help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sinisi, A. A.
Right arrow Articles by Pasquali, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sinisi, A. A.
Right arrow Articles by Pasquali, D.
The Journal of Clinical Endocrinology & Metabolism Vol. 82, No. 8 2566-2569
Copyright © 1997 by The Endocrine Society


Endocrinological Oncology

Different Expression Patterns of Somatostatin Receptor Subtypes in Cultured Epithelial Cells from Human Normal Prostate and Prostate Cancer1

Antonio A. Sinisi, Antonio Bellastella, Domenico Prezioso, Maria R. Nicchio, Tullio Lotti, Marco Salvatore and Daniela Pasquali

Istituto di Endocrinologia (A.A.S., A.B., Da.P., M.R.N.), Facoltà di Medicina, Seconda Università di Napoli; and Istituto di Urologia (Do.P., T.L.) and Dipartimento di Medicina Nucleare (M.S.), Università Federico II, 80131 Napoli, Italy

Address all correspondence and requests for reprints to: Antonio Bellastella, M.D., Istituto di Endocrinologia, Seconda Università di Napoli, Via Pansini 5, 80131, Napoli, Italy.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The transcripts of five SRIH receptor subtypes (SSTR1, SSTR2, SSTR3, SSTR4, and SSTR5) were investigated by RT-PCR in epithelial cells (EC) and stromal cells (SC) from primary cultures of five normal human prostates and six prostate cancers. Primary cultures of prostate EC were established in serum-free keratynocyte medium with 5% FCS, epidermal growth factor, and bovine pituitary extract; SC were cultured in MEM with 10% FCS. Total RNA was extracted from EC and SC using a modified guanidine thiocyanate method. RT-PCR was performed after deoxyribonuclease treatment, using SSTR1-, SSTR2-, SSTR3-, SSTR4-, and SSTR5-specific primers and adding glyceraldehyde-3-phosphate dehydrogenase-specific primers as internal control. A PCR product of the expected size of 334 bp, corresponding to SSTR1, was expressed only in EC from prostate cancer, whereas the expected 461-bp product of SSTR2 was found only in EC from normal prostate. SSTR3 messenger RNA was undetectable in normal and cancer EC, whereas SSTR4 and SSTR5 were present in both cell types. SSTR1, SSTR2, SSTR3, SSTR4, and SSTR5 messenger RNAs were not expressed in SC from both normal and cancer prostates. The RT-PCR method clearly demonstrated SSTRs’ expression in the human prostate EC in vitro with differences between normal and tumoral samples. Our results may explain the ineffectiveness of some SSTR2 selective SRIH analogues in the treatment of prostate cancer and suggest that the absence of SSTR2 could represent a growth advantage in prostate cancer.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A ROLE for SRIH in the control of prostate growth or function has been evidenced, even if its mechanism is still under discussion (1, 2, 3, 4). A direct effect of SRIH caused by the presence of specific receptors has been demonstrated in the Dunning rat tumor (5). In humans, the presence of SRIH receptors (SSTRs) in normal prostate and in prostate cancer, investigated using SRIH analogue binding assay, gave contradictory results (6, 7, 8). Recently, five SSTR genes have been cloned and partially characterized (9, 10, 11, 12, 13, 14) that codify for SSTR subtypes and are variably expressed in brain, pituitary, and several endocrine and nonendocrine peripheral tissues (13, 14). The presence of messenger RNA (mRNA) for SSTR1 in prostate cancer and of mRNA for SSTR2 subtype in normal prostate tissues, with localization of binding in the smooth muscles surrounding the gland, has been demonstrated using in situ hybridization technique together with radioligand assay (15). The aim of our study was to evaluate the expression of SSTR1–5 gene subtypes by a highly sensitive method of analysis (RT-PCR) in an isolated cell system represented by epithelial cells (EC) and stromal cells (SC) from primary cultures of normal human prostate and prostate cancer.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell cultures

Five normal human prostate tissues were collected from patients (53–72 yr old) who had undergone radical cistectomy for bladder cancer. Prostate cancer tissues were obtained from six patients (54–70 yr old) who had undergone radical prostatectomy for previously untreated carcinoma of the prostate. After prostatectomy, a wedge-shaped specimen of the fresh prostate was cut. A sample of the tissue was submitted for pathological examination to confirm the prostate origin, the diagnosis, and the absence of other diseases. All tumor specimens were moderately differentiated adenocarcinomas: four had Gleason grades between 2–3, the others between 3–3 and 3–4, respectively; the epithelial/stroma proportion did not vary between five cancer and control prostate tissues; only one cancer specimen with Gleason score 7 had evidence of stroma invasiveness. Only specimens containing 100% normal or cancer prostate cells were used to establish primary cultures, according to a previously described method (16). Prostate EC and SC were separated by centrifugation of minced and collagenase (Collagenase IV, Gibco-BRL, Milan, Italy, 10 mg/mL) digested tissues. The EC were plated on serum-free keratinocyte medium (Gibco-BRL) supplemented with bovine pituitary extract (10 mg/mL), epidermal growth factor (10 ng/mL), cholera toxin (10 ng/mL), 5% FCS, and antibiotics (fungizon and penicillin-streptomycin). SC were cultured on MEM supplemented with 10% FCS and antibiotics. At confluence, cultures were passaged after trypsin treatment. Cell culture purity was assessed by immunocytochemical staining with monoclonal antibodies specific for cytokeratin (Boehringer, Mannheim, Germany) as a marker for EC and for vimentin (Boehringer) for SC. At first passage, the purity of the EC and SC cultures was near 95% and 100%, respectively.

RNA isolation

RNA was isolated from the cultures at first passage (for EC) or at second/third passage (for SC). Total RNA was recovered with the use of RNAZOL B kit (Cinna/Biotecx Laboratories, Houston, TX). Residual DNA was removed by ribonuclease-free deoxyribonuclease (DNase) I treatment (Promega, Florence, Italy).

RT-PCR

RNAs were reversely transcribed using 5 µg of total RNA in the presence of RT (Superscript, BRL, 200 U) at 37 C for 1.5 h, according to the protocol of the manufacturer. The reaction was stopped by incubation at 95 C for 5 min. To obtain negative control for the amplification reactions, we carried out an RNA transcription without addition of RT. Complementary DNA (600 ng), obtained by reverse transcription of RNAs, was amplified in the total vol of 50 µL Tris HCl (10 mmol), 1.5 mmol MgCl2, and 50 mmol KCl (pH 8.3), 100 ng of primers, deoxynucleotides triphosphate (0.2 mmol), and 2.5 U Taq DNA polymerase (Boehringer). The reaction was carried out in a DNA thermal cycler (Perkin-Elmer/Cetus, Milan, Italy). PCR was started by a 3-min denaturation at 95 C, followed by 45 cycles of 1-min annealing at 60 C, 2-min extension at 72 C, and 30 sec denaturation at 95 C. The PCR products were analyzed by electrophoresis on 1.2% or 1.5% agarose gel. We used 5'-3'end oligonucleotides for SSTR1, SSTR2, SSTR3, SSTR4, and SSTR5 as described (17, 18). In each PCR reaction, 100 ng of primers of GAPDH, as internal control. For GAPDH, primer sequences from the published DNA sequence of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene were added (19): 5' GACCCCTTCATTGACCTCAACTACATG3' (sense); 5' GTCCACCACCCTGTTGCTGTAGCC3' (antisense). The identity of PCR products was confirmed by comparing the size of the product with the size expected from the gene sequence. SSTR1 and SSTR2 PCR products were further confirmed by restriction analysis. Ten microliters of SSTR1 and SSTR2 PCR products were digested using APA I and PVU II (Promega), respectively, at 37 C for 2 h, and the digested products with the controls were separated on 2% agarose gel. Moreover SSTR1 and SSTR2 amplimers were subjected to direct sequencing (Sequenase, Amersham, Milan, Italy).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We found that a PCR product of the expected size of 334 bp, corresponding to SSTR1, was expressed only in EC from prostate cancers (Fig. 1Go), whereas the expected 461-bp product of SSTR2 was found in EC from normal prostates (Fig. 2Go). SSTR3 mRNA was undetectable in normal and cancer EC, whereas SSTR4 (247 bp) and SSTR5 (221 bp) were present in both (see Fig. 4Go and Fig. 5Go). SSTR1 and SSTR2 (Fig. 3Go), SSTR3, SSTR4 mRNAs (Fig. 4Go), and SSTR5 (Fig. 5Go) were not expressed in SC from both normal and cancer prostates. The 876-bp product of GAPDH was detectable in each PCR reaction. The treatment with DNase and the coamplification of the GAPDH gene containing introns excluded genomic DNA contaminations. Moreover, we did not find any products in control amplifications performed in the absence of complementary DNA (Figs. 1Go and 2Go). The identification by restriction analysis of SSTR1 and SSTR2 RT-PCR products is shown in Fig. 6Go.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 1. SSTR1 and GAPDH RT-PCR products, separated on a 1.2% agarose gel, obtained in EC from five normal prostate and six cancer prostate samples. Lanes 2–6 show the absence of SSTR1 (334 bp) in EC from normal prostates; lanes 7–12 show the presence of SSTR1 (334 bp) in EC from prostate cancers. GAPDH (876 bp) is present in all samples. Lane 1, Puc 18 Hinf DNA ladder; lane 14, 100-bp DNA ladder; lane 13, negative control.

 


View larger version (48K):
[in this window]
[in a new window]
 
Figure 2. SSTR2 and GAPDH RT-PCR products, separated on a 1.2% agarose gel, obtained in EC from five normal prostate and six prostate cancer samples. Lanes 2–6 show the presence of SSTR2 (461 bp) in EC from normal prostates; lanes 7–12 show the absence of SSTR2 in EC from prostate cancers. GAPDH (876 bp) is present in all samples. Lane 1, 100-bp DNA ladder; lane 13, negative control.

 


View larger version (34K):
[in this window]
[in a new window]
 
Figure 4. SSTR3, SSTR4, and GAPDH RT-PCR products, separated on a 1.5% agarose gel, obtained in representative cell samples from human normal prostate and prostate cancer. SSTR4 (247 bp) is expressed in EC from normal prostate (lane 3) and from prostate cancer (lane 5); SSTR3 is absent in EC from normal prostate and prostate cancer (lanes 2 and 4, respectively); SSTR3 and SSTR4 were absent in SC from normal prostate (lanes 7 and 8) and prostate cancer (lanes 9 and 10); GAPDH was present in all samples. Lane 1, 100-bp DNA ladder.

 


View larger version (53K):
[in this window]
[in a new window]
 
Figure 5. SSTR5 and GAPDH RT-PCR products, separated on a 1.5% agarose gel, obtained in EC from two normal prostates (lanes 2 and 4) and two prostate cancers (lanes 3 and 5). SSTR5 is absent in SC from normal prostate (lanes 7 and 9) and prostate cancer (lanes 8 and 10); GAPDH was present in all samples. Lanes 1 and 6, 100-bp DNA ladder.

 


View larger version (32K):
[in this window]
[in a new window]
 
Figure 3. RT-PCR for SSTR1, SSTR2, and GAPDH in SC of representative normal prostate and prostate cancer samples. RT-PCR products were separated in 1.2% agarose gel. Lanes 2–5 show the presence of GAPDH (876 bp) and the absence of SSTR1 and SSTR2 in SC from normal prostate (lanes 2 and 3) and prostate cancer (lanes 4 and 5); lanes 6 and 7 are included as positive controls for SSTR1 (lane 6) and SSTR2 (lane 7) amplification.

 


View larger version (108K):
[in this window]
[in a new window]
 
Figure 6. Identification of SSTR1 and SSTR2 by restriction analisys: Lanes 1 and 4, 100-bp DNA ladder; Lanes 2 and 5, SSTR1 and SSTR2; Lanes 3 and 6 show the change in appearance of RT-PCR products of SSTR1 and SSTR2 after digestion with restriction enzymes APAI and PVUII, respectively.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The RT-PCR method clearly demonstrated SSTRs’ expression in the cultured human prostate EC with differences between normal and cancer samples. So far, the presence of SSTRs has been evaluated in human prostate and prostate cancer by binding assay, with contradictory results (6, 7, 8). In fact, either absent or low-affinity SRIH binding has been reported in postmortem prostate homogenates (6, 8); in prostate cancer biopsies, no labeled octreotide binding was observed (6); in prostate cancer homogenates, either absent or high-affinity SRIH-14 binding was reported (6, 7). High-affinity receptors for SRIH have been detected in rat prostate tumor (Dunning R3327) (5, 8). Recently, it has been demonstrated that SSTR comprises a family of structurally related proteins encoded by at least five genes (9, 10, 11, 12, 13, 14). The expression of these genes has been established in some human endocrine tumors (17, 18, 20, 21, 22). Expression of SSTR2 mRNA in six benign prostate tissues and SSTR1 mRNA in eight prostate cancers have been reported by Reubi et al. (15) using in situ hybridization on cryostat sections. By using a combination of in vitro receptor autoradiography with labeled octreotide and SRIH-28 as radioligands and in situ hybridization techniques, these authors localized the SSTRs in the smooth muscles of the stroma of all normal and hyperplastic prostate cryostat sections examined. In this study, by using RT-PCR technique, we show that cultured human prostate EC, but not SC, express SSTRs. Furthermore, we investigated and detected, for the first time, the expression of SSTR4 and SSTR5 in both normal and cancer-cultured epithelial prostate cells. Even if we studied a limited number of samples, the results were univocal and suggested that SSTR mRNAs are present in the hormone-dependent glandular compartment. The apparent discrepancy between our data and the findings of Reubi et al. (15) may be caused by the different methodological approaches used. In our study, the higher sensitivity of RT-PCR analysis may explain the evidence of SSTR transcripts in EC. Moreover, stromal cell primary cultures at second or third passage in serum-containing medium, used by us for RT-PCR, probably were devoid of smooth muscle cells, in which SSTR have been localized previously by in situ hybridization (15). In fact, these culture conditions are unable to maintain smooth muscle cells vs. fibroblasts (23). Thus, our data indicate that cultured stromal fibroblasts, from either normal or prostate cancer, do not express SSTRs, but it cannot be excluded that other SC, as smooth muscle cells, contain SSTRs in vivo. In line with the findings of Reubi et al. (15), we demonstrate a significant difference in regulation of SSTR subtypes between normal and cancer cells. In our study, normal prostate EC express SSTR2, SSTR4, and SSTR5, whereas cancer EC express SSTR1, SSTR4, and SSTR5 subtypes. The different expression patterns of the five SSTR genes investigated by us under identical experimental conditions exclude that our RT-PCR results might be a consequence of ectopic transcription. The pretreatment of RNAs with DNase, the absence of PCR products when RNA preparation was directly amplified, and the coamplification of GAPDH in each PCR reaction indicate that the products detected were not caused by the amplification of genomic DNA, because SSTR genes are intronless. Thereafter, our data confirm that RT-PCR is a reliable and specific technique in detecting the expression of SSTR genes in tissues and cells, as suggested by other authors (17, 18, 21).

SRIH analogues have been shown to inhibit the growth of transplanted Dunning rat prostate tumors (2, 3). Regression of the prostate epithelium and proliferation of connective tissue have been observed by adding SRIH to luteinizing hormone/releasing hormone analogues in the treatment of prostate cancer (3). It has been suggested that these effects may result from a direct action at glandular level, or from an indirect action on local growth factors or on GH and PRL circulating levels (4). Our findings suggest that SRIH may act as hormone on prostate EC also, even if normal and prostate cancer EC display different SSTR gene expression and may be target for SRIH analogues with different receptor affinity. Exact functions mediated by different SSTR subtypes is not yet clearly established, but several findings suggest that SSTR1 and SSTR2 subtypes may be responsible for the antiproliferative effects of SRIH (13, 14). Thus, absence of SSTR2 expression on cancer cells could represent a condition of growth advantage, as suggested in other human cancer types (22). Moreover, our data may explain the lack of results in the treatment of prostate cancer with some SRIH analogues (1, 24, 25) with high affinity for SSTR2 subtype, and suggest the need to look for new analogues with high affinity for SSTR1.


    Acknowledgments
 
The authors thank Drs. Ch. Sultan and C. Boudon (INSERM U439, Montpellier, France) for their help and advice in setting up primary cultures of prostate cells.


    Footnotes
 
1 This research was supported by grants from AIRC (AIRC 1994) and from CNR (AI95.0020) to A. A. Sinisi. Back

Received January 13, 1997.

Revised March 13, 1997.

Accepted April 30, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Schally AV, Redding TW. 1987 Somatostatin analogs as adjuncts to agonists of luteinizing hormone-releasing hormone in the treatment of experimental prostate cancer. Proc Natl Acad Sci USA. 84:7275–7279.[Abstract/Free Full Text]
  2. Siegel RA, Tolcsvai L, Rudin M. 1988 Partial inhibition of the growth of transplanted Dunning rat prostate tumors with the long-acting somatostatin analogue sandostatin (SMS 201–995). Cancer Res. 48:4651–4655.[Abstract/Free Full Text]
  3. Zalatnai A, Paz-Bouza JI, Redding TW, Schally AV. 1988 Histologic changes in the rat prostate cancer model after treatment with somatostatin analogs and D-Trp-6-LH-RH. Prostate. 12:85–98.[Medline]
  4. Manni A, Boucher AE, Demers LM, et al. 1990 Somatostatin analogues in the treatment of breast and prostate cancer. J Steroid Biochem Mol Biol. 37:1083–1087.[CrossRef][Medline]
  5. Kadar T, Redding TW, Den-David M, Schally AV. 1988 Receptors for prolactin, somatostatin, and luteinizing hormone releasing hormone in experimental prostate cancer after treatment with analogs of luteinizing hormone releasing hormone and somatostatin. Proc Natl Acad Sci USA. 85:890–894.[Abstract/Free Full Text]
  6. Fekete M, Redding TW, Comaru-Schally AM, et al. 1989 Receptors for luteinizing hormone-releasing hormone, somatostatin, prolactin and epidermal growth factor in rat and human prostate cancer and in benign prostate hyperplasia. Prostate. 14:191–208.[Medline]
  7. Reubi JC, Maurer R, von Werder K, Torhost J, Klijn JGM, Lamberts SWJ. 1987 Somatostatin receptors in human endocrine tumors. Cancer Res. 47:551–558.[Abstract/Free Full Text]
  8. Srkalovic G, Cai RZ, Schally AV. 1990 Evaluation of receptors for somatostatin in various tumors using different analogs. J Clin Endocrinol Metab. 70:661–669.[Abstract/Free Full Text]
  9. Yamada Y, Post SR, Wang K, Tager HS, Bell GI, Seino S. 1992 Cloning and functional characterization of a family of human and mouse somatostatin receptors expressed in brain, gastrointestinal tract, and kidney. Proc Natl Acad Sci USA. 89:251–255.[Abstract/Free Full Text]
  10. Yasuda K, Rens-Domiano S, Breder CD, et al. 1992 Cloning of a novel somatostatin receptor, SSTR3, that is coupled to adenylate cyclase. J Biol Chem. 267:20422–20428.[Abstract/Free Full Text]
  11. Xu Y, Song J, Bruno JF, Berelowitz M. 1993 Molecular cloning and sequencing of human somatostatin receptor hSSTR4. Biochem Biophys Res Commun. 193:648–652.[CrossRef][Medline]
  12. O’Carroll A-M, Raynor K, Lolait SJ, Reisine T. 1994 Characterization of cloned human somatostatin receptor SSTR5. Mol Pharmacol. 46:291–298.[Abstract]
  13. Reisine T, Bell GI. 1995 Molecular biology of somatostatin receptors. Endocr Rev. 16:427–442.[Abstract/Free Full Text]
  14. Lewin MJM, Le Romancer M. 1996 Somatostatin receptors. In: Scarpignato C, ed. Octreotide: from basic science to clinical medicine. Basel: Karger; 23–34.
  15. Reubi JC, Waser B, Schaer J-C, Markwalder R. 1995 Somatostatin receptors in human prostate and prostate cancer. J Clin Endocrinol Metab. 80:2806–2814.[Abstract]
  16. Boudon C, Rodier G, Lechevallier E, Mottet N, Barenton B, Sultan Ch. 1996 Secretion of insulin-like growth factors and their binding proteins by human normal and hyperplastic prostatic cells in primary culture. J Clin Endocrinol Metab. 81:612–617.[Abstract]
  17. Vikic-Topic S, Raisch KP, Kvols LK, Vuk-Pavlovic S. 1995 Expression of somatostatin receptor subtypes in breast carcinoma, carcinoid tumor, and renal cell carcinoma. J Clin Endocrinol Metab. 80:2974–2979.[Abstract/Free Full Text]
  18. Kubota A, Yamada Y, Kagimoto S, et al. 1994 Identification of somatostatin receptor subtypes and an implication for the efficacy of somatostatin analogue SMS 201–995 in treatment of human endocrine tumors. J Clin Invest. 93:1321–1325.
  19. Tso JY, Sun X-H, Kao T, Reece KS, Wu R. 1985 Isolation and characterization of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNAs: genomic complexity and molecular evolution of the gene. Nucleic Acids Res. 13:2485–2502.[Abstract/Free Full Text]
  20. Reubi JC, Schaer JC, Waser B, Mengod G. 1994 Expression and localization of somatostatin receptor SSTR1, SSTR2, and SSTR3 messenger RNAs in primary human tumors using in situ hybridization. Cancer Res. 54:3455–3459.[Abstract/Free Full Text]
  21. Eden PA, Taylor JE. 1993 Somatostatin receptor subtype gene expression in human and rodent tumors. Life Sci. 53:85–90.[CrossRef][Medline]
  22. Buscail L, Saint-Laurent N, Chastre E, et al. 1996 Loss of SSTR2 somatostatin receptor gene expression in human pancreatic and colorectal cancer. Cancer Res. 56:1823–1827.[Abstract/Free Full Text]
  23. Sato JD, Hayashi I, Hayashi J, et al. 1994 Specific cell types and their requirements. In: Davis JM, ed. Basic cell culture. Oxford/New York: Oxford University Press; 181–222.
  24. Parmar H, Charlton CD, Phillips R, et al. 1992 Therapeutic response to somatostatin analogue, BIM 23014, in metastatic prostatic cancer. Clin Exp Metastasis. 13:3–11.
  25. Logothetis CJ, Hossan EA, Smith TL. 1994 SMS 201–995 in the treatment of refractory prostatic carcinoma. Anticancer Res. 14:2731–2734.[Medline]



This article has been cited by other articles:


Home page
J Mol EndocrinolHome page
D. Pasquali, V. Rossi, G. Conzo, G. Pannone, P. Bufo, A. De Bellis, A. Renzullo, G. Bellastella, A. Colao, G. Vallone, et al.
Effects of somatostatin analog SOM230 on cell proliferation, apoptosis, and catecholamine levels in cultured pheochromocytoma cells
J. Mol. Endocrinol., June 1, 2008; 40(6): 263 - 271.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
D M Peehl
Primary cell cultures as models of prostate cancer development
Endocr. Relat. Cancer, March 1, 2005; 12(1): 19 - 47.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
J. C. Reubi
Peptide Receptors as Molecular Targets for Cancer Diagnosis and Therapy
Endocr. Rev., August 1, 2003; 24(4): 389 - 427.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. Pasquali, A. Notaro, G. Bonavolonta', P. Vassallo, A. Bellastella, and A. A. Sinisi
Somatostatin Receptor Genes Are Expressed in Lymphocytes from Retroorbital Tissues in Graves' Disease
J. Clin. Endocrinol. Metab., November 1, 2002; 87(11): 5125 - 5129.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. D. Zapata, R. M. Ropero, A. M. Valencia, L. Buscail, J. I. Lopez, R. M. Martin-Orozco, J. C. Prieto, J. Angulo, C. Susini, P. Lopez-Ruiz, et al.
Autocrine Regulation of Human Prostate Carcinoma Cell Proliferation by Somatostatin through the Modulation of the SH2 Domain Containing Protein Tyrosine Phosphatase (SHP)-1
J. Clin. Endocrinol. Metab., February 1, 2002; 87(2): 915 - 926.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. Szepeshazi, A. V. Schally, G. Halmos, B. Sun, F. Hebert, B. Csernus, and A. Nagy
Targeting of Cytotoxic Somatostatin Analog AN-238 to Somatostatin Receptor Subtypes 5 and/or 3 in Experimental Pancreatic Cancers
Clin. Cancer Res., September 1, 2001; 7(9): 2854 - 2861.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. C. Reubi, J.-C. Schaer, S. Wenger, C. Hoeger, J. Erchegyi, B. Waser, and J. Rivier
SST3-selective potent peptidic somatostatin receptor antagonists
PNAS, November 22, 2000; (2000) 250483897.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Colao, P. Marzullo, S. Spiezia, A. Giaccio, D. Ferone, G. Cerbone, A. Di Sarno, and G. Lombardi
Effect of Two Years of Growth Hormone and Insulin-Like Growth Factor-I Suppression on Prostate Diseases in Acromegalic Patients
J. Clin. Endocrinol. Metab., October 1, 2000; 85(10): 3754 - 3761.
[Abstract] [Full Text]


Home page
CarcinogenesisHome page
N. Baou, M. Bouras, J.-P. Droz, M. Benahmed, and S. Krantic
Evidence for a selective loss of somatostatin receptor subtype expression in male germ cell tumors of seminoma type
Carcinogenesis, April 1, 2000; 21(4): 805 - 810.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Plonowski, A. V. Schally, A. Nagy, B. Sun, and K. Szepeshazi
Inhibition of PC-3 Human Androgen-independent Prostate Cancer and Its Metastases by Cytotoxic Somatostatin Analogue AN-238
Cancer Res., April 1, 1999; 59(8): 1947 - 1953.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Colao, P. Marzullo, D. Ferone, S. Spiezia, G. Cerbone, V. Marino, A. Di Sarno, B. Merola, and G. Lombardi
Prostatic Hyperplasia: An Unknown Feature of Acromegaly
J. Clin. Endocrinol. Metab., March 1, 1998; 83(3): 775 - 779.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. C. Reubi, J.-C. Schaer, S. Wenger, C. Hoeger, J. Erchegyi, B. Waser, and J. Rivier
SST3-selective potent peptidic somatostatin receptor antagonists
PNAS, December 5, 2000; 97(25): 13973 - 13978.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sinisi, A. A.
Right arrow Articles by Pasquali, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sinisi, A. A.
Right arrow Articles by Pasquali, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals