This Article Abstract Full Text (PDF) Submit a related Letter to the Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ain, K. B. Articles by Venkataraman, G. Search for Related Content PubMed PubMed Citation Articles by Ain, K. B. Articles by Venkataraman, G. Pubmed/NCBI databases Gene GEO Profiles HomoloGene UniGene Medline Plus Health Information Thyroid Cancer

Somatostatin Receptor Subtype Expression in Human Thyroid and Thyroid Carcinoma Cell Lines¹

Thyroid Cancer Research Laboratory, Medical Service, Veterans Affairs Medical Center, Lexington, Kentucky 40511; and the Department of Internal Medicine, University of Kentucky Medical Center, Lexington, Kentucky 40536

Address all correspondence and requests for reprints to: Kenneth B. Ain, M.D., Thyroid Nodule and Oncology Clinical Service, Division of Endocrinology and Molecular Medicine, Department of Internal Medicine, Room MN520, University of Kentucky Medical Center, 800 Rose Street, Lexington, Kentucky 40536-0084.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Somatostatin (SRIH) analogs can suppress the proliferation of human differentiated thyroid carcinoma cell lines that express SRIH receptors (SSTRs) demonstrated by radioligand binding analysis. Five distinct human SSTR subtypes (hSSTR1–5) that bind native SRIH exhibit diverse affinities to a wide range of SRIH analogs. Reverse transcriptase-PCR amplification of ribonucleic acids (RNAs) obtained from normal thyroid tissues and nine human thyroid carcinoma cell lines, grown as monolayer cultures and xenograft tumors in nude mice, were used to discriminate expression of SSTR subtype messenger RNAs (mRNAs). The cell lines were derived from a follicular adenoma (KAK-1), two follicular carcinomas (MRO-87 and WRO-82), two papillary carcinomas (NPA87 and KAT-10), and four anaplastic thyroid carcinomas (DRO-90, ARO-81, KAT-4, and KAT-18). Most thyroid cancer cell line monolayers and xenografts expressed SSTR3 and SSTR5 mRNAs. SSTR1 expression was more varied between monolayers and xenografts, whereas SSTR2 mRNA was only faintly detectable at the most extreme resolution. SSTR4 mRNA was faintly positive in only one anaplastic carcinoma xenograft. Normal thyroid also expressed SSTR3 and SSTR5 mRNAs, with only faint expression of SSTR1 and SSTR2 mRNAs (in one of five and three of five samples, respectively). SSTR mRNA expression was dependent upon in vitro culture conditions, as xenograft SSTR mRNA expression tended to decrease compared to that in each respective monolayer culture. Characterization of SSTR subtype expression in human thyroid carcinomas may permit targeting of specific SRIH analogs to inhibit proliferation of differentiated and anaplastic thyroid carcinomas in patients.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
THYROID EPITHELIAL carcinomas are typically treated by surgical resection, suppression of TSH, and radioiodine ablation. Although this is effective for the majority of patients, aggressive tumors that lack the ability to concentrate iodine are lethal (1). This has prompted us to seek alternative approaches to inhibit thyroid carcinoma proliferation. Somatostatin (SRIH) and its analogs have been shown to inhibit the proliferation of neoplastic tissues in vitro and in vivo (2). Accordingly, we previously demonstrated specific SRIH binding to membranes of thyroid carcinoma cells and tissues. In addition, we showed discordant effects of different SRIH analogs on the growth of four different thyroid carcinoma cell lines, with two analogs producing growth inhibition, stimulation, or no effect in different cell lines (3). As there are five distinct human SRIH receptor subtypes (hSSTR1–5), each with possibly different postreceptor actions (4, 5, 6, 7), further characterization of SSTR phenotypes in thyroid carcinoma cells may elucidate the effects of SRIH analogs.

To determine the expression of SSTR subtypes in normal and malignant human thyroid follicular cells, we isolated ribonucleic acid (RNA) from these cells, obtained complementary deoxyribonucleic acid (cDNA) by reverse transcription, and used PCR amplification to detect specific SSTR messenger RNA (mRNA) transcripts. Expression of SSTR mRNAs in thyroid carcinoma cell lines grown in vitro was compared to that in each cell line grown as xenograft tumors in nude mice to discriminate variations in expression due to culture conditions.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Human thyroid carcinoma cell lines, xenografts, and normal thyroid samples

Five human thyroid epithelial carcinoma cell lines, provided by Dr. Guy J. F. Juillard (Department of Radiation Oncology, University of California-Los Angeles School of Medicine), were derived from a papillary carcinoma (NPA87), two follicular carcinomas [RO 82-W-1, "WRO82" (8), and RO 87-M-1, "MRO87"], and two anaplastic carcinomas (UCLA RO 90-D-1, "DRO90," and ARO81). Additional cell lines, KAK-1 (follicular adenoma) (3, 9), KAT-10 (papillary carcinoma), and KAT-4 and KAT-18 (both anaplastic carcinomas), were grown from cultured samples of thyroid epithelial tumors from fresh surgical pathology specimens obtained in the course of routine surgical care of patients. Sterile tumor samples were minced in RPMI 1640 medium with Dispase (Boehringer Mannheim, Indianapolis, IN), medium was removed by centrifugation and aspiration, and cells were plated in RPMI 1640 medium with 10% FBS (both from Life Technologies, Gaithersburg, MD) in flasks. After two or three passages of growth at 37 C in a humidified atmosphere of 5% (vol/vol) CO₂ in air, with medium changed every 3–6 days, cultures were treated for 4 weeks in medium containing D-valine (10) and cis-4-hydroxy-L-proline (11) to ensure elimination of fibroblasts. Cell lines were screened for mycoplasma by hybridization to a DNA probe (Gen-Probe Mycoplasma Rapid Detection System, Fisher Scientific, Pittsburgh, PA). Normal human thyroid tissues were obtained from fresh surgical samples of normal contralateral lobes of nonmalignant thyroid disease.

Suspensions of 1 x 10⁶ cells in RPMI 1640 medium were injected under the skin of one flank of 7-week-old nude mice (Harlan Sprague-Dawley) for each of seven cell lines: DRO90, ARO81, KAT-4, NPA87, KAT-10, KAK-1, and MRO87. When tumors reached sufficient size, they were removed and processed to extract RNA.

RNA isolation and cDNA synthesis

RNA was isolated from cell monolayers using Tri-Reagent (Molecular Research Center, Cincinnati, OH) according to the manufacturer’s protocol. Tissues from surgical samples or xenograft tumors were homogenized in the same reagent using a Tissumizer (Tekmar, Cincinnati, OH) before RNA isolation. Isolated RNA was dissolved in ribonuclease-free water and treated with ribonuclease-free deoxyribonuclease I (Boehringer Mannheim) for 30 min at 37 C and then at 95 C for 15 min. The RNA concentration was assessed by ultraviolet spectrophotometry. Complementary DNA was made from 0.5-µg RNA samples using the 1st Strand cDNA Synthesis Kit (Clontech, Palo Alto, CA) with random hexamer priming in a total volume of 20 µL. cDNA was stored at -80 C until used.

PCR amplification of SSTRs

Optimal conditions for amplification of each SSTR were determined using the Invitrogen PCR Optimizer Kit (Invitrogen, San Diego, CA) and SSTR plasmid DNA as positive controls. Plasmid DNA for SSTR1–4 was kindly provided by Dr. Graeme I. Bell (University of Chicago, Chicago, IL), and SSTR5 plasmid DNA was provided by Dr. Yogesh C. Patel (McGill University, Montreal, Canada). PCR amplification of cDNA using primers specific for ß-actin (Stratagene, La Jolla, CA), followed by agarose electrophoresis and ethidium bromide staining, provided confirmation of integrity of the cDNA and absence of contaminating genomic DNA, as ß-actin cDNA produced a 641-nucleotide band whereas ß-actin genomic DNA produced an 857-nucleotide band. PCR reactions contained 2.5 mmol/L dNTPs, 0.2 µg TaqStart Antibody (Clontech), 0.25 µg of each primer, 1 U AmpliTaq DNA polymerase (Perkin-Elmer, Norwalk, CT), and 1 µg cDNA. PCR buffers contained 3.5 mmol/L MgCl₂ at pH 9.0 for ß-actin, SSTR3, and SSTR5, whereas SSTR1 PCR buffer contained 2.5 mmol/L MgCl₂ at pH 9.0, SSTR2 and SSTR4 PCR buffers contained 3.5 mmol/L MgCl₂ at pH 9.5, and SSTR4 PCR buffer additionally contained 10% (vol/vol) dimethylsulfoxide (Sigma Chemical Co., St. Louis, MO). An initial denaturation step at 94 C for 5 min was followed by 35, 40, or 45 cycles (in different amplification reactions) of 1 min at 94 C for denaturation, 2 min for annealing, and 30 s at 72 C for extension. Annealing temperatures were 62 C for ß-actin and SSTR1–3, 58 C for SSTR4, and 68 C for SSTR5. A final extension reaction was performed for 10 min at 72 C. Priming sequences were as follows (upstream 5' to 3'/downstream 5' to 3'): SSTR1, CGAAATGCGTCCCAGAACGG/GGTTTACTACCTTGGCCACG; SSTR2, TGGAAGCCACACATGGCTAT/CCATCCACAGTCATGACCAC; SSTR3, CATGGACATGCTTCATCCAT/CATGACCAGGCGGCACATGA; SSTR4, GCATGGTCGCTATCCAGTGCA/GTGGTCGCAGAAGACAGAGTG (12); and SSTR5, AACACGCTGGTCATCTACGTGGT/AGACACTGGTGAACTGGTTGAC (12). The PCR products for hSSTR1–5 were 409, 342, 361, 275, and 211 nucleotides, respectively. PCR products were electrophoresed on 2% agarose gels, stained with ethidium bromide, and photographed with UV illumination.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
SSTR mRNA expression in normal thyroid tissues

Five distinct samples of normal thyroid tissue obtained from surgical specimens from five patients yielded sufficient RNA for generation of cDNA and analysis of SSTR subtype-specific cDNA by PCR. Identical samples were subjected to 35, 40, and 45 PCR amplification cycles in different reactions to provide relative quantification of specific SSTR subtype cDNAs. Ultraviolet illumination of ethidium bromide-stained agarose gels containing electrophoresed reaction products provided subjective discrimination of relative band intensities at the appropriate lane positions. Figure 1 shows the gel for one sample of normal thyroid, amplified for hSSTR subtypes 1–5 at 35, 40, and 45 PCR cycles in sequential lanes. Expression of SSTR2 mRNA was extremely low, with only a very faint band after 45 PCR cycles, whereas SSTR3 and SSTR5 showed the greatest expression. SSTR4 was not expressed, and only 1 thyroid sample revealed SSTR1 expression. As summarized in Table 1, all five samples were positive for SSTR3, 3 of 5 were clearly positive for SSTR5, 3 of 5 were only faintly positive for SSTR2, and 1 of 5 was positive for SSTR1.

View larger version (74K): [in this window] [in a new window]   Figure 1. Ethidium bromide-stained gel of SSTR subtype expression in normal thyroid tissue. PCR products were electrophoresed after amplification of cDNA for 35, 40, and 45 PCR cycles with each primer set in adjoining triplicate lanes: SSTR1 (lanes 3–5), SSTR2 (lanes 7–9)l SSTR3 (lanes 11–13), SSTR4 (lanes 15–17), and SSTR5 (lanes 19–21). Lanes 1 and 22 contain 1-kilobase DNA ladder markers (Life Technologies).

The KAK-1 cell line is derived from a benign follicular thyroid adenoma. Reverse transcriptase-PCR results for these cells, shown in Fig. 2, reveal expression of mRNA for all hSSTR subtypes except SSTR4. The dominant subtypes are SSTR1 and -3, as suggested by greater band intensities at lower numbers of PCR cycles. This pattern of hSSTR subtype expression was similar in monolayers of the two follicular carcinoma cell lines, MRO-87 (Fig. 3) and WRO-82.

View larger version (85K): [in this window] [in a new window]   Figure 2. Ethidium bromide-stained gel of SSTR subtype expression in a benign follicular thyroid adenoma cell line (KAK-1) monolayer. PCR products were electrophoresed after amplification of cDNA for 35, 40, and 45 PCR cycles with each primer set in adjoining triplicate lanes: SSTR1 (lanes 3–5), SSTR2 (lanes 7–9), SSTR3 (lanes 11–13), SSTR4 (lanes 15–17), and SSTR5 (lanes 19–21). Lanes 1 and 22 contain 1-kilobase DNA ladder markers (Life Technologies).

View larger version (79K): [in this window] [in a new window]   Figure 3. Ethidium bromide-stained gel of SSTR subtype expression in a follicular thyroid carcinoma cell line (MRO-87) monolayer. PCR products were electrophoresed after amplification of cDNA for 35, 40, and 45 PCR cycles with each primer set in adjoining triplicate lanes: SSTR1 (lanes 3–5), SSTR2 (lanes 7–9), SSTR3 (lanes 11–13), SSTR4 (lanes 15–17), and SSTR5 (lanes 19–21). Lanes 1 and 22 contain 1-kilobase DNA ladder markers (Life Technologies).

Two papillary carcinoma cell line monolayers, NPA87 and KAT-10 (Fig. 4), maintained similar patterns of hSSTR expression as follicular carcinoma and adenoma cell lines. As all cDNA aliquots were subjected to PCR for ß-actin and produced similar intensity bands upon ethidium bromide staining of electrophoresis gels, it is likely that the reduced intensity of hSSTR bands in these cells represents generally reduced hSSTR mRNA expression compared with the other thyroid carcinoma phenotypes.

View larger version (83K): [in this window] [in a new window]   Figure 4. Ethidium bromide-stained gel of SSTR subtype expression in a papillary thyroid carcinoma cell line (KAT-10) monolayer. PCR products were electrophoresed after amplification of cDNA for 35, 40, and 45 PCR cycles with each primer set in adjoining triplicate lanes: SSTR1 (lanes 3–5), SSTR2 (lanes 7–9), SSTR3 (lanes 11–13), SSTR4 (lanes 15–17), and SSTR5 (lanes 19–21). Lanes 1 and 22 contain 1-kilobase DNA ladder markers (Life Technologies).

Expression of hSSTR mRNAs in anaplastic carcinoma cell line monolayers is variable (Table 1), but follows the general pattern of minimal (if any) mRNA of SSTR2 and SSTR4. DRO-90 hSSTR mRNA expression is typical of this cell type, as shown in Fig. 5. All four cell lines were positive for SSTR1, SSTR3, and SSTR5 in varying amounts, whereas SSTR2 expression was only faint at the highest PCR cycle number in all of them. Few of the cell lines expressed mRNA for SSTR4.

View larger version (71K): [in this window] [in a new window]   Figure 5. Ethidium bromide-stained gel of SSTR subtype expression in an anaplastic thyroid carcinoma cell line (DRO-90) monolayer. PCR products were electrophoresed after amplification of cDNA for 35, 40, and 45 PCR cycles with each primer set in adjoining triplicate lanes: SSTR1 (lanes 3–5), SSTR2 (lanes 7–9), SSTR3 (lanes 11–13), SSTR4 (lanes 15–17), and SSTR5 (lanes 19–21). Lanes 1 and 22 contain 1-kilobase DNA ladder markers (Life Technologies).

Seven of nine cell lines were grown as sc xenograft tumors in nude mice. Table 1 shows their patterns of hSSTR mRNA expression compared to their corresponding monolayer cultures. The follicular adenoma cell line KAK-1 and the follicular carcinoma cell line MRO-87 expressed the same hSSTR subtype mRNAs in similar quantities when grown as monolayers and as xenografts. On the other hand, both papillary carcinoma cell lines as well as the anaplastic carcinoma cell lines (the three cell lines capable of xenograft growth) differed in hSSTR mRNA expression between monolayer and xenograft cultures. The papillary cell lines (NPA87 and KAT-10) as well as ARO-81 (anaplastic carcinoma) no longer expressed SSTR1 mRNA after growth as xenografts. Likewise, SSTR3 mRNA expression evident in monolayer cultures was lost in xenografts of KAT-10 and KAT-4. SSTR5 mRNA seen in DRO-90 monolayers was no longer detectable in xenograft culture. In general, hSSTR mRNA expression in xenografts tended to more closely resemble the pattern seen in normal thyroid tissue than that in their respective monolayer cultures. The only exception was the faint, but definite, SSTR4 expression noted in KAT-4 xenografts, which was not observed in any other thyroid cells.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
These results expand upon our earlier demonstration (3) of specific SRIH binding to membranes of normal thyroid tissues and thyroid carcinoma cell lines as well as disparate proliferative effects of different SRIH analogs on cell lines in monolayer cultures. We have delineated hSSTR subtypes 3 and 5 as the predominant SRIH receptor mRNAs in normal human thyroid tissues. There are no other reports of SSTR subtype expression in thyroids of any species, except for one brief statement of the absence of SSTR5 in thyroid tissue (13), which is contradicted by our findings. Although thyroid tissue RNA is a mixture derived from follicular cells, parafollicular cells, fibroblasts, endothelial cells, and other vascular cells, it appears that the pattern of hSSTR subtype expression found in this study is representative of thyroid follicular cells, as we have shown that the follicular cell-derived carcinoma cell lines have similar expression patterns.

To date, human carcinomas have been reported to express predominantly SSTR2 (14, 15, 16, 17, 18, 19, 20), with limited expression of SSTR1, SSTR3, and SSTR4. SSTR5 expression in human cancers appears unique to thyroid cancer, except for a preliminary report of expression in human breast carcinomas (21). Greenman and Melmed have reported that nonmalignant human pituitary neoplasms express SSTR5 as well as SSTR2 and SSTR3 (12, 22), whereas Panetta and Patel found variable expression of all five SSTRs in similar pituitary adenomas (23). Functional human endocrine tumors examined by Kubota et al. (24) revealed predominantly SSTR1–4 subtypes in human glucagonomas and insulinomas, with pheochromocytomas expressing only SSTR1 and SSTR2. Likewise, Jonas et al. (17) demonstrated SSTR2 expression in malignant carcinoids and gastrinomas, although SSTR4 and -5 expression was not analyzed. Medullary thyroid carcinomas, derived from thyroid parafollicular cells, express SSTR1 and sometimes SSTR3 (SSTR4 and -5 mRNAs were not assayed) (25). The patterns of SSTR subtype expression seen in human thyroid carcinomas from follicular cells appear unique compared to those in other human carcinomas whether of endocrine or nonendocrine origin.

SSTR subtype expression appears to be affected by the cellular environment. In most cases, SSTR subtype expression in thyroid carcinoma cells is less restricted in monolayer culture than when grown in vivo as xenografts. For this reason, it may prove difficult to extrapolate in vitro data from cell monolayers as relevant to clinical disease without confirmatory preclinical studies using xenograft models. In addition, there was a tendency for less differentiated carcinomas to express a greater variety of SSTR subtypes. This observation is encouraging for potential SRIH analog treatment of aggressive dedifferentiated carcinomas that have no alternative effective therapies.

Most recent studies of SRIH receptors, like ours, have relied upon assessments of specific mRNAs to indicate cellular SSTR phenotypes. As Schonbrunn et al. correctly point out, expression of mRNA does not always accurately reflect the level or type of SSTR protein present. In their hands, SSTR1 mRNA expression was clearly evident in AR4–2J pancreatic acinar cells and AtT20 pituitary cells without any functional SSTR1 protein detectable by immunoprecipitation with SSTR1-specific antibody (26, 27). Although we have not applied immunoprecipitation techniques to verify each subtype of SSTR expressed in our thyroid tissues and carcinoma cells, we have previously demonstrated specific [¹²⁵I]Tyr¹¹-SRIH binding to their membranes and growth responses to SRIH analogs, illustrating the presence of functional receptor proteins (3).

The presence of a large and expanding group of SRIH analogs with differing affinities and specificities for the five SSTR subtypes suggests the possibility of targeting antiproliferative therapies with SRIH agents based upon the expression of distinct subtypes of SSTRs. Recent studies suggest that direct antiproliferative responses are mediated by SSTR1, SSTR2, and SSTR5 (6). Although all five receptors are coupled to adenylyl cyclase inhibition (5), current evidence suggests that SSTR-stimulated protein tyrosine phosphatase is more closely related to direct antiproliferative effects (28). This is the mechanism found for SSTR1 and SSTR2 (29, 30); however, SSTR5-mediated growth inhibition appears to work via a phospholipase C/inositol phospholipid/calcium pathway without involvement of a protein phosphatase (31). Of these antiproliferation-coupled receptors, SSTR5 and SSTR1 are the most highly and consistently expressed in thyroid carcinoma and are logical targets for subtype-specific SRIH analogs. Alternatively, SRIH analogs have been observed to cause tumor inhibition by inducing apoptosis (32, 33, 34), although the specific SSTR subtypes responsible for this effect are not known.

Indirect antineoplastic effects of SRIH analogs may be mediated through inhibition of peritumoral angiogenesis. Analysis of tumor-associated vessels suggests predominant expression of SSTR2 (35, 36) and in vitro treatment with octreotide significantly inhibits human endothelial cell cultures (37). In this way, the absence of significant SSTR2 expression in thyroid carcinomas may not rule out the use of SSTR2-specific SRIH analogs for antiproliferative therapy. This mechanism would not be discernible through in vitro studies of thyroid carcinoma cells and may not be observed in xenografts because peritumoral vessels would be of nonhuman origin.

The sparse expression of SSTR2 mRNA in most thyroid carcinoma cells suggests that SSTR2-specific analogs, such as octreotide (38, 39, 40), would have little direct antineoplastic activity. This is supported by negative clinical trials of this agent in five cases of differentiated metastatic thyroid cancer by both Zlock et al. (41) and two cases treated by our group (unpublished results). It is not clear why Tenenbaum et al. were able to detect thyroid carcinoma metastases with [¹¹¹In]penetreotide in patients (42), although it is possible that the scans were detecting peritumoral vessels or tumor-infiltrating lymphocytes. Our previous in vitro study of thyroid carcinoma cell monolayers demonstrated the absence of significant antiproliferative activity of octreotide, although growth promotion was noted in some conditions (3).

This study suggests the need for evaluation of SSTR5-specific SRIH analogs as antineoplastic agents for human thyroid carcinoma. At present, there are no SRIH analogs with specific potency for binding to SSTR1. Although SSTR5-specific analog candidates have been proposed, evaluation is complicated by profound disagreements between investigators relating to species specificity and expression systems in determining analog binding affinities to cell membranes expressing transfected SSTR5 (38, 39). The native precursor, SRIH-28, seems to have greater affinity for SSTR5 than SRIH-14 in some studies (38, 40), but is without any binding advantage in others (39). Likewise, synthetic analogs such as BIM-23268D (40), L-362,855 (BIM-23208D) (13, 39, 40), DC-23–99 (BIM-23052) (43), and BIM-23059 (38) have been proposed as SSTR5-selective agonists in different and sometimes conflicting reports. Ongoing investigations, in vitro and in vivo, should serve to resolve these questions and provide preclinical data defining appropriate agents for clinical trials.

	Footnotes

 
¹ This work was supported by NCI Grant CA-58935, V.A. Merit Review 596-0003, the Ephraim McDowell Cancer Research Foundation (Lexington, KY), and the Lexington Clinic Foundation (Lexington, KY). Presented in part at the 77th Annual Meeting of The Endocrine Society, Washington, D.C., 1995.

Received October 25, 1996.

Revised February 28, 1997.

Accepted March 10, 1997.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Robbins J, Merino MJ, Boice Jr JD, et al. 1991 Thyroid cancer: a lethal neoplasm. Ann Intern Med. 115:133–147.
2. Lamberts SWJ, Krenning EP, Reubi J-C. 1991 The role of somatostatin and its analogs in the diagnosis and treatment of tumors. Endocr Rev. 12:450–482.[Abstract/Free Full Text]
3. Ain KB, Taylor KD. 1994 Somatostatin analogs affect proliferation of human thyroid carcinoma cell lines in vitro. J Clin Endocrinol Metab. 78:1097–1102.[Abstract]
4. Bell GI, Reisine T. 1993 Molecular biology of somatostatin receptors. Trends Neurosci. 16:34–38.[CrossRef][Medline]
5. Patel YC, Greenwood MT, Warszynska A, Panetta R, Srikant CB. 1994 All five cloned human somatostatin receptors (hSSTR1–5) are functionally coupled to adenylyl cyclase. Biochem Biophys Res Commun. 198:605–612.[CrossRef][Medline]
6. Law SF, Woulfe D, Reisine T. 1995 Somatostatin receptor activation of cellular effector systems. Cell Signal. 7:1–8.[CrossRef][Medline]
7. Hoyer D, Bell GI, Berelowitz M, et al. 1995 Classification and nomenclature of somatostatin receptors. Trends Pharmacol Sci. 16:86–88.[CrossRef][Medline]
8. Estour B, Van Herle AJ, Juillard GJF, et al. 1989 Characterization of a human follicular thyroid carcinoma cell line (UCLA RO 82 W-1). Virchows Arch B [Cell Pathol]. 57:167–174.[Medline]
9. Ain KB, Taylor KD, Banks ER, Pettigrew AL. 1992 Characterization of an immortalized cell-line (KAK-1) from a benign human thyroid follicular adenoma. Thyroid. 2:S49.
10. Gilbert SF, Migeon BR. 1975 D-Valine as a selective agent for normal human and rodent epithelial cells in culture. Cell. 5:11–17.[CrossRef][Medline]
11. Kao WW-Y, Prockop DJ. 1977 Proline analogue removes fibroblasts from cultured mixed cell populations. Nature. 266:63–64.[CrossRef][Medline]
12. Greenman Y, Melmed S. 1994 Expression of three somatostatin receptor subtypes in pituitary adenomas: evidence for preferential SSTR5 expression in the mammosomatotroph lineage. J Clin Endocrinol Metab. 79:724–729.[Abstract]
13. Bell GI, Yasuda K, Kong H, Law SF, Raynor K, Reisine T. 1995 Molecular biology of somatostatin receptors. In: Chadwick DJ, Cardew G, eds. Somatostatin and its receptors. Ciba Found Symp 190. Chichester: Wiley and Sons; 65–88.
14. Eden PA, Taylor JE. 1993 Somatostatin receptor subtype gene expression in human and rodent tumors. Life Sci. 53:85–90.[CrossRef][Medline]
15. Vikic-Topic S, Raisch KP, Kvols LK, Vuk-Pavolvic S. 1995 Expression of somatostatin receptor subytypes in breast carcinoma, carcinoid tumor, and renal cell carcinoma. J Clin Endocrinol Metab. 80:2974–2979.[Abstract/Free Full Text]
16. Taylor JE, Theveniau MA, Bashirzadeh R, Reisine T, Eden PA. 1994 Detection of somatostatin receptor subtype 2 (SSTR2) in established tumors and tumor cell lines: evidence for SSTR2 heterogeneity. Peptides. 15:1229–1236.[CrossRef][Medline]
17. Jonas S, John M, Boese-Landgraf J, et al. 1995 Somatostatin receptor subtypes in neuroendocrine tumor cell lines and tumor tissues. Langenbecks Arch Chir. 380:90–95.[Medline]
18. Bruns C, Weckbecker G, Raulf F, Lübbert H, Hoyer D. 1995 Characterization of somatostatin receptor subtypes. In: Chadwick DJ, Cardew G, eds. Somatostatin and its receptors. Ciba Found Symp 190. Chichester: Wiley and Sons; 89–110.
19. Feindt J, Becker I, Blömer U, et al. 1995 Expression of somatostatin receptor subtypes in cultured astrocytes and gliomas. J Neurochem. 65:1997–2005.[Medline]
20. Hatzoglou A, Ouafik LH, Bakogeorgou E, Thermos K, Castanas E. 1995 Morphine cross-reacts with somatostatin receptor SSTR2 in the T47D human breast cancer cell line and decreases cell growth. Cancer Res. 55:5632–5636.[Abstract/Free Full Text]
21. Patel YC, Greenwood M, Panetta R, et al. 1996 Molecular biology of somatostatin receptor subtypes. Metabolism. 45:31–38.[CrossRef][Medline]
22. Greenman Y, Melmed S. 1994 Heterogeneous expression of two somatostatin receptor subtypes in pituitary tumors. J Clin Endocrinol Metab. 78:398–403.[Abstract]
23. Panetta R, Patel YC. 1995 Expression of mRNA for all five human somatostatin receptors (hSSTR1–5) in pituitary tumors. Life Sci. 56:333–342.[CrossRef][Medline]
24. Kubota A, Yamada Y, Kagimoto S, et al. 1994 Identification of somatostatin receptor subtypes and an implication for the efficacy of somatostatin analogue SMS 201–995 in treatment of human endocrine tumors. J Clin Invest. 93:1321–1325.
25. Reubi JC, Schaer JC, Waser B, Mengod G. 1994 Expression and localization of somatostatin receptor SSTR1, SSTR2, and SSTR3 messenger RNAs in primary human tumors using in situ hybridization. Cancer Res. 54:3455–3459.[Abstract/Free Full Text]
26. Schonbrunn A, Gu Y-Z, Dournard P, Beaudet A, Tannenbaum GS, Brown PJ. 1996 Somatostatin receptor subtypes: specific expression and signaling properties. Metabolism. 45:8–11.[CrossRef][Medline]
27. Gu Y-Z, Brown PJ, Loose-Mitchell DS, Stork PJS, Schonbrunn A. 1995 Development and use of a receptor antibody to characterize the interaction between somatostatin receptor subtype 1 and G proteins. Mol Pharmacol. 48:1004–1014.[Abstract]
28. Pan MG, Tullio F, Stork PJS. 1992 G protein activation of a hormone-stimulated phosphatase in human tumor cells. Science. 256:1215–1217.[Abstract/Free Full Text]
29. Buscail L, Delesque N, Esteve J-P, et al. 1994 Stimulation of tyrosine phosphatase and inhibition of cell proliferation by somatostatin analogues: mediation by human somatostatin receptor subtypes SSTR1 and SSTR2. Proc Natl Acad Sci USA. 91:2315–2319.[Abstract/Free Full Text]
30. Lopez F, Esève JP, Buscail L, et al. 1996 Molecular mechanisms of antiproliferative effect of somatostatin: involvement of a tyrosine phosphatase. Metabolism. 45:14–16.[CrossRef][Medline]
31. Buscail L, Estève J-P, Saint-Laurent N, et al. 1995 Inhibition of cell proliferation by the somatostatin analogue RC-160 is mediated by somatostatin receptor subtypes SSTR2 and SSTR5 through different mechanisms. Proc Natl Acad Sci USA. 92:1580–1584.[Abstract/Free Full Text]
32. Szende B, Zalatnai A, Schally AV. 1989 Programmed cell death (apoptosis) in pancreatic cancers of hamsters after treatment with analogs of both luteinizing hormone-releasing hormone and somatostatin. Proc Natl Acad Sci USA. 86:1643–1647.[Abstract/Free Full Text]
33. Pagliacci MC, Tognellini R, Grignani F, Nicoletti I. 1991 Inhibition of human breast cancer cell (MCF-7) growth in vitro by the somatostatin analog SMS 201–995: effects on cell cycle parameters and apoptotic cell death. Endocrinology. 129:2555–2562.[Abstract/Free Full Text]
34. Srikant CB. 1995 Cell cycle dependent induction of apoptosis by somatostatin analog SMS201–995 in AtT-20 mouse pituitary tumor cells. Biochem Biophys Res Commun. 209:400–407.[CrossRef][Medline]
35. Reubi JC, Horisberger U, Laissue J. 1994 High density of somatostatin receptors in veins surrounding human cancer tissue: role in tumor-host interaction? Int J Cancer. 56:681–688.[Medline]
36. Reubi JC, Schaer J-C, Laissue JA, Waser B. 1996 Somatostatin receptors and their subtypes in human tumors and in peritumoral vessels. Metabolism. 45:39–41.[CrossRef][Medline]
37. Danesi R, Del Tacca M. 1996 The effects of the somatostatin analog octreotide on angiogenesis in vitro. Metabolism. 45:49–50.
38. Patel YC. 1994 Subtype selectivity of peptide analogs for all five cloned human somatostatin receptors (hsstr 1–5). Endocrinology. 135:2814–2817.[Abstract]
39. Bruns C, Raulf F, Hoyer D, Schloos J, Lübbert H, Weckbecker G. 1996 Binding properties of somatostatin receptor subtypes. Metabolism. 45:17–20.[CrossRef][Medline]
40. Coy DH, Taylor JE. 1996 Receptor-specific somatostatin analogs: correlations with biological activity. Metabolism. 45:21–23.[CrossRef][Medline]
41. Zlock DW, Greenspan FS, Clark OH, Higgins CB. 1994 Octreotide therapy in advanced thyroid cancer. Thyroid. 4:427–431.[Medline]
42. Tenenbaum F, Lumbroso J, Schlumberger M, Caillou B, Fragu P, Parmentier C. 1995 Radiolabeled somatostatin analog scintigraphy in differentiated thyroid cancer. J Nucl Med. 36:807–810.[Abstract/Free Full Text]
43. Coy DH, Rossowski WJ. 1995 Somatostatin analogues and multiple receptors: possible physiological roles. In: Chadwick DJ, Cardew G, eds. Somatostatin and its receptors. Ciba Found Symp 190. Chichester: Wiley and Sons; 240–254.

This article has been cited by other articles:

				R. E. Schweppe, J. P. Klopper, C. Korch, U. Pugazhenthi, M. Benezra, J. A. Knauf, J. A. Fagin, L. A. Marlow, J. A. Copland, R. C. Smallridge, et al. Deoxyribonucleic Acid Profiling Analysis of 40 Human Thyroid Cancer Cell Lines Reveals Cross-Contamination Resulting in Cell Line Redundancy and Misidentification J. Clin. Endocrinol. Metab., November 1, 2008; 93(11): 4331 - 4341. [Abstract] [Full Text] [PDF]

				W. C.G. van Staveren, D. W. Solis, L. Delys, L. Duprez, G. Andry, B. Franc, G. Thomas, F. Libert, J. E. Dumont, V. Detours, et al. Human Thyroid Tumor Cell Lines Derived from Different Tumor Types Present a Common Dedifferentiated Phenotype Cancer Res., September 1, 2007; 67(17): 8113 - 8120. [Abstract] [Full Text] [PDF]

				C. S. Mitsiades, D. McMillin, V. Kotoula, V. Poulaki, C. McMullan, J. Negri, G. Fanourakis, S. Tseleni-Balafouta, K. B. Ain, and N. Mitsiades Antitumor Effects of the Proteasome Inhibitor Bortezomib in Medullary and Anaplastic Thyroid Carcinoma Cells in Vitro J. Clin. Endocrinol. Metab., October 1, 2006; 91(10): 4013 - 4021. [Abstract] [Full Text] [PDF]

				M. Rodrigues, S. Li, M. Gabriel, D. Heute, M. Greifeneder, and I. Virgolini 99mTc-Depreotide Scintigraphy Versus 18F-FDG-PET in the Diagnosis of Radioiodine-Negative Thyroid Cancer J. Clin. Endocrinol. Metab., October 1, 2006; 91(10): 3997 - 4000. [Abstract] [Full Text] [PDF]

				L. Bodei, G. Paganelli, and G. Mariani Receptor Radionuclide Therapy of Tumors: A Road from Basic Research to Clinical Applications J. Nucl. Med., March 1, 2006; 47(3): 375 - 377. [Full Text] [PDF]

				J. J.M. Teunissen, D. J. Kwekkeboom, P. P.M. Kooij, W. H. Bakker, and E. P. Krenning Peptide Receptor Radionuclide Therapy for Non-Radioiodine-Avid Differentiated Thyroid Carcinoma J. Nucl. Med., January 1, 2005; 46(1_suppl): 107S - 114S. [Abstract] [Full Text] [PDF]

				X. Xu, R. M. Quiros, J. B. Maxhimer, P. Jiang, R. Marcinek, K. B. Ain, J. L. Platt, J. Shen, P. Gattuso, and R. A. Prinz Inverse Correlation between Heparan Sulfate Composition and Heparanase-1 Gene Expression in Thyroid Papillary Carcinomas: A Potential Role in Tumor Metastasis Clin. Cancer Res., December 1, 2003; 9(16): 5968 - 5979. [Abstract] [Full Text] [PDF]

				X. Xu, R. M. Quiros, P. Gattuso, K. B. Ain, and R. A. Prinz High Prevalence of BRAF Gene Mutation in Papillary Thyroid Carcinomas and Thyroid Tumor Cell Lines Cancer Res., August 1, 2003; 63(15): 4561 - 4567. [Abstract] [Full Text] [PDF]

				P. C. Lisboa, K. J. Oliveira, A. Cabanelas, T. M. Ortiga-Carvalho, and C. C. Pazos-Moura Acute cold exposure, leptin, and somatostatin analog (octreotide) modulate thyroid 5'-deiodinase activity Am J Physiol Endocrinol Metab, June 1, 2003; 284(6): E1172 - E1176. [Abstract] [Full Text] [PDF]

				M. C. Zatelli, F. Tagliati, J. E. Taylor, R. Rossi, M. D. Culler, and E. C. degli Uberti Somatostatin Receptor Subtypes 2 and 5 Differentially Affect Proliferation in Vitro of the Human Medullary Thyroid Carcinoma Cell Line TT J. Clin. Endocrinol. Metab., May 1, 2001; 86(5): 2161 - 2169. [Abstract] [Full Text]

				G. M. Venkataraman, M. Yatin, R. Marcinek, and K. B. Ain Restoration of Iodide Uptake in Dedifferentiated Thyroid Carcinoma: Relationship to Human Na+/I- Symporter Gene Methylation Status J. Clin. Endocrinol. Metab., July 1, 1999; 84(7): 2449 - 2457. [Abstract] [Full Text]

				V. D. Corleto, H. C. Weber, and R. T. Jensen Expression of somatostatin receptor subtypes on guinea pig gastric and colonic smooth muscle cells Am J Physiol Gastrointest Liver Physiol, July 1, 1999; 277(1): G235 - G244. [Abstract] [Full Text] [PDF]

				P. Georgii-Hemming, T. Stromberg, E. T. Janson, M. Stridsberg, H. J. Wiklund, and K. Nilsson The Somatostatin Analog Octreotide Inhibits Growth of Interleukin-6 (IL-6)-Dependent and IL-6-Independent Human Multiple Myeloma Cell Lines Blood, March 1, 1999; 93(5): 1724 - 1731. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a related Letter to the Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ain, K. B. Articles by Venkataraman, G. Search for Related Content PubMed PubMed Citation Articles by Ain, K. B. Articles by Venkataraman, G. Pubmed/NCBI databases Gene GEO Profiles HomoloGene UniGene Medline Plus Health Information Thyroid Cancer