, Phillips R, et al. 1992 Therapeutic response to somatostatin analogue, BIM 23014, in metastatic
prostatic cancer. Clin Exp Metastasis. 13:3–11.
-
Logothetis CJ, Hossan EA, Smith TL. 1994 SMS
201–995 in the treatment of refractory prostatic carcinoma. Anticancer
Res. 14:2731–2734.[Medline]
This article has been cited by other articles:
|
|
|
|
 
D. Pasquali, V. Rossi, G. Conzo, G. Pannone, P. Bufo, A. De Bellis, A. Renzullo, G. Bellastella, A. Colao, G. Vallone, et al.
Effects of somatostatin analog SOM230 on cell proliferation, apoptosis, and catecholamine levels in cultured pheochromocytoma cells
J. Mol. Endocrinol.,
June 1, 2008;
40(6):
263 - 271.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D M Peehl
Primary cell cultures as models of prostate cancer development
Endocr. Relat. Cancer,
March 1, 2005;
12(1):
19 - 47.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. C. Reubi
Peptide Receptors as Molecular Targets for Cancer Diagnosis and Therapy
Endocr. Rev.,
August 1, 2003;
24(4):
389 - 427.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Pasquali, A. Notaro, G. Bonavolonta', P. Vassallo, A. Bellastella, and A. A. Sinisi
Somatostatin Receptor Genes Are Expressed in Lymphocytes from Retroorbital Tissues in Graves' Disease
J. Clin. Endocrinol. Metab.,
November 1, 2002;
87(11):
5125 - 5129.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. D. Zapata, R. M. Ropero, A. M. Valencia, L. Buscail, J. I. Lopez, R. M. Martin-Orozco, J. C. Prieto, J. Angulo, C. Susini, P. Lopez-Ruiz, et al.
Autocrine Regulation of Human Prostate Carcinoma Cell Proliferation by Somatostatin through the Modulation of the SH2 Domain Containing Protein Tyrosine Phosphatase (SHP)-1
J. Clin. Endocrinol. Metab.,
February 1, 2002;
87(2):
915 - 926.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Szepeshazi, A. V. Schally, G. Halmos, B. Sun, F. Hebert, B. Csernus, and A. Nagy
Targeting of Cytotoxic Somatostatin Analog AN-238 to Somatostatin Receptor Subtypes 5 and/or 3 in Experimental Pancreatic Cancers
Clin. Cancer Res.,
September 1, 2001;
7(9):
2854 - 2861.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. C. Reubi, J.-C. Schaer, S. Wenger, C. Hoeger, J. Erchegyi, B. Waser, and J. Rivier
SST3-selective potent peptidic somatostatin receptor antagonists
PNAS,
November 22, 2000;
(2000)
250483897.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
A. Colao, P. Marzullo, S. Spiezia, A. Giaccio, D. Ferone, G. Cerbone, A. Di Sarno, and G. Lombardi
Effect of Two Years of Growth Hormone and Insulin-Like Growth Factor-I Suppression on Prostate Diseases in Acromegalic Patients
J. Clin. Endocrinol. Metab.,
October 1, 2000;
85(10):
3754 - 3761.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
G. Halmos, A. V. Schally, B. Sun, R. Davis, D. G. Bostwick, and A. Plonowski
High Expression of Somatostatin Receptors and Messenger Ribonucleic Acid for Its Receptor Subtypes in Organ-Confined and Locally Advanced Human Prostate Cancers
J. Clin. Endocrinol. Metab.,
July 1, 2000;
85(7):
2564 - 2571.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
N. Baou, M. Bouras, J.-P. Droz, M. Benahmed, and S. Krantic
Evidence for a selective loss of somatostatin receptor subtype expression in male germ cell tumors of seminoma type
Carcinogenesis,
April 1, 2000;
21(4):
805 - 810.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Pasquali, V. Rossi, D. Prezioso, V. Gentile, V. Colantuoni, T. Lotti, A. Bellastella, and A. A. Sinisi
Changes in Tissue Transglutaminase Activity and Expression during Retinoic Acid-Induced Growth Arrest and Apoptosis in Primary Cultures of Human Epithelial Prostate Cells
J. Clin. Endocrinol. Metab.,
April 1, 1999;
84(4):
1463 - 1469.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
A. Plonowski, A. V. Schally, A. Nagy, B. Sun, and K. Szepeshazi
Inhibition of PC-3 Human Androgen-independent Prostate Cancer and Its Metastases by Cytotoxic Somatostatin Analogue AN-238
Cancer Res.,
April 1, 1999;
59(8):
1947 - 1953.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Colao, P. Marzullo, D. Ferone, S. Spiezia, G. Cerbone, V. Marinò, A. Di Sarno, B. Merola, and G. Lombardi
Prostatic Hyperplasia: An Unknown Feature of Acromegaly
J. Clin. Endocrinol. Metab.,
March 1, 1998;
83(3):
775 - 779.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
J. C. Reubi, J.-C. Schaer, S. Wenger, C. Hoeger, J. Erchegyi, B. Waser, and J. Rivier
SST3-selective potent peptidic somatostatin receptor antagonists
PNAS,
December 5, 2000;
97(25):
13973 - 13978.
[Abstract]
[Full Text]
[PDF]
|
|
|
Top
Abstract
Introduction
