help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sakai, Y.
Right arrow Articles by Suda, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sakai, Y.
Right arrow Articles by Suda, T.
The Journal of Clinical Endocrinology & Metabolism Vol. 82, No. 4 1229-1234
Copyright © 1997 by The Endocrine Society


Endocrinological Oncology

Corticotropin-Releasing Factor Up-Regulates Its Own Receptor Gene Expression in Corticotropic Adenoma Cells in Vitro1

Yoko Sakai, Nobuo Horiba, Ken Sakai, Fumiko Tozawa, Akio Kuwayama, Hiroshi Demura and Toshihiro Suda

Third Division, Department of Medicine, Hirosaki University School of Medicine (Y.S., N.H., K.S., T.S.), Hirosaki 036; Department of Neurosurgery, Nagoya National Hospital (A.K.), Nagoya 460; and Department of Medicine, Institute of Clinical Endocrinology, Tokyo Women’s Medical College (F.T., H.D.), Tokyo 162, Japan

Address all correspondence and requests for reprints to: Yoko Sakai, Third Division, Department of Medicine, Hirosaki University School of Medicine, 5 Zaifu-cho, Hirosaki 036, Japan.


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
To investigate the expression of CRF receptor (CRF-R) in human corticotropic adenoma (hCA) cells, we analyzed messenger RNA (mRNA) levels of type-1 CRF-R (CRF-R1). Adenomas were obtained from 10 patients with Cushing’s disease. Northern blot analysis using a rat CRF-R1 complementary RNA probe revealed a main hybridization band of 2.7 kilobases in all the hCAs. The CRF-R1 mRNA level significantly increased after 1 h, reached 15-fold the basal level at 8 h, and remained elevated 24 h after the addition of 10 nmol/L CRF in vitro. Dose dependency of the stimulatory effect of CRF was also demonstrated in hCA cells, whereas CRF down-regulated CRF-R1 mRNA levels in rat anterior pituitary (AP) cells. Treatment with dexamethasone or vasopressin decreased the CRF-R1 mRNA level in hCA cells, as observed in rat AP cells. In conclusion, we detected CRF-R1 mRNA in all hCAs tested. The CRF-R1 mRNA level was up-regulated by CRF itself in cultured hCA cells, in contrast to the down-regulation in rat AP cells.


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
CRF IS the most principal stimulator promoting the synthesis and release of ACTH by the anterior pituitary (AP) (1). The regulatory actions of CRF are mediated by specific plasma membrane receptors (2, 3). Binding studies have demonstrated that the number of CRF receptors (CRF-Rs) is down-regulated by CRF itself in rat AP (4–7). Glucocorticoids also decrease CRF-R number in rat AP (4–8). However, the regulation of human pituitary CRF-Rs has not been reported yet; CRF-binding sites were only detected in corticotropic adenomas (9).

In 1993, complementary DNAs (cDNAs) encoding a human pituitary (10) and a rat brain (11) CRF-R were cloned. The two receptors are 91% and 97% identical at the nucleotide and deduced amino acid levels, respectively. More recently, cDNA cloning of a second type of CRF-R from the rat hypothalamus was reported (12). This type of CRF-R, designated as CRF2 receptor (12), CRF-RB (13), or type-2 CRF receptor (CRF-R2) (14), is expressed primarily in the heart, skeletal muscle, brain, and lungs (12, 13, 15, 16) and is distinct from the first (pituitary/brain) type called CRF1 receptor (12), CRF-RA (13), or type-1 CRF receptor (CRF-R1) (14). These advances have enabled us to examine the pituitary CRF-R as a distinct molecule. However, the regulation of the CRF-R1 gene expression is still poorly understood in rats and has not been reported in humans.

Cushing’s disease is a disorder caused by the autonomous secretion of ACTH by a pituitary adenoma. It is well known that CRF administration increases the plasma ACTH concentration in most patients with Cushing’s disease (17, 18). Furthermore, in vitro studies showed that CRF increases not only ACTH secretion but also POMC mRNA levels in cultured human corticotropic adenoma (hCA) cells (19). These findings, together with the detection of CRF-binding sites in hCAs (9), indicate that hCAs express CRF-R1 in spite of their autonomous secretion of ACTH. In patients with Cushing’s disease, the portal CRF levels are suppressed, but in patients with Nelson’s syndrome whose portal CRF level have increased after bilateral adrenalectomy, elevated CRF might have some effect on CRF-R1 on hCA cells and play a role in the initiation of the syndrome.

In this study, we examined the effects of CRF, arginine vasopressin (AVP), and dexamethasone (Dex) on CRF-R1 mRNA in hCA cells obtained from patients with Cushing’s disease using Northern blot hybridization.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Patients

Pituitary adenomas were obtained by transsphenoidal adenomectomy from 10 patients with Cushing’s disease. All the patients showed more than a 1.5-fold of plasma ACTH response to the iv administration of 100 µg human CRF. Their plasma cortisol and ACTH levels were all suppressed to less than 50% of the basal levels by high-dose (8 mg) Dex administration, but remained basal after low-dose (2 mg) Dex treatment. The diagnosis of Cushing’s disease was confirmed histologically in all cases after the surgery.

hCA cell culture

The adenoma tissue was minced and incubated with sterile HEPES-buffered saline containing 0.4% collagenase (Sigma Chemical Co., St. Louis, MO), 0.04% dispase (Sanko Pure Chemical, Tokyo, Japan), 0.002% DNase (Sigma), and 2% BSA for 20 min at 37 C. The cells were dispersed by pipetting, washed twice, then resuspended with HEPES-buffered DMEM containing 10% FCS. Aliquots of 2 x 105 cells were placed in 12-well (22.1 mm diameter) culture clusters (Costar, Cambridge, MA) and incubated at 37 C in humidified 95% air-5% CO2. When sufficient adenoma tissue was obtained (cases 4 and 5 in Table 1Go), triplicate cultures were prepared for experimental incubations.


View this table:
[in this window]
[in a new window]
 
Table 1. Type 1 CRF-R mRNA levels in corticotropic adenomas from nine patients with Cushing’s disease

 
Rat AP cell culture

Rat APs were removed from adult male Wistar rats (Charles River Japan, Tokyo, Japan) weighing about 250 g and then the AP cells were dispersed and cultured as previously reported (20).

Experimental incubation

After 3–5 days of culture, cells were washed with serum-free HEPES-buffered DMEM containing 0.2% BSA, then incubated with the serum-free medium containing 0.1–10 nmol/L rat/human CRF (r/hCRF; Peninsula Laboratories, Belmont, CA), 10 µg/dL Dex (Sigma), or 0.1–10 nmol/L AVP (Peptide Institute, Osaka, Japan) for 1–24 h. At the end of an incubation, the medium was saved for ACTH RIA, and total cellular RNA was isolated for Northern blot analysis.

ACTH RIA

The ACTH levels in the incubation media were determined by RIA based on the previously reported method (21) with a new strain of antiserum raised against ACTH-(1–24) and 125I-labeled ACTH-(1–39) as a tracer. The antiserum was used at a final dilution of 1:150,000. The sensitivity of this assay was 3 pg/tube. The intra- and interassay variances were less than 5% and 10%, respectively. Cross-reactivities for various peptides relative to ACTH-(1–39) were 2181%, 2.4%, 9.5%, 15.8%, 15.3%, and <0.001% for ACTH-(1–24), ACTH-(18–39), ACTH-(1–17), ACTH-(1–10), {alpha}-MSH, and ß-MSH, or ß-endorpin, respectively. All peptides were purchased from Peninsula Laboratories.

Northern blot analysis

Details of the isolation of cellular RNA and Northern blot analysis have been described previously (22). In brief, total RNA was isolated from cultured hCA cells by the acid guanidium thiocyanate-phenol-chloroform method (23). The RNA samples (0.5–1 µg) were denatured with 1 mol/L glyoxal and 50% dimethylsulfoxide and electrophoresed on a 1.4% agarose gel in 10 mmol/L sodium phosphate buffer, pH 7.0. After electrophoresis, the RNA was transferred to a filter (Gene Screen; DuPont/NEN, Boston, MA) and fixed under UV by a UV cross-linker (UV Stratalinker 1800, Stratagene, La Jolla, CA). The filter was prehybridized for 6 h and then hybridized with 1 x 107 cpm/10 mL 32P-labeled CRF-R1 cRNA probe. Hybridization was performed at 60 C for 48 h in a hybridization buffer of the following composition: 6x SSC (1 x SSC = 150 mmol/L sodium chloride and 15 mmol/L sodium citrate, pH 7.4), 50% formamide, 2% SDS, and 100 µg/mL denatured sheared salmon sperm DNA. At the end of the incubation, the filter was washed twice at room temperature in 2x SSC with 1% SDS, and several times at 60 C in 0.1x SSC with 1% SDS. After washing, the filters were exposed to Kodak XAR-5 x-ray film (Eastman Kodak, Tokyo, Japan). As a control, the same filters were rehybridized with a human ß-actin probe 21 days later. The relative densities of the hybridization bands were quantified by a densitometer. The CRF-R1 mRNA levels were normalized for the ß-actin mRNA levels and expressed as percent of the control.

Probes

Labeled CRF-R1 cRNA probe was synthesized as previously described (24). In brief, two oligonucleotide primers were designed based on the nucleotide sequence of the rat CRF- R1 (11) and synthesized with BamHI and HindIII linkers at their 5' ends to facilitate cloning. The primer sequences were sense primer: 5' CCGGATCCACAAACAATGGCTACCGGGAG and antisense primer: 5' GGAAGCTTACACCCCAGCCAATGCAGAC. The sense and antisense primers corresponded to 327–347 base and 803–783 base of CRF-R1, respectively. After RT using rat brain RNA, the antisense primer and rTth DNA polymerase (Perkin Elmer Cetus, Norwalk, CT), PCR was performed for 30 cycles at 95 C for 1 min, at 55 C for 2 min, and at 72 C for 2 min. The PCR product was subcloned into Bluescript plasmid (Stratagene). Sequence analysis revealed that the PCR product was identical to 327–803 base of CRF-R1. Radioactive cRNA was synthesized by in vitro transcription of the BamHI-digested subclone using T3 RNA polymerase (Stratagene). The size of the final cRNA probe was 528 base. The restriction enzymes were purchased from Takara Shuzo, Co. (Kyoto, Japan). The labeled ß-actin probe was synthesized from plasmid pMY869, a derivative of pMFb A-1 (25).

Statistical analysis

All values are expressed as means ± SEM. Statistical analysis was performed by one-way ANOVA, followed by Duncan’s multiple range test. P < 0.05 was accepted as statistically significant.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Effect of r/hCRF and Dex on CRF-R1 mRNA in cultured hCA cells

Northern blot analysis using the rat CRF-R1 probe revealed a main hybridization band of 2.7 kilobases (kb) in hCAs from all 10 patients with Cushing’s disease. The size of the band did not change after the treatment with r/hCRF or Dex. Samples of autoradiogram (cases 1 and 2 in Table 1Go) are shown in Fig. 1Go. After a 16-h incubation with 10 nmol/L r/hCRF, the CRF-R1 mRNA level increased to 118–960% of the basal level in hCA cells from 9 of 10 patients (Table 1Go and Fig. 1Go). In case 10 (Fig. 5Go), effects of CRF were not tested. Treatment with 10 µg/dL of Dex decreased the CRF-R1 mRNA level to 31–55% of the basal level after 16 h in all 3 hCAs tested (Table 1Go and Fig. 1Go).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 1. Effects of CRF, Dex, and AVP on CRF-R gene expression in cultured hCA cells. Samples of Northern blot analysis of CRF-R1 mRNA are shown (cases 1 and 2 in Table 1Go). Arrows indicate CRF-R1 mRNA. ß-actin mRNA levels are shown as control. After 16 h incubation with 10 nmol/L r/hCRF, CRF-R1 mRNA level increased in hCA cells. Treatment with 10 µg/dL Dex caused a decrease in mRNA level. Coaddition of 10 nmol/L AVP inhibited CRF induced increase in CRF-R1 mRNA (right).

 


View larger version (22K):
[in this window]
[in a new window]
 
Figure 5. Effect of AVP on CRF-R gene expression in cultured hCA cells. Samples of Northern blot analysis of CRF-R1 mRNA (left) and relative changes in CRF-R1 mRNA levels compared with control values (right) are shown (case 10, not described in Table 1Go). ß-actin mRNA levels are shown as control. A similar result was obtained with hCA cells from another patient.

 
Effect of r/hCRF on CRF-R1 mRNA in cultured rat AP cells

Northern blot analysis using the rat CRF-R1 probe revealed a main hybridization band of 2.7 kb in rat AP cells, the size of which was unchanged after the following treatment (Fig. 2Go). Treatment with 10 nmol/L r/hCRF significantly reduced CRF-R1 mRNA levels within 1 h after the addition of CRF. The mRNA level fell to 30% of the basal level at 2 h after the treatment, remained reduced for 4 h, and recovered to the control level after 8–16 h (Fig. 2Go).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 2. Effect of 10 nmol/L CRF on CRF-R gene expression in cultured rat AP cells. A sample of Northern blot analysis of CRF-R1 mRNA (left) and relative changes in CRF-R1 mRNA levels compared with control values (right) are shown. ß-actin mRNA levels are shown as control. Values are mean ± SEM (n = 6 combined from three totally independent experiments). *, P < 0.05 vs. control value.

 
Time course study in hCA cells (Fig. 3Go)

Because the CRF-R1 mRNA decreased with CRF in rat AP cells, whereas that in hCA cells increased 16 h after the treatment with CRF, detailed time course studies were carried out in hCA cells. The expression level of the CRF-R1 mRNA significantly increased at 1 h, reached 15-fold the basal level at 8 h, and remained elevated at 24 h after the addition of 10 nmol/L r/hCRF in hCA cells.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 3. Time course study of effect of 10 nmol/L CRF on CRF-R gene expression in cultured hCA cells. A sample of Northern blot analysis of CRF-R1 mRNA (left) and relative changes in CRF-R1 mRNA levels compared with control values (right) are shown (case 4 in Table 1Go). Values are mean ± SEM (n = 3 at each point). ß-actin mRNA levels are shown as control. *, P < 0.05 vs. control value. A similar result was obtained with hCA cells from another patient.

 
Dose-dependent study in hCA cells

With a 16-h incubation, the CRF-R1 mRNA level significantly increased in a dose-dependent manner. The CRF-R1 mRNA levels increased to 160%, 245%, and 308% of the basal level with 0.1, 1, or 10 nmol/L r/hCRF, respectively (Fig. 4Go). In the case shown in Fig. 4Go (case 5 in Table 1Go), additional hybridization bands larger than the main 2.7-kb band were detected. Only the main bands were quantified and expressed in the right panel of Fig. 4Go.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 4. Dose-related effect of 0.1–10 nmol/L CRF on CRF-R gene expression in cultured hCA cells after a 16-h incubation. A sample of Northern blot analysis of CRF-R1 mRNA (left) and relative changes in CRF-R1 mRNA levels compared with control values (right) are shown (case 5 in Table 1Go). ß-actin mRNA levels are shown as control. Values are mean ± SEM (n = 3 at each point). *, P < 0.05 vs. control value. Representative results were obtained with hCA cells from another two patients.

 
Effect of AVP on CRF-R1 mRNA in hCA cells

CRF-R1 mRNA levels decreased with AVP in cultured hCA cells. Treatment with 0.1 nmol/L AVP caused a decrease in the CRF-R1 mRNA levels to 26% of the basal level within 6 h (Fig. 5Go). In the experiment shown in Fig. 5Go, the ACTH levels in the incubation media were 254, 320, 393, and 449 ng/mL with 0, 0.1, 1, and 10 nmol/L AVP, respectively. As shown in Fig. 1Go (right), coaddition of AVP inhibited the CRF-induced increase in the CRF-R1 mRNA.


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
CRF is the principal stimulator of the synthesis and release of ACTH in AP (1, 26). Because CRF-Rs play a key role in this regulation, to determine the mechanism controlling the number of CRF-R on corticotrophs is of prime importance. Binding studies have revealed that CRF down-regulates the number of CRF-binding sites in the rat AP (4–6, 27). Internalization of the receptor-ligand complex into corticotrophs may account for this down-regulation (8, 28), but changes in the CRF-R1 mRNA level may also be involved (29). Other corticotroph regulators, such as vasopressin and glucocorticoid, also have been reported to modulate the number of CRF-binding sites in the rat AP (2, 6, 7, 8).

Since cDNAs encoding a human pituitary (10) and a rat brain (11) CRF-R, CRF-R1, were cloned, several investigators including us have described the regulation of CRF-R1 gene expression in the rat AP (29–32). However, there have been no studies in humans. In this study, we examined the regulation of CRF-R1 mRNA in hCAs by Northern blot analysis.

Northern blot hybridization using a rat CRF-R1 probe revealed a main hybridization band of 2.7 kb in all the RNA samples extracted from the hCA cells obtained from 10 patients with Cushing’s disease. The size of the band is the same as that described in a previous study on human CRF-R1 (10). These results, together with the high homology between the cDNA sequences of the rat and human CRF-R1, indicate that the main 2.7-kb band denotes CRF-R1 mRNA. In addition to the main band, much weaker bands were detected at positions of 2.1 and 1.6 kb in most cases. The density levels of these bands did not change in parallel with the main band level, suggesting that these bands are nonspecific. In hCA cells from a patient (case 5), two more bands larger than the main band were also observed. As the levels of the larger bands appear to increase with CRF (Fig. 4Go), these bands may indicate other sizes of CRF-R1 transcripts. To identify the nature of the two groups of the additional bands, preparation of poly(A) RNA samples can be helpful, but hCA tissue was not sufficient. The CRF-R1 mRNA level was estimated by the density level of the main band.

Treatment with Dex caused a decrease in the CRF-R1 mRNA level (Fig. 1Go and Table 1Go). This regulation is in the same direction as that observed in rat AP cells (29, 32). Glucocorticoid suppression of CRF-R1 gene expression in corticotrophs might be involved in the feedback mechanisms in the hypothalamo-pituitary-adrenal axis, even though the major effects of glucocorticoids are suppression of the release and synthesis of CRF and ACTH. AVP also exerted a significant suppressive effect on the CRF-R1 mRNA level in hCA cells (Fig. 5Go). This negative regulation is again in the same direction as that observed in rat AP cells (29). On the other hand, treatment with r/hCRF caused a significant increase in the CRF-R1 mRNA level in the hCA cells in a time- and dose-dependent manner (Figs. 3Go and 4Go), whereas r/hCRF induced a significant decrease in CRF-R1 mRNA levels in rat AP cells (Fig. 2Go). It is quite interesting that only CRF regulates CRF-R1 gene expression in hCA in an opposite manner to that in rat AP. This divergent regulation by CRF may be attributed to different hormonal environment in vivo, or to intrinsic differences between the two types of corticotrophs, including the species difference or different cell types, i.e. normal vs. tumor cells. In Cushing’s disease, plasma glucocorticoid levels are elevated and portal CRF levels are depleted. As only CRF showed the divergent effects in the two types of cultures, the CRF depletion in vivo could be a putative environmental factor that affected the results in hCA cells in vitro. If it is hypothesized that minimal or physiological levels of CRF are required for the CRF-R1 gene expression, CRF-R1 gene transcription would be stimulated with CRF in hCA cells, whereas the additional CRF could decrease the CRF-R1 mRNA level in rat AP cells in which basal transcription was maintained in vivo. However, this possibility is less likely because the hCA and rat AP cells were cultured for 3–5 days before experiments in the same conditions with 10% FCS. Species difference may result in the different regulation of the CRF-R1 mRNA level by CRF. However, in early phase of hypothalamic damage, i.e. CRF deficiency, the patients show exaggerated plasma ACTH responses to CRF administration (33). This fact suggests that CRF down-regulates CRF-R1 in normal human corticotrophs. Consequently, an intrinsic difference(s) that follows the neoplastic change of corticotrophs may play the most important role in the different regulation of CRF-R1 by CRF. Grino et al. (34) demonstrated that ACTH release from hCA cells did not become desensitized during long-term exposure to r/hCRF; this can be a collaboration of up-regulation of the CRF-R1 mRNA by CRF in hCA cells. If the up-regulation of the CRF-R1 mRNA level by CRF is dependent on any intrinsic characters of hCA cells, CRF-R1 gene expression in hCA would be stimulated by elevation of the portal CRF level in patient with Cushing’s disease after bilateral adrenalectomy, which might play a role in the initiation or progression of Nelson’s syndrome.

In conclusion, we detected CRF-R1 mRNA in hCAs from all the 10 patients with Cushing’s disease and revealed that the CRF-R1 mRNA level was up-regulated by CRF itself in hCA cells, in contrast to the down-regulation in rat AP cells.


    Acknowledgments
 
We thank Mrs. I. Dobashi for her technical assistance.


    Footnotes
 
1 This work was supported in part by a research grant from the Japanese Ministry of Education, Science and Culture. A part of this study was presented in the 77th Annual Meeting of the Endocrine Society, June 14–17, Washington DC. Back

Received June 14, 1996.

Revised December 23, 1996.

Accepted January 9, 1997.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Abou-Samra A, Harwood J, Catt K. 1987 Mechanisms of action of CRF and other regulators of ACTH release in pituitary corticotrophs. Ann NY Acad Sci. 512:67–84.[Medline]
  2. Wynn PC, Harwood JP, Catt KJ, Aguilera G. 1985 Regulation of corticotropin-releasing factor (CRF) receptors in the rat pituitary gland: effects of adrenalectomy on CRF receptors and corticotroph responses. Endocrinology. 116:1653–1659.[Abstract]
  3. Millan MA, Samra AB, Wynn PC, Catt KJ, Aguilera G. 1987 Receptors and actions of corticotropin-releasing hormone in the primate pituitary gland. J Clin Endocrinol Metab. 64:1036–1041.[Abstract]
  4. Wynn PC, Aguilera G, Morell J, Catt KJ. 1983 Properties and regulation of high-affinity pituitary receptors for corticotropin-releasing factor. Biochem Biophys Res Comm. 110:602–608.[CrossRef][Medline]
  5. Wynn PC, Harwood JP, Catt KJ, Aguilera G. 1988 Corticotropin-releasing factor (CRF) induces desensitization of the rat pituitary CRF receptor-adenylate cyclase complex. Endocrinology. 122:351–358.[Abstract]
  6. Tizabi Y, Aguilera G. 1992 Desensitization of the hypothalamic-pituitary-adrenal axis following prolonged administration of corticotropin-releasing hormone or vasopressin. Neuroendocrinology. 56:611–618.[Medline]
  7. Hauger RL, Millan MA, Catt KJ, Aguilera G. 1987 Differential regulation of brain and pituitary corticotropin-releasing factor receptors by corticosterone. Endocrinology. 120:1527–1533.[Abstract]
  8. Childs GV, Morell JL, Niendorf A, Aguilera G. 1986 Cytochemical studies of corticotropin-releasing factor (CRF) receptors in anterior lobe corticotropes: binding, glucocorticoid regulation, and endocytosis of [biotinyl-Ser1]CRF. Endocrinology. 119:2129–2142.[Abstract]
  9. Grino M, Guillaume V, Boudouresque F, et al. 1988 Characterization of corticotropin-releasing hormone receptors on human pituitary corticotroph adenomas and their correlation with endogenous glucocorticoids. J Clin Endocrinol Metab. 67:279–283.[Abstract]
  10. Chen R, Lewis KA, Perrin MH, Vale WW. 1993 Expression cloning of a human corticotropin-releasing-factor receptor. Proc Natl Acad Sci USA. 90:8967–8971.[Abstract/Free Full Text]
  11. Perrin MH, Donaldson CJ, Chen R, Lewis KA, Vale WW. 1993 Cloning and functional expression of a rat brain corticotropin releasing factor (CRF) receptor. Endocrinology. 133:3058–3061.[Abstract]
  12. Lovenberg TW, Liaw CW, Grigoriadis DE, et al. 1995 Cloning and characterization of a functionally distinct corticotropin-releasing factor receptor subtype from rat brain. Proc Natl Acad Sci USA. 92:836–840.[Abstract/Free Full Text]
  13. Perrin M, Donaldson C, Chen R, et al. 1995 Identification of a second corticotropin-releasing factor receptor gene and characterization of a cDNA expressed in heart. Proc Natl Acad Sci USA. 92:2969–2973.[Abstract/Free Full Text]
  14. Vaughan J, Donaldson C, Bittencourt J, et al. 1995 Urocortin, a mammalian neuropeptide related to fish urotensin I and to corticotropin-releasing factor. Nature. 378:287–292.[CrossRef][Medline]
  15. Kishimoto T, Pearse, II, RV, Lin CR, Rosenfeld MG. 1995 A sauvagine/corticotropin-releasing factor receptor expressed in heart and skeletal muscle. Proc Natl Acad Sci USA. 92:1108–1112.[Abstract/Free Full Text]
  16. Stenzel P, Kesterson R, Yeung W, Cone RD, Rittenberg MB, Stenzel-Poore MP. 1995 Identification of a novel murine receptor for corticotropin-releasing hormone expressed in the heart. Mol Endocrinol. 9:637–645.[Abstract]
  17. Muller OA, Stalla GK, Werder KV. 1980 Corticotropin releasing factor: a new tool for the differential diagnosis of Cushing’s syndrome. J Clin Endocrinol Metab. 57:227–229.[Abstract]
  18. Orth DN, DeBold CR, DeCherney GS, et al. 1982 Pituitary microadenomas causing Cushing’s disease respond to corticotropin-releasing factor. J Clin Endocrinol Metab. 55:1017–1019.[Abstract]
  19. Suda T, Tozawa F, Yamada M, et al. 1988 Effects of corticotropin-releasing hormone and dexamethasone on proopiomelanocortin messenger RNA level in human corticotroph adenoma cells in vitro. J Clin Invest. 82:110–114.
  20. Suda T, Tozawa F, Ushiyama T, et al. 1989 Effects of protein kinase-C-related adrenocorticotropin secretagogues and interleukin-1 on proopiomelanocortin gene expression in rat anterior pituitary cells. Endocrinology. 124:1444–1449.[Abstract]
  21. Suda T, Liotta AS, Krieger DH. 1978 ß-Endorphin is not detectable in plasma from normal human subjects. Science. 202:221–223.[Abstract/Free Full Text]
  22. Suda T, Tozawa F, Dobasi I, et al. 1993 Corticotropin-releasing hormone, proopiomelanocortin, and glucocorticoid receptor gene expression in adrenocorticotropin-producing tumors in vitro. J Clin Invest. 92:2790–2795.
  23. Suda T. 1992 Corticotropin-releasing factor gene expression. Methods Neurosci. 9:23–31.
  24. Suda T, Tozawa F, Yamada M, et al. 1988 Insulin-induced hypoglycemia increases corticotropin-releasing factor messenger ribonucleic acid level in rat hypothalamus. Endocrinology. 123:1371–1375.[Abstract]
  25. Gunning P, Ponte P, Okayama H, Engel J, Blau H, Kedek L. 1983 Isolation and characterization of full-length cDNA clones for human {alpha}-, ß-, {gamma}-actin mRNA: skeletal but not cytoplasmic actins have an amino-terminal cystine that is subsequently removed. Mol Cell Biol. 3:787–795.[Abstract/Free Full Text]
  26. Vale W, Spiess J, Rivier C, Rivier J. 1981 Characterization of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and ß-endorphin. Science. 213:1394–1397.[Free Full Text]
  27. Hauger RL, Aguilera G. 1993 Regulation of pituitary corticotropin releasing hormone (CRH) receptors by CRH: interaction with vasopressin. Endocrinology. 133:1708–1714.[Abstract]
  28. Leroux P, Pelletier G. 1984 Radioautographic study of binding and internalization of corticotropin-releasing factor by rat anterior pituitary corticotrophs. Endocrinology. 114:14–21.[Abstract]
  29. Sakai K, Horiba N, Sakai Y, Tozawa F, Demura H, Suda T. 1996 Regulation of corticotropin-releasing factor receptor mRNA in rat anterior pituitary. Endocrinology. 137:1758–1763.[Abstract]
  30. Luo X, Kiss A, Rabandan-Diehl C, Aguilera G. 1995 Regulation of hypothalamic and pituitary corticotropin-releasing hormone receptor messenger ribonucleic acid by adrenalectomy and glucocorticoids. Endocrinology. 136:3877–3883.[Abstract]
  31. Makino S, Schulkin J, Smith M, Pacak K, Palkovits M, Gold P. 1995 Regulation of corticotropin-releasing hormone receptor messenger ribonucleic acid in the rat brain and pituitary by glucocorticoids and stress. Endocrinology. 136:4517–4525.[Abstract]
  32. Pozzoli G, Bilezikejian LM, Perrin MH, Blount AL, Vale WW. 1996 Corticotropin-releasing factor (CRF) and glucocorticoids modulate the expression of type 1 CRF receptor messenger ribonucleic acid in rat anterior pituitary cell cultures. Endocrinology. 137:65–71.[Abstract]
  33. Orth DN. 1992 Corticotropin-releasing hormone in humans. Endocr Rev. 13:164–191.[CrossRef][Medline]
  34. Grino M, Boudouresque F, Conte-Devolx B, et al. 1988 In vitro corticotropin-releasing hormone (CRH) stimulation of adrenocorticotropin release from corticotroph adenoma cells: effect of prolonged exposure to CRH and its interaction with cortisol. J Clin Endocrinol Metab. 66:770–775.[Abstract]



This article has been cited by other articles:


Home page
EndocrinologyHome page
K. Kageyama, K. Hanada, T. Nigawara, T. Moriyama, K. Terui, S. Sakihara, and T. Suda
Urocortin Induces Interleukin-6 Gene Expression via Cyclooxygenase-2 Activity in Aortic Smooth Muscle Cells
Endocrinology, September 1, 2006; 147(9): 4454 - 4462.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. Kageyama, K. Hanada, T. Moriyama, T. Nigawara, S. Sakihara, and T. Suda
G Protein-Coupled Receptor Kinase 2 Involvement in Desensitization of Corticotropin-Releasing Factor (CRF) Receptor Type 1 by CRF in Murine Corticotrophs
Endocrinology, January 1, 2006; 147(1): 441 - 450.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. C. Reubi, B. Waser, W. Vale, and J. Rivier
Expression of CRF1 and CRF2 Receptors in Human Cancers
J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 3312 - 3320.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
P. L. M. Dahia and A. B. Grossman
The Molecular Pathogenesis of Corticotroph Tumors
Endocr. Rev., April 1, 1999; 20(2): 136 - 155.
[Abstract] [Full Text]


Home page
Endocr. Rev.Home page
S. L. Asa and S. Ezzat
The Cytogenesis and Pathogenesis of Pituitary Adenomas
Endocr. Rev., December 1, 1998; 19(6): 798 - 827.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
K. D. Dieterich, E. D. Gundelfinger, D. K. Lüdecke, and H. Lehnert
Mutation and Expression Analysis of Corticotropin-Releasing Factor 1 Receptor in Adrenocorticotropin-Secreting Pituitary Adenomas
J. Clin. Endocrinol. Metab., September 1, 1998; 83(9): 3327 - 3331.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sakai, Y.
Right arrow Articles by Suda, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sakai, Y.
Right arrow Articles by Suda, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals