| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Reproductive Endocrinology |
Unit of Hormonal and Reproduction Research, INSERM U-135, and Laboratory of Hormonology, and Molecular Biology, Bicetre Hospital (M.M., G.M., S.P., I.B., H.L., A.J., E.M.), 94275 Le Kremlin Bicetre; Pediatric Endocrinology Service, Saint Vincent de Paul Hospital (C.B., P.B.), 75674 Paris;, and Pediatric Endocrinology Service, Necker Hospital for Sick Children (R.R.), 75743 Paris, France
Address all correspondence and requests for reprints to: Dr. M. Misrahi, INSERM U-135, Hôpital de Bicêtre, 3ème niveau, 78 rue du Général Leclerc, 94275 Le Kremlin Bicêtre, France.
 |
Abstract |
|---|
 Top Abstract IntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
The LH/CG receptor belongs to a particular subgroup of G protein-coupled receptors that also includes the FSH and TSH receptors (reviews in Refs. 4–7). They contain a seven-transmembrane domain characteristic of G protein-coupled receptors. These receptors also display a large extracellular domain that is involved in high affinity hormone binding.
The cloning of the complementary DNAs (cDNAs) (8, 9, 10, 11, 12, 13, 14) and the genes (15, 16, 17) corresponding to these receptors has opened the field to the study of genetic alterations of these receptors. Two different types of receptor dysfunctions have been described. Germ-line activating mutations of the LH receptor gene were found in precocious puberty in boys (18, 19, 20, 21). Loss of function mutations of the LH receptor have been reported recently in familial cases of male pseudohermaphroditism (22, 23, 24, 25) along with primary amenorrhea in women (24). The initial reports described XY patients with complete feminization who underwent investigations for primary amenorhea and who were found to have Leydig cell agenesis or hypoplasia (22, 23). Loss of function mutations of the LH receptor were also found in a boy with isolated micropenis (24) and an infant presenting with micropenis associated with hypospadias (25).
In the past, various degrees of male pseudohermaphroditism had been attributed to Leydig cell hypoplasia or agenesis and gonadotropin unresponsiveness (26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37). The lack of molecular knowledge of the LH receptor and of adequate specific antibodies has prevented precise study and classification of these disorders.
We describe here the case of an XY infant who was sexually ambiguous at birth, with hypoplastic phallus and hypospadias. Classical histological studies of the testes revealed an apparent absence of Leydig cells. However, immunocytochemical studies of the gonads with anti-LH receptor and anti-P450c17 antibodies detected cells with Leydig cell characteristics.
All missense mutations described to date were found in the transmembrane domain of the receptor, which corresponds to an intron-less region of the gene. The recent cloning of the entire human LH receptor gene (16) allowed us to sequence the 11 exons of the patient’s gene. Indeed, a homozygous mutation yielding a Cys131Arg substitution in the extracellular domain of the receptor was detected in the fifth exon. This mutation markedly impaired hormone binding, whereas very limited adenylate cyclase stimulation could be obtained at high hCG concentrations.
The immunocytochemical method used in the present work will be useful to study other cases of possible Leydig cell hypoplasia or agenesis. This will eventually allow the determination of a correlation between receptor molecular defects and the severity of the alterations in Leydig cell development and differentiation.
|
Subjects and Methods |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Patient
The patient was born at term (weight, 2680 g; height, 48
cm; head circumference, 33 cm). His phallus was 5 mm long, with the
urethral meatus at its base (Fig. 1
). Two small gonads
were found inguinally. The karyotype was XY. The cystourethrogram
revealed a small utriculovaginal pouch. At 11 days of age, basal serum
testosterone was 0.05 ng/mL before and after hCG stimulation. The serum
LH response to LH-releasing hormone (LHRH) ranged from less than 0.5 to
2.5 mIU/mL (normal, 0.3–7), and the FSH response ranged from less than
0.5 to 1.8 mIU/mL (normal, 0.3–4). The serum level of anti-Mullerian
hormone was 89 ng/mL (normal, 43 \ 14 ng/mL). Serum
concentrations of 17-hydroxyprogesterone (0.3 ng/mL),
4-androstenedione (<0.05 ng/mL), dehydroepiandrosterone
(0.04 ng/mL), and estradiol (15 pg/mL) were normal. The serum
dihydrotestosterone level was less than 0.05 ng/mL. Female gender was
assigned.
|
4-androstenedione (0.1 ng/mL) levels were normal and did
not increase in response to hCG. At 3 months of age, the patient had
recurrent seizures and was treated with Gardenal and later with
Depakine.
At 12 months of age, the child was rehospitalized for castration. The
serum testosterone level was 0.09 ng/mL. He was microcephalic (41 cm;
-4 SD) and had major psychomotor delay, with axial
hypotonia and peripheral hypertonia. During his stay, he presented
severe repeated seizures. Nuclear magnetic resonance imaging revealed a
major symmetrical atrophia of the brain and cerebellum, with
generalized pachygyria. These features suggested defective antenatal
central nervous system development. Hemoglobin was 9.1 g/dL, with
anisocytosis and anisochromia. Because of the ambiguous genitalia,
major psychomotor delay, and anemia in an XY patient, a diagnosis of
X-linked mental retardation with 
thalassemia syndrome (38) was
first considered, but the absence of -thalassemia ruled it out.
Castration was performed after hCG administration (six doses of 1500 U)
starting 15 days and ending 2 days before surgery. Two testes were
found with normal epididymis and vas deferens.
Antibodies
Monoclonal antibody LHR 29 raised against the human LH receptor (39) (LH receptor amino acids 75–406 fused to ubiquitin produced in Escherichia coli) was used. The specificity of the antibody had been verified by its reaction with receptor-ß-galactosidase fusion protein and its ability to immunoprecipitate and immunopurify [125I]hCG-receptor complexes prepared from cells transfected with a LH receptor expression vector. This antibody was shown to immunostain cells transfected with an expression vector encoding the LH receptor, but not mock-transfected cells.
An antibody raised in rabbits against 17–20 lyase (P450c17; a gift from Dr. S. Takemori), which was specific for androgen-producing cells, was also employed to identify testicular interstitial Leydig cells (40).
Conventional microscopy
Testicular tissue was formol fixed and paraffin embedded, then cut at 3 µm thickness and stained with hematoxylin-eosin, periodic acid-Schiff, and Masson’s trichrome stains.
Immunohistochemical study of the gonad
Six-micron thick serial frozen sections of testicular tissue were air-dried for 30 min at room temperature and fixed in -20 C acetone for 5 min. The sections were then processed for immunohistochemistry as described previously (39). The monoclonal antibody LHR 29 was used at a concentration of 10 µg/mL, and the anti-P450c17 antibody (41) was diluted 1:10,000. Aminoethylcarbazole (Sigma Chemical Co., St. Louis, MO) was used as a chromogen. The sections were lightly counterstained with Meyer’s hematoxylin. Replacement of the specific primary monoclonal antibody with preimmune mouse Igs (Sigma Chemical Co.) or with another unrelated monoclonal antibody (IDA 10) (42) of the same subclass, used at the same concentrations, resulted in the absence of staining. The same result was obtained when the polyclonal anti-P450c17 antibody was replaced by preimmune rabbit serum at the same dilution.
DNA sequencing
Genomic DNA was isolated from peripheral blood samples of the patient, the parents, and the siblings. The DNA was used as a template for PCR amplification of the 11 exons of the human LH receptor gene as previously described (16) with the following modifications. The annealing temperature for PCR amplification of exons 3–10 and for primers GhLHR 21 and 22 (16) was 56 C. Primer GhLHR 17 was changed to AATAAAAAGCATTTCTCCCCTTT. Direct sequencing of the PCR products was performed using the Taq dideoxyterminator cycle sequencing kit (Applied Biosystems, Foster City, CA).
Construction of expression vectors encoding the control and mutated LH receptor
The wild-type human LH receptor expression vector (pSG5-hLHR) was constructed by cloning the human LH receptor cDNA (nucleotides -3 to 2374 relative to the translation start site) into the EcoRI site of pSG5 expression vector. The Cys131Arg substitution was engineered in pSG5-hLHR. Two primers were used, primer A (AAATACTTGAGCATCCGTAACACAGG-CATC) and the reverse corresponding primer B. A HindIII-XmnI fragment of 360 bp containing this mutation was constructed in two pieces. The first fragment was obtained by PCR using oligonucleotide B and a 5'-CGACTATCACTTGCCTACCTC-CC primer C corresponding to positions 163–185 of the human LH receptor cDNA-coding sequence. The second fragment was obtained using oligonucleotides A and a 3'-primer D (CATCCCTTGAAAAGCATTTCCTGG) corresponding to positions 499–522 of the human LH receptor cDNA coding sequence. After digestion with HindIII and XmnI, the purified fragment was ligated to the purified PSG5-hLHR vector partially digested with XmnI and HindIII. The construct was verified by double stranded sequencing.
Study of hCG binding to wild-type and mutated receptors
COS-7 cells were transfected as previously described (8). Forty-eight hours later, intact cells were incubated for 3 h at 37 C with [125I]hCG (2 x 105 cpm) and increasing concentrations of unlabeled hCG as previously described (8, 43). Nonspecific binding was determined (and subtracted from total binding) in samples containing an excess (1 µg/mL) of unlabeled hCG. All experiments were performed three times in duplicate. In all experiments, the transfection efficiency was verified by cotransfecting pRSV-ß-galactosidase (RSV = Rous sarcoma virus) and measuring ß-galactosidase activity in the cells.
cAMP assays
cAMP assays were performed as previously described (8) after a 2-h incubation of transfected cells at 37 C with variable amounts of hCG.
|
Results |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Conventional histological examination of the testes after
hematoxylin-eosin staining revealed a testicular structure with a thick
albuginea and the presence of normal seminiferous tubules grouped in
lobules. The tubules lacked a central lumen and were composed of
numerous Sertoli cells and rare spermatogonia. Some fibroblastic cells
were seen in the interstitium. No cells were observed that displayed
the characteristics of Leydig cells, i.e. a polygonal or
round shape, round nuclei, and abundant cytoplasm including lipid
droplets (Fig. 2A).
|
) and with the anti-P450c17 antibodies (Fig. 2D). The
number of LH receptor-expressing cells and that of P450c17-expressing
cells counted at high magnification on contiguous sections were
equivalent. More cells were labeled by both antibodies at the periphery
of the organs, near the capsule, than in the central portions. Thus,
the Leydig cells or the Leydig cell precursors observed in the
interstitium could only be distinguished from the other cells by
immunocytochemistry.
For obvious ethical reasons we could not compare this pattern with that
of normal testes taken from a boy of the same age. However, we show for
comparison immunostaining for P450c17 of the hCG-primed testes of a
1-yr-old boy with a defect of 17ß-hydroxysteroid dehydrogenase. In
the latter case the interstitium was filled with Leydig cells (Fig. 2D).
Sequencing of the LH receptor gene
Sequencing of the complete human LH/CG receptor gene in the
patient revealed a T
C homozygous substitution in the fifth exon of
the gene. This mutation yielded a Cys131Arg substitution in
the extracellular domain of the receptor. Both parents as well as two
phenotypically normal sisters were heterozygous for this mutation. A
brother with normal sexual development was homozygous for the wild-type
sequence (Fig. 3). Another homozygous GA transversion
yielding a Ser312Asn substitution was found in the patient.
This substitution is located in the seventh exon of the gene at the end
of the extracellular domain of the receptor. However, asparagine is
found in the corresponding position of the porcine LH receptor (8), and
thus, this substitution probably represents an allelic variation.
|
The Cys131Arg mutation was engineered in vitro in an expression vector. The wild-type and mutant LH receptors were transiently transfected in COS-7 cells.
Cells were incubated with [125I]hCG and increasing
concentrations of unlabeled hormone. Cells transfected with the
wild-type LH receptor cDNA bound labeled hCG with high affinity. In
contrast, very weak hCG binding was found in the cells transfected with
the Cys131Arg LH receptor mutant, about 5% of the
wild-type receptor (Fig. 4). The same result was
obtained in two independent experiments.
|
COS-7 cells were transfected with expression vectors encoding the wild-type or mutated receptors. The cells were incubated with increasing concentrations (1–1000 ng) of hCG, and the resulting cAMP accumulation was measured.
As expected, the biological activity of the mutant receptor, deficient
in hormone binding, was markedly impaired (Fig. 5).
However, at high concentrations of hCG, a limited stimulation of
adenylate cyclase was observed.
|
|
Discussion |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
In the case reported here, the low testosterone levels before and after hCG administration, associated with increased LH response to LHRH and normal serum concentrations of precursor hormones, strongly suggested a selective defect of Leydig cell development and/or function.
After classical histology failed to detect Leydig cells in the hCG-primed testes of the patient, immunocytochemistry with anti-LH receptor and anti-P450c17 antibodies was performed. The latter method revealed the presence of rare Leydig cells in the interstitium of the tubules.
Leydig cell differentiation is a multistep process (reviews in Refs. 1 and 3). Undifferentiated mesenchymal cells initially acquire the steroidogenic machinery by an unknown mechanism. The expression of the LH receptor gene starts simultaneously or even earlier, and seems to be constitutive. Functional LH- or hCG-dependent maturation of the Leydig cells follows, associated with a morphological differentiation and increased steroidogenesis.
In the human, there are three waves of Leydig cells development. At the end of the first year of life, very few Leydig cells with morphological features of undifferentiated precursor cells are present in the testes (review in 1 . The growth and differentiation of these cells after birth are under LH or hCG control. Indeed, treatment with hCG resulted in an effluorescence of Leydig cells in the interstitium of the tubules in an age-matched infant presenting with a testosterone biosynthetic defect.
In our patient, the strong hCG stimulation performed before castration may have allowed some growth and differentiation of Leydig cells. For ethical reasons, we could not obtain a normal gonad as a control. However, this stimulation could not increase serum testosterone secretion. This may be related to the low number of Leydig cells and/or to the absence of a complete functional differentiation of Leydig cells.
Our study indicates the necessity to study the sequence of the entire LH receptor gene-coding region to detect all pertinent mutations. Two homozygous substitutions were found. The Ser312Asn substitution corresponds to an allelic variation. The Cys131Arg substitution detected in the extracellular domain of the receptor dramatically impaired hormone binding in vitro, whereas some stimulation of adenylate cyclase could be observed at high concentrations of hCG. Cysteine 131 may be critical for the establishment of a ligand binding conformation. The role, in hormone binding, of cysteine residues present in the extracellular domain and the extracellular loops of the rat LH receptor has recently been investigated (46). In addition, the mutation of this cysteine may impair the correct folding and membrane targeting of the receptor.
There was no phenotypic expression of the mutation in the heterozygous parents and siblings. This observation further confirms the recessive character of loss of function mutations of the LH receptor.
The first reported phenotype of loss of function mutations of the LH receptor (22, 23, 24, 25) corresponded to complete male pseudohermaphroditism. Homozygous mutations were detected in the sixth transmembrane span (Ala593Pro) (22) or in the third intracellular loop (introducing a stop at codon 554) (24) of the LH receptor. A heterozygous mutation (introducing a stop at codon 545) in the fifth transmembrane span (23) was also detected in another patient who was a compound heterozygote (the normal father had the same mutation). The mutation of the other allele could not be detected because complete sequencing of the LH receptor gene could not be performed. In all of these cases, conventional histology of the gonads showed either the absence of Leydig cells (23, 24) or the presence of a few immature Leydig cells (22).
Two other phenotypes associated with loss of function mutations of the LH receptor were recently described. The first one was a 6-yr-old boy who presented with a small penis (length of the phallus, 1.5 cm; -2 SD). No histological examination of the gonad was performed. A homozygous Ser616Tyr substitution was found in the seventh transmembrane span of the LH receptor. This mutation was found to completely suppress hormone binding and cyclase stimulation (24).
The second case was a 2- to 3-yr-old infant who had a 2-cm long phallus associated with hypospadias. The patient was a compound heterozygote. He had a deletion of exon 8 on one allele of the LH receptor gene together with a Ser616Tyr substitution in the seventh transmembrane span of the receptor. The deletion of exon 8 abolished hormone binding. The substitution of Ser616 was found to impair, but not to abolish, hormone binding and cyclase stimulation (25). This substitution involved, however, the same residue found to be mutated in the case reported by the group of Chrousos (24). Classical histology of the testes revealed the absence of Leydig cells.
Our case is characterized by the diagnosis at birth of ambiguous genitalia with a hypoplastic phallus associated with hypospadias. Partial masculinization of the external genitalia suggests that some production and biological action of testosterone had occurred to fuse the labioscrotal folds during the first trimester of pregnancy (47). This suggestion is consistent with the ability of the mutated receptor to induce some adenylate cyclase activity when stimulated by high concentrations of hCG in vitro. Testosterone production was apparently not sufficient in our patient to allow the normal increase in penis size during the second and third trimesters of pregnancy (48) when the concentrations of maternal and fetal serum hCG decrease (49). Pituitary LH secretion is low and starts only in the 10th and 11th weeks of gestation (1). As cryptorchidism and maldescended testes are often observed in congenital hypopituitarism as a consequence of gonadotropin deficiency (46), it is possible that the alteration of LH receptor function in our patient may have similarly impaired testes migration to the scrotum.
In more than 70% of patients with male pseudohermaphroditism the cause remains unexplained (50). Various phenotypes have been found to be associated with abnormalities of Leydig cell function (26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37). The use of immunocytochemistry should lead to a more precise classification of the different phenotypes. Indeed, study of the expression of the LH receptor and steroidogenic enzymes will allow detection of the presence of Leydig cells. In some cases, it may lead to molecular study of the LH receptor. It may also allow the establishment of a correlation between molecular defects of the receptor and abnormalities of Leydig cell development and differentiation. Finally, immunocytochemical and molecular studies will help to determine whether all cases of Leydig cell hypoplasia or agenesis are due to mutations of LH receptor coding or regulatory regions, or if other, yet unidentified, factors are also involved.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received December 9, 1996.
Revised March 14, 1997.
Accepted March 17, 1997.
|
References |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
-reductase deficiency,
testicular feminization, and related disorders. In: Scriver CR, Beaudet
AL, Sly WS, Valle D, eds. The metabolic and molecular bases of
inherited disease, 7th ed. New York: McGraw-Hill; vol 2:2967–2998.
This article has been cited by other articles:
 |
|
 |
|
  T R. Kumar What have we learned about gonadotropin function from gonadotropin subunit and receptor knockout mice? Reproduction, September 1, 2005; 130(3): 293 - 302. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A Richter-Unruh, E Korsch, O Hiort, P M Holterhus, A P Themmen, and S A Wudy Novel insertion frameshift mutation of the LH receptor gene: problematic clinical distinction of Leydig cell hypoplasia from enzyme defects primarily affecting testosterone biosynthesis Eur. J. Endocrinol., February 1, 2005; 152(2): 255 - 259. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Richter-Unruh, M. Verhoef-Post, S. Malak, J. Homoki, B. P. Hauffa, and A. P. N. Themmen Leydig Cell Hypoplasia: Absent Luteinizing Hormone Receptor Cell Surface Expression Caused by a Novel Homozygous Mutation in the Extracellular Domain J. Clin. Endocrinol. Metab., October 1, 2004; 89(10): 5161 - 5167. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Vasseur, P. Rodien, I. Beau, A. Desroches, C. Gerard, L. de Poncheville, S. Chaplot, F. Savagner, A. Croue, E. Mathieu, et al. A Chorionic Gonadotropin-Sensitive Mutation in the Follicle-Stimulating Hormone Receptor as a Cause of Familial Gestational Spontaneous Ovarian Hyperstimulation Syndrome N. Engl. J. Med., August 21, 2003; 349(8): 753 - 759. [Full Text] [PDF]
|
|
|
|
|
|
S. N. Kalantaridou and G. P. Chrousos Monogenic Disorders of Puberty J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2481 - 2494. [Full Text] [PDF]
|
|
|
|
|
|
J. W. M. Martens, S. Lumbroso, M. Verhoef-Post, V. Georget, A. Richter-Unruh, M. Szarras-Czapnik, T. E. Romer, H. G. Brunner, A. P. N. Themmen, and Ch. Sultan Mutant Luteinizing Hormone Receptors in a Compound Heterozygous Patient with Complete Leydig Cell Hypoplasia: Abnormal Processing Causes Signaling Deficiency J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2506 - 2513. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Ji, C. Lee, Y. Song, P. M. Conn, and T. H. Ji Cis- and Trans-Activation of Hormone Receptors: the LH Receptor Mol. Endocrinol., June 1, 2002; 16(6): 1299 - 1308. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Lee, I. Ji, K. Ryu, Y. Song, P. M. Conn, and T. H. Ji Two Defective Heterozygous Luteinizing Hormone Receptors Can Rescue Hormone Action J. Biol. Chem., May 3, 2002; 277(18): 15795 - 15800. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Ascoli, F. Fanelli, and D. L. Segaloff The Lutropin/Choriogonadotropin Receptor, A 2002 Perspective Endocr. Rev., April 1, 2002; 23(2): 141 - 174. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. M. Lei, S. Mishra, W. Zou, B. Xu, M. Foltz, X. Li, and Ch. V. Rao Targeted Disruption of Luteinizing Hormone/Human Chorionic Gonadotropin Receptor Gene Mol. Endocrinol., January 1, 2001; 15(1): 184 - 200. [Abstract] [Full Text]
|
|
|
|
|
|
A. P. N. Themmen and I. T. Huhtaniemi Mutations of Gonadotropins and Gonadotropin Receptors: Elucidating the Physiology and Pathophysiology of Pituitary-Gonadal Function Endocr. Rev., October 1, 2000; 21(5): 551 - 583. [Abstract] [Full Text]
|
|
|
|
|
|
J. Gromoll, U. Eiholzer, E. Nieschlag, and M. Simoni Male Hypogonadism Caused by Homozygous Deletion of Exon 10 of the Luteinizing Hormone (LH) Receptor: Differential Action of Human Chorionic Gonadotropin and LH J. Clin. Endocrinol. Metab., June 1, 2000; 85(6): 2281 - 2286. [Abstract] [Full Text]
|
|
|
|
|
|
J. C. Zenteno, P. Canto, S. Kofman-Alfaro, and J. P. Mendez Evidence for Genetic Heterogeneity in Male Pseudohermaphroditism due to Leydig Cell Hypoplasia J. Clin. Endocrinol. Metab., October 1, 1999; 84(10): 3803 - 3806. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Bhowmick, P. Narayan, and D. Puett Identification of Ionizable Amino Acid Residues on the Extracellular Domain of the Lutropin Receptor Involved in Ligand Binding Endocrinology, October 1, 1999; 140(10): 4558 - 4563. [Abstract] [Full Text]
|
|
|
|
|
|
J. W. M. Martens, M. Verhoef-Post, N. Abelin, M. Ezabella, S. P. A. Toledo, H. G. Brunner, and A. P. N. Themmen A Homozygous Mutation in the Luteinizing Hormone Receptor Causes Partial Leydig Cell Hypoplasia: Correlation between Receptor Activity and Phenotype Mol. Endocrinol., June 1, 1998; 12(6): 775 - 784. [Abstract] [Full Text]
|
|
|
|
|
|
S. S. Stavrou, Y.-S. Zhu, L.-Q. Cai, M. D. Katz, C. Herrera, M. DeFillo-Ricart, and J. Imperato-McGinley A Novel Mutation of the Human Luteinizing Hormone Receptor in 46XY and 46XX Sisters J. Clin. Endocrinol. Metab., June 1, 1998; 83(6): 2091 - 2098. [Abstract] [Full Text]
|
|
|
|
|
|
A. C. Latronico, Y. Chai, I. J.P. Arnhold, X. Liu, B. B. Mendonca, and D. L. Segaloff A Homozygous Microdeletion in Helix 7 of the Luteinizing Hormone Receptor Associated with Familial Testicular and Ovarian Resistance Is Due to Both Decreased Cell Surface Expression and Impaired Effector Activation by the Cell Surface Receptor Mol. Endocrinol., March 1, 1998; 12(3): 442 - 450. [Abstract] [Full Text]
|
|
|
|
|
|
N. de Roux, J. Young, M. Misrahi, R. Genet, P. Chanson, G. Schaison, and E. Milgrom A Family with Hypogonadotropic Hypogonadism and Mutations in the Gonadotropin-Releasing Hormone Receptor N. Engl. J. Med., November 27, 1997; 337(22): 1597 - 1603. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||
