| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Studies |
Department of Gastroenterology and Hepatology (M.G.C., P.O.-S., C.P.S., M.P.M.), Hannover Medical School, 30625 Hannover, Germany; Institute of Clinica e Biologia dell’eta evolutiva (M.G.C., A.M., S.D.V.), Universita degli Studi di Cagliari, Cagliari, Italy 09121; Patologia Medica II (V.A.), Universita degli Studi di Cagliari, Cagliari, Italy; and University of California at San Diego Cancer Center (R.H.T.), Department of Medicine and Pharmacology, San Diego, La Jolla, California 92093
Address all correspondence and requests for reprints to: Prof. M. P. Manns, Department of Gastroenterology and Hepatology, Hannover Medical School Carl-Neuberg Strasse 30625 Hannover, Germany.
 |
Abstract |
|---|
 Top Abstract IntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
One of six APS1 patients suffered from chronic hepatitis. In this patient, immunofluorescence revealed a centrolobular liver and a proximal renal tubule staining pattern. Western blots using microsomal preparations of human liver revealed a protein band of 52 kDa. The autoantigen was identified as cytochrome P450 1A2 by use of recombinant protein preparations. P450 1A2 represents the first hepatic autoantigen reported in APS1. P450 1A2 usually is not detected by sera of patients with isolated autoimmune liver disease and might be a hepatic marker autoantigen for patients with APS1.
|
Introduction |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Recently, progress was made in the study of APS1-related Addison’s disease, which affects more than 60% of APS1 patients (1, 2, 3). Adrenal autoantigens in APS1 are cytochromes P450 c17, P450 scc, and P450 c21, which are all enzymes involved in steroidogenesis (5, 6, 7, 8, 9, 10, 11, 12, 13). P450 c21 is reported to be present in the adrenal cortex; expression of P450 c17 is found in adrenal tissue and steroid-producing cells of testis and ovary; and P450 scc is expressed in adrenals, gonads, and placenta (8). It was shown previously that autoantibodies directed against the adrenal cortex alone correlate with a high risk of adrenocortical failure, and antibodies directed against steroidal cells in females, in addition, correlate with a high risk of ovarian failure (14).
Chronic hepatitis is a serious disease component present in 10–18% of patients with APS1 (1, 2, 3), and occasional deaths related to hepatitis are reported in APS1 (2, 15). However, hepatitis as a disease component of APS1 still is poorly investigated. Autoantibodies associated with autoimmune hepatitis as part of APS1 were not described before, and the corresponding antigens accordingly remained unidentified.
Here we report the characterization of six patients with APS1 and confirm P450 scc and P450 c17 as adrenal autoantigens in APS1 in patients from Sardinia. We present the first characterization of hepatic autoantibodies in patients with APS1 and the molecular identification of a hepatic autoantigen in APS 1. The molecular target, cytochrome P450 1A2, is different from the targets of LKM1 and LKM3 autoantibodies that are found in autoimmune hepatitis type 2. Potential diagnostic consequences of this finding are discussed.
|
Subjects and Methods |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
We studied six patients with APS1 (Table 1
).
Patient 1 suffered from liver disease. Patient 1 is female and lacks
markers for hepatitis B, C, and D viruses and HIV. Serum ceruloplasmin
and 
-1 antitrypsin levels are normal. She presented at the clinic at
the age of 6 yr with acute hepatitis that subsequently turned chronic.
Four years after the onset of hepatitis, she developed adrenal failure
and chronic mucocutaneous candidiasis. A percutaneous liver biopsy
revealed the histologic picture of chronic active hepatitis.
|
). All subjects were of Sardinian descent. As shown in
Fig. 1, the 6 APS1 patients belong to 5 different
families. In family 3 and in family 5, 1 sister affected by APS1 died
of acute adrenal failure (at 8 yr old and 15 yr old, respectively).
None of the other 22 relatives had evidence of an autoimmune
disorder.
|
|
Human liver tissue was obtained during liver transplantation from a patient’s liver that was removed because of hepatocellular carcinoma. The tissue otherwise would have been discarded.
For the immunofluorescence studies, a goat antihuman IgM, IgG, IgA
polyclonal FITC-conjugated antiserum was used (Dianova, Hamburg,
Germany). The antibody used for Western blots was an alkaline
phosphatase conjugated anti-IgG, IgA, and IgM antiserum (Dianova). The
complementary DNA (cDNA) construct pBS/1A2, used for subcloning the
cDNA of P450 1A2, was provided by one of us (R. H. Tukey, UC San
Diego). The cDNA constructs, pUC18-scc and PUC 18-c17, containing the
cDNAs of P450 scc and P450 c17, were a kind gift of Walter Miller, UC
San Francisco (16, 17). The DH5 FIQ cells were from GIBCO-BRL
(Eggenstein, Germany).
Nitro blue tetrazolium chloride/5-bromo-chloro-3 indolyl phosphate substrates and isopropylthiogalactoside (IPTG) for bacterial induction were from Promega (Madison, WI). Vectors for the expression of bacterial proteins were from the pQE 30 series of Quiagen (Hilden, Germany). Restriction enzymes were purchased from New England Biolabs (Schwalbach/Taunus, Germany), and the sequencing kit was from Pharmacia (Freiburg, Germany). All other chemicals used were of the highest degree available and purchased from Sigma (Heidelberg, Germany).
Methods
Indirect immunofluorescence. Frozen sections of rat liver and kidney and of human adrenals were incubated at room temperature for 30 min with patient sera at dilutions of 1:40, 1:80, 1:160, 1:320, 1:640, and 1:1280 in phosphate buffered saline (PBS). The sections were washed twice in PBS and incubated with a goat antihuman anti-IgM, IgA, and IgG FITC-conjugated antiserum at a dilution of 1:100 in PBS for 30 min at room temperature. The sections were washed twice in PBS and embedded in 90% vol/vol glycerol in PBS. For analysis of the results, we used an Olympus IMT2 microscope (Olympus, Hamburg, Germany) fitted with an Olympus SC 35 type 12 camera.
Antigen preparations. One gram of frozen tissue was homogenized with 20 strokes of a homogenisator in 3 mL ice-cold solution of 0.25 mol/L sucrose containing 0.1 mmol/L phenylmethylsulfonylfluoride. Cellular debris and nuclei were removed by centrifugation (Sigma SK15 centrifuge, 1000 x g, 4 C, 15 min). The supernatant was fractionated by centrifugation (Sigma SK15 centrifuge, 3000 x g, 4 C, 15 min) into a mitochondrial pellet and the supernatant containing microsomes and the soluble liver proteins.
Mitochondrial preparation. For mitochondrial preparations, the pellet was resuspended in the sucrose solution, and the mitochondria were washed three times, as described above. The washed pellet was frozen on dry ice and stored at -80 C. The resulting fraction is enriched in mitochondria.
Microsomal preparation. The supernatant containing microsomes and soluble liver proteins was subjected to ultracentrifugation (Beckman ultracentrifuge, TLA 100 rotor, 100,000 x g, 4 C, 1 h). The supernatant was discarded, and the microsomal pellet was resuspended in 0.5 ml sucrose solution. The subcellular fractions were frozen on dry ice and stored at -80 C. The resulting preparation is enriched in microsomal proteins.
Western blotting. Fifty micrograms of tissue antigens and bacterial extracts containing recombinant proteins were separated on a 10% polyacrylamide gel and transferred to nitrocellulose (18, 19). The blots were blocked in PBS containing 0.1% Tween 20 and 5% nonfat dry milk and incubated for 1 h with a 1:100 dilution of the patient’s or control sera in PBS-Tween. The blots were then washed three times for 10 min with PBS-Tween and incubated for 1 h with a 1:1000 dilution of an alkaline phosphatase conjugated antihuman IgM, IgA, IgG antiserum in PBS-Tween. After washing three times with PBS-Tween and two times in alkaline phosphatase buffer, the blots were developed using the nitro blue tetrazolium chloride/5-bromo-chloro-3 indolyl phosphate detection system (20).
Cloning and expression of recombinant cytochromes P450s. The primers used for amplification and modification of cytochromes P450 according to Waterman (21) had the following sequences: P450 scc-primers: 5' GTGAGGTACCGCTCTGTTATTAGCAGTTTTTCTGTCAGTCCTGGTC-AAAGGCTAC 3' and 5' GCTCAAGCTTTGATCACTGCTGGGTTGC-TTC 3'; P450 c17-primers: 5' GTGAGGTACCGCTCTGTTATTAGCAGTTTTTCTGCTTACCCTAGCTTATTTGTTT 3' and 5' GCTCAA-GCTTTGATCACTGCTGGGTTGCTTC 3'; P450 1A2-primers: 5' GTGAGGTACCGCTCTGTTATTAGCAGTTTTTCTGTTCTGCCTGGTAT-TCTGGGTG 3' and 5' GCTCAAGCTTCAATTGATGGAGAACG 3'.
The cDNAs were amplified by the Vent polymerase according to the
manufacturers recommendations (New England Biolabs) (Fig. 2A). Denaturation was performed for 1 min at 94 C,
annealing for 2 min at 62 C, and the elongation for 3 min at 72 C.
Twenty cycles were applied for the amplification of the cDNA, with a
final elongation step of 7 min. After PCR, the modified cDNAs were
purified by the Quiagen PCR-purification kit, digested with
HindIII and KpnI, and inserted into the
respective restriction sites of the pQE 30 vector. All constructs were
confirmed by several restriction digests and by sequence analysis of
the N- and C-termini, using the T7 sequencing kit, according to the
manufacturer’s recommendations. For expression of the recombinant
cytochrome P450 proteins, all cDNA-expression vectors were transfected
into DH5FIQ cells. The expression of the recombinant proteins was
induced by the addition of IPTG to a final concentration of 2 mmol/L
for 3 h after the cells were grown to late-log phase. The cells
were harvested by centrifugation, lysed in SDS-sample buffer, and the
proteins were analyzed by SDS-PAGE and Western blotting. The expression
of cytochrome P450 1A2 was further confirmed by Western blotting using
a polyclonal rabbit antihuman P4501A2 antibody that was a kind gift
from Prof. P. Beaune of the University of Paris.
|
|
Results |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Indirect immunofluorescence studies of the sera were performed on
cryosections of human adrenal tissue (Table 1
). Four of six APS1 sera
detected tissue antigens in all three layers (zona glomerulosa, the
zona fasciculata, and the zona reticularis) of the human adrenal
cortex. None of the 82 other sera, including the serum from a patient
with idiopathic Addison’s disease, recognized adrenal antigens.
Immunoblotting with human adrenal antigens
To further characterize the adrenal autoantigens involved, we
prepared mitochondrial subfractions of human adrenal and placental
tissues. Western blotting, with patient sera 1, 2, 4, and 5, revealed a
protein band at 54 kDa in both tissues (Fig. 3, A and
B). In addition to the 54-kDa protein, patient serum no. 2 recognized a
second band at 57 kDa in adrenal but not in placental tissue. In
contrast, none of the sera from the patients‘ first-degree relatives,
from patients with other autoimmune diseases, or from healthy controls
showed protein bands at the levels of 54 or 57 kDa (Fig. 3, A and B,
Table 2). Also, the serum of the patient with isolated Addison’s
disease failed to recognize any of these autoantigens. This result is
in accordance with the working hypothesis that the autoantigenes
recognized in immunofluorescence are the 54-kDa and 57-kDa protein
bands found in Western blotting.
|
Bacterial lysates of clones expressing cytochromes P450 scc and
P450 c17 were used to test for the presence of autoantibodies directed
against these two proteins. Sera 1, 2, 4, and 5, which also reacted
with the 54-kDa adrenal and placental autoantigens, recognized the
recombinant P450 scc (Fig. 3C). Serum 2, which in addition detected a
57-kDa adrenal antigen, recognized P450 c17 (Fig. 3D). In contrast,
none of 82 sera from the patients’ first-degree relatives, patients
with other autoimmune diseases, and healthy controls recognized P450
scc or P450 c17 (Fig. 3, C and D and Table 2).
Control experiments with lysates from bacteria expressing the empty pQE vector were performed with all patient and control sera, demonstrating the specificity of the reaction by the absence of the specific 54-kDa and 57-kDa bands (data not shown).
Absorption studies were performed with recombinant preparations of P450 scc and P450 c17 (data not shown). As expected, recombinant P450 scc absorbed the bands at 54 kDa and P450 c17 the band at 57 kDa, in Western blots with human adrenal mitochondria, demonstrating the identity of the molecular targets. Interestingly, using P450 scc for absorption, no other signal was left in blots with patient sera 1, 4, and 5, whereas only the 57-kDa band remained in blots using serum 2.
Also, the signals in immunofluorescence could be absorbed by the recombinant preparations of P450 scc and P450 c17, if P450 scc were used for sera 1, 4, and 5 and a combination of P450 scc and P450 c17 was used for patient serum 2 (data not shown). These results clearly demonstrate that the immunofluorescence is caused by autoantibodies directed against cytochromes P450 scc and P450 c17. They further show that no autoantibodies directed against cytochrome P450 c21 are present that would not have been absorbed by the recombinant antigens.
Indirect immunofluorescence on rat liver and kidney sections
To investigate the hepatic autoantigens involved in chronic
autoimmune hepatitis associated with APS1, indirect immunofluorescence
was performed (Tables 1 and 2). Six out of 88 sera tested revealed
immunostaining of liver and kidney sections. These sera were the serum
of patient 1, who suffered from chronic hepatitis and APS1, two sera
from patients with LKM-1 positive autoimmune hepatitis, two sera from
patients with LKM-1 positive hepatitis C, and one serum from a patient
with primary biliary cirrhosis, who was positive for antimitochondrial
antibodies. The staining pattern of the serum of patient 1 (Fig. 4) was characterized by a predominant staining of the
perivenous hepatocytes (titer > 1:1000) and of the proximal renal
tubules (titer 1:320). This pattern differs from the homogeneous
staining pattern found in patients with isolated autoimmune hepatitis,
suggesting that the serum of patient 2 recognizes an autoantigen that
is different from LKM1 (anticytochrome P450 2D6) and LKM3
(anti-UDP-glucuronosyltransferase) autoantigenes that were described
earlier to be targets for autoimmunity in patients with autoimmune and
virus hepatitis (22, 23).
|
To further characterize the hepatic antigens involved, the
microsomal fraction of human liver tissue was handled under nonreducing
conditions and tested by immunoblotting. As shown in Fig. 5A, a protein band of approximately 52 kDa was detected
by the serum of patient 1. Bands of 50 kDa and 68 kDa were detected by
the LKM1-positive patients, the 50-kDa band representing an
autoantibody directed against cytochrome P450 2D6 (22). The patient
with PBC shows a band at about 70 kDa, which is caused by a high-titer
antimitochondrial antibody produced by this patient.
|
To identify the hepatic autoantigen recognized by patient 1,
we expressed cytochrome P450 1A2 in E. coli (Fig. 2).
Preparations of the recombinant cytochrome P450 1A2 were used in
Western blotting experiments. All of the 88 sera were tested; however,
only the serum of patient 1 was positive (Fig. 5B). This result
demonstrates that P450 1A2 is an autoantigen in autoimmune hepatitis
associated with APS1. To demonstrate the specificity of the reaction, a
Western blot of serum 1 was performed, using E. coli
extracts of clones carrying the empty vector alone, in parallel with
preparations containing recombinant P450 1A2. No band appeared in the
control extract, whereas a clear signal was visible in the lane
containing P450 1A2 (Fig. 5C).
P450 1A2 is expressed in liver, but not in kidney, and therefore, antibodies directed against P450 1A2 were described before as LM autoantibody in patients with dihydralazine-induced hepatitis (24). There are two potential explanations for the renal immunofluorescence pattern. The first explanation consists of a cross-reaction of the autoantibody with a kidney antigen. A cross-reaction also would explain why the signal is only detected at lower serum dilutions. The second explanation is the presence of an unrelated second autoantibody present at a lower titer. To distinguish between these possibilities, absorption studies were performed.
Absorption studies
After absorption with preparations of recombinant P450 1A2, the
immunofluorescence studies shown in Fig. 4 were repeated (data not
shown). In three independent experiments, the immunofluorescence
disappeared in liver and in kidney. In control experiments performed
with LKM1 positive control sera, the immunofluorescence patterns
persisted after absorption with the recombinant P450 1A2.
Figure 6A shows a result after Western blotting with
liver microsomes. The serum of patient 1 revealed a clear signal at 52
kDa in a Western blot with liver microsomes before absorption (Fig. 6A, lane 1) the signal almost completely disappeared after absorption with
P450 1A2 (Fig. 6A, lane 2). The third lane of Fig. 6A shows that the
signals of an LKM1-positive serum that are not related to P450 1A2
persist after absorption with P450 1A2. Figure 6B shows a result after
Western blotting using recombinant P450 1A2.
|
|
Discussion |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
, A–D). There also is some disagreement
as to whether P450 c21 is an autoantigen in APS1. Although Uibo
et al. (8) report P450 c21 being an autoantigen in 15/50
patients with APS1, Winqvist et al. (7, 12) failed to detect
this autoantibody in APS1. In our group of six patients with APS1, we
also did not detect other adrenal autoantigens than P450 scc and P450
c17. The most important aspect of this paper, however, is the detection and identification of a hepatic autoantigen in patients with APS1. Ten to eighteen percent of APS1 patients develop chronic hepatitis (1, 2, 3), and occasionally, patients are reported to have died within only a few days from hepatitis, which occurred unexpectedly and without signs of prewarning (2, 15). However, in contrast to the wealth of information collected by the researchers working on adrenal and gonadal failure in APS1, very little is known about hepatitis as a disease component in APS1. Here we report for the first time the characterization of hepatic autoantigens and the identification of cytochrome P450 1A2 as hepatic autoantigen in APS1. The identification of the autoantigen was facilitated by an immunofluorescence pattern that was different from the patterns resulting from LKM1 and LKM3 autoantibodies. When Western blots were performed with rat microsomes, we failed to detect a specific protein recognized by the antiserum (data not shown). However, using human liver microsomes, a protein band of 52 kDa appeared. This is in accordance with observations published by P. Beaune and his colleges (24), who identified cytochrome P450 1A2 as hepatic autoantigen in dihydralazine hepatitis. In addition, control experiments with intestinal microsomes were performed (data not shown), demonstrating by the absence of the 52-kDa signal that an organ specific autoantigen is detected by the serum of patient 1. To prove that cytochrome P450 1A2 also is an autoantigen in APS1, P450 1A2 was expressed in E. coli. The serum not only specifically recognized cytochrome P450 1A2 in Western blot experiments, but absorption with recombinant P450 1A2 resulted in a complete disappearance of the immunofluorescence pattern and the reactivity in Western blots with human liver microsomes. At lower dilutions of the serum, immunofluorescence also was detected in kidney sections, in spite of the fact that P450 1A2 is not expressed in kidney. This result seems to be caused by a cross-reaction of the antibody, because the renal immunofluorescence also could be absorbed with the recombinant cytochrome P450 1A2.
Cytochrome P450 1A2 was described earlier by our group as autoantigen in an unusual case of autoimmune hepatitis (28, 29). This patient suffered from vitiligo, alopecia, and nail dystrophy and had a brother who had died from Addison’s disease at the age of 8 yr. We now believe that in accordance with the criteria for diagnosis of APS1 from Neufeld (1), this patient also suffered from APS1. Adding the present patient to that previous one, we now have two patients on record suffering from autoimmune hepatitis in APS1 with cytochrome P450 1A2 as hepatic autoantigen.
Extensive control studies were performed. A total of 40 patient sera
with other autoimmune diseases and 22 first-degree relatives of the
patients were tested for autoantibodies directed against hepatic
antigens and cytochrome P450 1A2. However, only patient serum 1 and 4
sera from patients with other liver diseases reacted with human hepatic
microsomes (Fig. 5, Tables 1, 2). When extracts of expression clones
containing the recombinant P450 1A2 were used, reaction of only patient
serum 1 was detected, showing that the detection of the hepatic
autoantibodies and P450 1A2 did not represent false positive results
caused by elevated IgG-levels that are typical for patients with
autoimmune diseases. Most patients with autoimmune hepatitis type 2
recognize P450 2D6, and about 10% recognize UGT 1 proteins. Of 15
German patients with autoimmune hepatitis type 2, none was found to
recognize cytochrome P450 1A2 (data not shown). Determination of the
exact molecular target of autoimmunity in patients with autoimmune
hepatitis could help to distinguish patients with autoimmune
hepatitis-2 from patients with hepatitis in APS1. The later patients
should be closely monitored for the development of further disease
manifestations.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received November 21, 1995.
Revised May 9, 1996.
Revised December 20, 1996.
Accepted January 31, 1997.
|
References |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
-hydroxylase. Lancet. 339:770–773.[CrossRef][Medline]
This article has been cited by other articles:
 |
|
 |
|
  M. Oliva-Hemker, G. V. Berkenblit, G. J. Anhalt, and J. H. Yardley Pernicious Anemia and Widespread Absence of Gastrointestinal Endocrine Cells in a Patient with Autoimmune Polyglandular Syndrome Type I and Malabsorption J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 2833 - 2838. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Betterle, C. Dal Pra, F. Mantero, and R. Zanchetta Autoimmune Adrenal Insufficiency and Autoimmune Polyendocrine Syndromes: Autoantibodies, Autoantigens, and Their Applicability in Diagnosis and Disease Prediction Endocr. Rev., June 1, 2002; 23(3): 327 - 364. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z BEN-ARI and A J CZAJA Autoimmune hepatitis and its variant syndromes Gut, October 1, 2001; 49(4): 589 - 594. [Full Text] [PDF]
|
|
|
|
|
|
O. Ekwall, J. Haavik, J. Perheentupa, C. Betterle, J. Gustafsson, E. Husebye, F. Rorsman, and O. Kämpe Pteridin-Dependent Hydroxylases as Autoantigens in Autoimmune Polyendocrine Syndrome Type I J. Clin. Endocrinol. Metab., August 1, 2000; 85(8): 2944 - 2950. [Abstract] [Full Text]
|
|
|
|
|
|
L. Ward, J. Paquette, E. Seidman, C. Huot, F. Alvarez, P. Crock, E. Delvin, O. Kämpe, and C. Deal Severe Autoimmune Polyendocrinopathy-Candidiasis-Ectodermal Dystrophy in an Adolescent Girl with a Novel AIRE Mutation: Response to Immunosuppressive Therapy J. Clin. Endocrinol. Metab., March 1, 1999; 84(3): 844 - 852. [Abstract] [Full Text]
|
|
|
|
 |
|
 K. Blechschmidt, M. Schweiger, K. Wertz, R. Poulson, H.-M. Christensen, A. Rosenthal, H. Lehrach, and M.-L. Yaspo The Mouse Aire Gene: Comparative Genomic Sequencing, Gene Organization, and Expression Genome Res., February 1, 1999; 9(2): 158 - 166. [Abstract] [Full Text]
|
|
|
|
 |
|
 H. S. Scott, M. Heino, P. Peterson, L. Mittaz, M. D. Lalioti, C. Betterle, A. Cohen, M. Seri, M. Lerone, G. Romeo, et al. Common Mutations in Autoimmune Polyendocrinopathy-Candidiasis-Ectodermal Dystrophy Patients of Different Origins Mol. Endocrinol., August 1, 1998; 12(8): 1112 - 1119. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
