| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Endocrinological Oncology |
Third Division, Department of Medicine, Hirosaki University School of Medicine (Y.S., N.H., K.S., T.S.), Hirosaki 036; Department of Neurosurgery, Nagoya National Hospital (A.K.), Nagoya 460; and Department of Medicine, Institute of Clinical Endocrinology, Tokyo Women’s Medical College (F.T., H.D.), Tokyo 162, Japan
Address all correspondence and requests for reprints to: Yoko Sakai, Third Division, Department of Medicine, Hirosaki University School of Medicine, 5 Zaifu-cho, Hirosaki 036, Japan.
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
In 1993, complementary DNAs (cDNAs) encoding a human pituitary (10) and a rat brain (11) CRF-R were cloned. The two receptors are 91% and 97% identical at the nucleotide and deduced amino acid levels, respectively. More recently, cDNA cloning of a second type of CRF-R from the rat hypothalamus was reported (12). This type of CRF-R, designated as CRF2 receptor (12), CRF-RB (13), or type-2 CRF receptor (CRF-R2) (14), is expressed primarily in the heart, skeletal muscle, brain, and lungs (12, 13, 15, 16) and is distinct from the first (pituitary/brain) type called CRF1 receptor (12), CRF-RA (13), or type-1 CRF receptor (CRF-R1) (14). These advances have enabled us to examine the pituitary CRF-R as a distinct molecule. However, the regulation of the CRF-R1 gene expression is still poorly understood in rats and has not been reported in humans.
Cushing’s disease is a disorder caused by the autonomous secretion of ACTH by a pituitary adenoma. It is well known that CRF administration increases the plasma ACTH concentration in most patients with Cushing’s disease (17, 18). Furthermore, in vitro studies showed that CRF increases not only ACTH secretion but also POMC mRNA levels in cultured human corticotropic adenoma (hCA) cells (19). These findings, together with the detection of CRF-binding sites in hCAs (9), indicate that hCAs express CRF-R1 in spite of their autonomous secretion of ACTH. In patients with Cushing’s disease, the portal CRF levels are suppressed, but in patients with Nelson’s syndrome whose portal CRF level have increased after bilateral adrenalectomy, elevated CRF might have some effect on CRF-R1 on hCA cells and play a role in the initiation of the syndrome.
In this study, we examined the effects of CRF, arginine vasopressin (AVP), and dexamethasone (Dex) on CRF-R1 mRNA in hCA cells obtained from patients with Cushing’s disease using Northern blot hybridization.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Pituitary adenomas were obtained by transsphenoidal adenomectomy from 10 patients with Cushing’s disease. All the patients showed more than a 1.5-fold of plasma ACTH response to the iv administration of 100 µg human CRF. Their plasma cortisol and ACTH levels were all suppressed to less than 50% of the basal levels by high-dose (8 mg) Dex administration, but remained basal after low-dose (2 mg) Dex treatment. The diagnosis of Cushing’s disease was confirmed histologically in all cases after the surgery.
hCA cell culture
The adenoma tissue was minced and incubated with sterile
HEPES-buffered saline containing 0.4% collagenase (Sigma Chemical Co.,
St. Louis, MO), 0.04% dispase (Sanko Pure Chemical, Tokyo, Japan),
0.002% DNase (Sigma), and 2% BSA for 20 min at 37 C. The cells were
dispersed by pipetting, washed twice, then resuspended with
HEPES-buffered DMEM containing 10% FCS. Aliquots of 2 x
105 cells were placed in 12-well (22.1 mm diameter) culture
clusters (Costar, Cambridge, MA) and incubated at 37 C in humidified
95% air-5% CO2. When sufficient adenoma tissue was
obtained (cases 4 and 5 in Table 1
), triplicate cultures were prepared
for experimental incubations.
|
Rat APs were removed from adult male Wistar rats (Charles River Japan, Tokyo, Japan) weighing about 250 g and then the AP cells were dispersed and cultured as previously reported (20).
Experimental incubation
After 3–5 days of culture, cells were washed with serum-free HEPES-buffered DMEM containing 0.2% BSA, then incubated with the serum-free medium containing 0.1–10 nmol/L rat/human CRF (r/hCRF; Peninsula Laboratories, Belmont, CA), 10 µg/dL Dex (Sigma), or 0.1–10 nmol/L AVP (Peptide Institute, Osaka, Japan) for 1–24 h. At the end of an incubation, the medium was saved for ACTH RIA, and total cellular RNA was isolated for Northern blot analysis.
ACTH RIA
The ACTH levels in the incubation media were determined by RIA
based on the previously reported method (21) with a new strain of
antiserum raised against ACTH-(1–24) and 125I-labeled
ACTH-(1–39) as a tracer. The antiserum was used at a final dilution of
1:150,000. The sensitivity of this assay was 3 pg/tube. The intra- and
interassay variances were less than 5% and 10%, respectively.
Cross-reactivities for various peptides relative to ACTH-(1–39) were
2181%, 2.4%, 9.5%, 15.8%, 15.3%, and <0.001% for ACTH-(1–24),
ACTH-(18–39), ACTH-(1–17), ACTH-(1–10), 
-MSH, and ß-MSH, or
ß-endorpin, respectively. All peptides were purchased from Peninsula
Laboratories.
Northern blot analysis
Details of the isolation of cellular RNA and Northern blot analysis have been described previously (22). In brief, total RNA was isolated from cultured hCA cells by the acid guanidium thiocyanate-phenol-chloroform method (23). The RNA samples (0.5–1 µg) were denatured with 1 mol/L glyoxal and 50% dimethylsulfoxide and electrophoresed on a 1.4% agarose gel in 10 mmol/L sodium phosphate buffer, pH 7.0. After electrophoresis, the RNA was transferred to a filter (Gene Screen; DuPont/NEN, Boston, MA) and fixed under UV by a UV cross-linker (UV Stratalinker 1800, Stratagene, La Jolla, CA). The filter was prehybridized for 6 h and then hybridized with 1 x 107 cpm/10 mL 32P-labeled CRF-R1 cRNA probe. Hybridization was performed at 60 C for 48 h in a hybridization buffer of the following composition: 6x SSC (1 x SSC = 150 mmol/L sodium chloride and 15 mmol/L sodium citrate, pH 7.4), 50% formamide, 2% SDS, and 100 µg/mL denatured sheared salmon sperm DNA. At the end of the incubation, the filter was washed twice at room temperature in 2x SSC with 1% SDS, and several times at 60 C in 0.1x SSC with 1% SDS. After washing, the filters were exposed to Kodak XAR-5 x-ray film (Eastman Kodak, Tokyo, Japan). As a control, the same filters were rehybridized with a human ß-actin probe 21 days later. The relative densities of the hybridization bands were quantified by a densitometer. The CRF-R1 mRNA levels were normalized for the ß-actin mRNA levels and expressed as percent of the control.
Probes
Labeled CRF-R1 cRNA probe was synthesized as previously described (24). In brief, two oligonucleotide primers were designed based on the nucleotide sequence of the rat CRF- R1 (11) and synthesized with BamHI and HindIII linkers at their 5' ends to facilitate cloning. The primer sequences were sense primer: 5' CCGGATCCACAAACAATGGCTACCGGGAG and antisense primer: 5' GGAAGCTTACACCCCAGCCAATGCAGAC. The sense and antisense primers corresponded to 327–347 base and 803–783 base of CRF-R1, respectively. After RT using rat brain RNA, the antisense primer and rTth DNA polymerase (Perkin Elmer Cetus, Norwalk, CT), PCR was performed for 30 cycles at 95 C for 1 min, at 55 C for 2 min, and at 72 C for 2 min. The PCR product was subcloned into Bluescript plasmid (Stratagene). Sequence analysis revealed that the PCR product was identical to 327–803 base of CRF-R1. Radioactive cRNA was synthesized by in vitro transcription of the BamHI-digested subclone using T3 RNA polymerase (Stratagene). The size of the final cRNA probe was 528 base. The restriction enzymes were purchased from Takara Shuzo, Co. (Kyoto, Japan). The labeled ß-actin probe was synthesized from plasmid pMY869, a derivative of pMFb A-1 (25).
Statistical analysis
All values are expressed as means ± SEM. Statistical analysis was performed by one-way ANOVA, followed by Duncan’s multiple range test. P < 0.05 was accepted as statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Northern blot analysis using the rat CRF-R1 probe revealed a main
hybridization band of 2.7 kilobases (kb) in hCAs from all 10 patients
with Cushing’s disease. The size of the band did not change after the
treatment with r/hCRF or Dex. Samples of autoradiogram (cases 1 and 2
in Table 1
) are shown in Fig. 1. After a
16-h incubation with 10 nmol/L r/hCRF, the CRF-R1 mRNA level increased
to 118–960% of the basal level in hCA cells from 9 of 10 patients
(Table 1 and Fig. 1). In case 10 (Fig. 5), effects of CRF were not
tested. Treatment with 10 µg/dL of Dex decreased the CRF-R1 mRNA
level to 31–55% of the basal level after 16 h in all 3 hCAs
tested (Table 1 and Fig. 1).
|
|
Northern blot analysis using the rat CRF-R1 probe revealed a main
hybridization band of 2.7 kb in rat AP cells, the size of which was
unchanged after the following treatment (Fig. 2).
Treatment with 10 nmol/L r/hCRF significantly reduced CRF-R1 mRNA
levels within 1 h after the addition of CRF. The mRNA level fell
to 30% of the basal level at 2 h after the treatment, remained
reduced for 4 h, and recovered to the control level after 8–16 h
(Fig. 2).
|
)Because the CRF-R1 mRNA decreased with CRF in rat AP cells, whereas that in hCA cells increased 16 h after the treatment with CRF, detailed time course studies were carried out in hCA cells. The expression level of the CRF-R1 mRNA significantly increased at 1 h, reached 15-fold the basal level at 8 h, and remained elevated at 24 h after the addition of 10 nmol/L r/hCRF in hCA cells.
|
With a 16-h incubation, the CRF-R1 mRNA level significantly
increased in a dose-dependent manner. The CRF-R1 mRNA levels increased
to 160%, 245%, and 308% of the basal level with 0.1, 1, or 10 nmol/L
r/hCRF, respectively (Fig. 4). In the case shown in Fig. 4 (case 5 in Table 1), additional hybridization bands larger than the
main 2.7-kb band were detected. Only the main bands were quantified and
expressed in the right panel of Fig. 4.
|
CRF-R1 mRNA levels decreased with AVP in cultured hCA cells.
Treatment with 0.1 nmol/L AVP caused a decrease in the CRF-R1 mRNA
levels to 26% of the basal level within 6 h (Fig. 5). In the experiment shown in Fig. 5, the ACTH levels
in the incubation media were 254, 320, 393, and 449 ng/mL with 0, 0.1,
1, and 10 nmol/L AVP, respectively. As shown in Fig. 1
(right), coaddition of AVP inhibited the CRF-induced
increase in the CRF-R1 mRNA.
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Since cDNAs encoding a human pituitary (10) and a rat brain (11) CRF-R, CRF-R1, were cloned, several investigators including us have described the regulation of CRF-R1 gene expression in the rat AP (29–32). However, there have been no studies in humans. In this study, we examined the regulation of CRF-R1 mRNA in hCAs by Northern blot analysis.
Northern blot hybridization using a rat CRF-R1 probe revealed a main
hybridization band of 2.7 kb in all the RNA samples extracted from the
hCA cells obtained from 10 patients with Cushing’s disease. The size
of the band is the same as that described in a previous study on human
CRF-R1 (10). These results, together with the high homology between the
cDNA sequences of the rat and human CRF-R1, indicate that the main
2.7-kb band denotes CRF-R1 mRNA. In addition to the main band, much
weaker bands were detected at positions of 2.1 and 1.6 kb in most
cases. The density levels of these bands did not change in parallel
with the main band level, suggesting that these bands are nonspecific.
In hCA cells from a patient (case 5), two more bands larger than the
main band were also observed. As the levels of the larger bands appear
to increase with CRF (Fig. 4), these bands may indicate other sizes of
CRF-R1 transcripts. To identify the nature of the two groups of the
additional bands, preparation of poly(A) RNA samples can be helpful,
but hCA tissue was not sufficient. The CRF-R1 mRNA level was estimated
by the density level of the main band.
Treatment with Dex caused a decrease in the CRF-R1 mRNA level (Fig. 1
and Table 1). This regulation is in the same direction as that observed
in rat AP cells (29, 32). Glucocorticoid suppression of CRF-R1 gene
expression in corticotrophs might be involved in the feedback
mechanisms in the hypothalamo-pituitary-adrenal axis, even though the
major effects of glucocorticoids are suppression of the release and
synthesis of CRF and ACTH. AVP also exerted a significant suppressive
effect on the CRF-R1 mRNA level in hCA cells (Fig. 5). This negative
regulation is again in the same direction as that observed in rat AP
cells (29). On the other hand, treatment with r/hCRF caused a
significant increase in the CRF-R1 mRNA level in the hCA cells in a
time- and dose-dependent manner (Figs. 3 and 4), whereas r/hCRF induced
a significant decrease in CRF-R1 mRNA levels in rat AP cells (Fig. 2).
It is quite interesting that only CRF regulates CRF-R1 gene expression
in hCA in an opposite manner to that in rat AP. This divergent
regulation by CRF may be attributed to different hormonal environment
in vivo, or to intrinsic differences between the two types
of corticotrophs, including the species difference or different cell
types, i.e. normal vs. tumor cells. In Cushing’s
disease, plasma glucocorticoid levels are elevated and portal CRF
levels are depleted. As only CRF showed the divergent effects in the
two types of cultures, the CRF depletion in vivo could be a
putative environmental factor that affected the results in hCA cells
in vitro. If it is hypothesized that minimal or
physiological levels of CRF are required for the CRF-R1 gene
expression, CRF-R1 gene transcription would be stimulated with CRF in
hCA cells, whereas the additional CRF could decrease the CRF-R1 mRNA
level in rat AP cells in which basal transcription was maintained
in vivo. However, this possibility is less likely because
the hCA and rat AP cells were cultured for 3–5 days before experiments
in the same conditions with 10% FCS. Species difference may result in
the different regulation of the CRF-R1 mRNA level by CRF. However, in
early phase of hypothalamic damage, i.e. CRF deficiency, the
patients show exaggerated plasma ACTH responses to CRF administration
(33). This fact suggests that CRF down-regulates CRF-R1 in normal human
corticotrophs. Consequently, an intrinsic difference(s) that follows
the neoplastic change of corticotrophs may play the most important role
in the different regulation of CRF-R1 by CRF. Grino et al.
(34) demonstrated that ACTH release from hCA cells did not become
desensitized during long-term exposure to r/hCRF; this can be a
collaboration of up-regulation of the CRF-R1 mRNA by CRF in hCA cells.
If the up-regulation of the CRF-R1 mRNA level by CRF is dependent on
any intrinsic characters of hCA cells, CRF-R1 gene expression in hCA
would be stimulated by elevation of the portal CRF level in patient
with Cushing’s disease after bilateral adrenalectomy, which might play
a role in the initiation or progression of Nelson’s syndrome.
In conclusion, we detected CRF-R1 mRNA in hCAs from all the 10 patients with Cushing’s disease and revealed that the CRF-R1 mRNA level was up-regulated by CRF itself in hCA cells, in contrast to the down-regulation in rat AP cells.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received June 14, 1996.
Revised December 23, 1996.
Accepted January 9, 1997.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
-, ß-, 
-actin mRNA: skeletal but not cytoplasmic
actins have an amino-terminal cystine that is subsequently removed. Mol
Cell Biol. 3:787–795.This article has been cited by other articles:
 |
|
 |
|
  K. Kageyama, K. Hanada, T. Nigawara, T. Moriyama, K. Terui, S. Sakihara, and T. Suda Urocortin Induces Interleukin-6 Gene Expression via Cyclooxygenase-2 Activity in Aortic Smooth Muscle Cells Endocrinology, September 1, 2006; 147(9): 4454 - 4462. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kageyama, K. Hanada, T. Moriyama, T. Nigawara, S. Sakihara, and T. Suda G Protein-Coupled Receptor Kinase 2 Involvement in Desensitization of Corticotropin-Releasing Factor (CRF) Receptor Type 1 by CRF in Murine Corticotrophs Endocrinology, January 1, 2006; 147(1): 441 - 450. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. C. Reubi, B. Waser, W. Vale, and J. Rivier Expression of CRF1 and CRF2 Receptors in Human Cancers J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 3312 - 3320. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. L. M. Dahia and A. B. Grossman The Molecular Pathogenesis of Corticotroph Tumors Endocr. Rev., April 1, 1999; 20(2): 136 - 155. [Abstract] [Full Text]
|
|
|
|
|
|
S. L. Asa and S. Ezzat The Cytogenesis and Pathogenesis of Pituitary Adenomas Endocr. Rev., December 1, 1998; 19(6): 798 - 827. [Abstract] [Full Text]
|
|
|
|
|
|
K. D. Dieterich, E. D. Gundelfinger, D. K. Lüdecke, and H. Lehnert Mutation and Expression Analysis of Corticotropin-Releasing Factor 1 Receptor in Adrenocorticotropin-Secreting Pituitary Adenomas J. Clin. Endocrinol. Metab., September 1, 1998; 83(9): 3327 - 3331. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
