help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kauma, S.
Right arrow Articles by Weatherford, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kauma, S.
Right arrow Articles by Weatherford, S.
The Journal of Clinical Endocrinology & Metabolism Vol. 82, No. 3 949-954
Copyright © 1997 by The Endocrine Society

Reproductive Endocrinology

The Differential Expression of Hepatocyte Growth Factor and Met in Human Placenta1

Scott Kauma, Natalie Hayes and Shannon Weatherford

Departments of Obstetrics/Gynecology and Microbiology/Immunology, Medical College of Virginia/Virginia Commonwealth University, Richmond, Virginia 23298

Address all correspondence and requests for reprints to: Dr. Scott Kauma, Departments of Obstetrics/Gynecology and Microbiology/Immunology, Medical College of Virginia, Box 980034, Richmond, Virginia 23298.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Met is the tyrosine kinase receptor for the ligand hepatocyte growth factor (HGF). Met/HGF plays an important role in epithelial cell proliferation, migration, and morphogenesis. HGF also plays a crucial role in placental development in the mouse. To determine whether HGF potentially has a similar role in human placental development, the production and localization of Met and HGF were determined in early second trimester and term placentas. Reverse transcription-PCR using specific primers demonstrated the expression of Met and HGF messenger ribonucleic acid in placental villi. HGF production was determined by enzyme-linked immunosorbent assay. HGF production over 48 h by second trimester placental villous explants in culture (810 pg/mg total protein·h) was 2.1-fold greater than that in term placental villous explants (380 pg/mg total protein·h; P < 0.01). Isolated trophoblast did not produce HGF, whereas isolated villous core tissues and villous core mesenchymal cells did produce HGF. Interleukin-1ß treatment of placental villi or coculture of villous core mesenchymal cells with isolated trophoblast cells did not stimulate HGF production. Using immunohistochemistry, HGF localized to the villous core compartment with no localization to the trophoblast. In contrast, Met localized mainly to cytotrophoblast. These findings suggest that HGF produced by the villous core may act in a paracrine fashion to regulate trophoblast development or function through the HGF receptor, Met.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
HEPATOCYTE growth factor (HGF) is a pleiotropic cytokine that was first characterized by its ability to promote the proliferation of hepatocytes in vitro (1). Subsequently, HGF was found to play a role in cell proliferation, migration, and morphogenesis in a number of different cell types and tissues (2). The receptor for HGF is a tyrosine kinase receptor and is the product of the c-met protooncogene (3). HGF is mainly produced by fibroblasts and other mesenchymal cell types (2). The production of HGF in fibroblasts is stimulated by interleukin-1 (IL-1) and inhibited by transforming growth factor-ß (4, 5). The HGF receptor, Met, is primarily found in endothelial and epithelial cell types. Mesenchymal cell/epithelial cell paracrine interaction through HGF/Met is known to play an important role in epithelial gland and tubule formation (6).

A potential role for HGF during pregnancy was first suggested in studies demonstrating high levels of HGF messenger ribonucleic acid (mRNA) expression and extractable HGF protein in human placentas (7). The importance of HGF in mammalian pregnancy was best demonstrated in recent studies using HGF knock-out mice (8). Mice that are heterozygote for the HGF knock-out gene appear normal. Homozygote HGF knock-outs, however, are lethal to the developing mouse embryos at 13–15 days gestation. These embryos have small placentas, with a lack of trophoblast growth and embryonic vessel development in the labyrinth area of the placenta. In addition, HGF stimulated the growth of both normal and HGF knock-out murine placental explants in vitro. These studies demonstrate a critical role for HGF in normal murine placental growth and development.

To determine whether HGF/Met has the potential to play a similar role in human placental growth and development, we determined the source of placental HGF during pregnancy and the regulation of HGF production by trophoblast cells and IL-1ß. In addition, we examined the potential for HGF action in the placenta by determining the expression of placental Met by Western analysis and reverse transcription-PCR (RT-PCR) and by immunohistochemically localizing cells in the placenta that expressed Met.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
The protocol for this study was approved by the institution’s committee for the conduct of human research before obtaining any tissue samples. Term placentas (n = 6) were obtained from patients (37–40 weeks gestation) undergoing uncomplicated repeat cesarean section. Early second trimester placentas (14–20 weeks; n = 6) were obtained from patients undergoing elective surgical pregnancy terminations. Placental villous explants were cultured as previously described (9). The rational for using tissues from normal patients undergoing surgical termination of their pregnancies (either via dilation and curettage or cesarean section) was to eliminate the potential compounding variables that labor or other abnormalities of pregnancy would introduce into the study. Immediately after obtaining the placenta, placental villi were dissected free from the decidua basalis or adherent decidua. The placental villi were minced into small pieces and rinsed free of blood.

To determine the production of HGF in early second trimester and term placenta, 500 mg wet weight placental villi were cultured in duplicate in 5 mL DMEM with 10 mmol L-glutamine, 100 mIU/mL penicillin, and 100 µg/mL streptomycin, pH 7.4 (DMEM; Sigma Chemical Co., St. Louis, MO) for 48 h, and the medium was sampled over this time period and stored at -20 C until assayed for HGF. To determine whether IL-1ß regulates the production of HGF, term placental explants were treated with 0.1–100 ng/mL IL-1ß (generous gift from the Immunex Corp., Seattle, WA) for 24 h, and the medium was sampled and stored at -20 C until assayed for HGF production. Statistical analysis comparing the different levels of HGF in the conditioned medium was performed using two-way ANOVA for repeated measures and the Student-Newman-Keuls post-hoc test.

To determine the production of HGF in the different placental villous compartments, villous core tissue and trophoblast cells were separated as previously described from term placental villi (10). Briefly, up to 15 g coarsely minced placental villi were digested in 15 mL CR-Dispase (Collaborative Research, Bedford, MA) for 15 min at 37 C. The trophoblast and villous core were then separated by gravity sedimentation. The trophoblast compartment was further purified by Percol equilibrium gradient centrifugation. Greater than 95% of the isolated trophoblast cells were cytokeratin positive by immunohistochemical staining. Isolated trophoblast (5–7 x 106 cells) or villous core (350 mg wet weight tissue) were placed on Millicell-HA platforms (Millipore Products Division, Bedford, MA) and cultured in 5 mL DMEM at 37 C in 5% CO2-air. The medium was sampled at 48 h of culture and stored at -20 C until assayed for HGF production. To standardize HGF protein production, cells and tissues were transferred to a Ten-Broeck homogenizer and ground with 20 strokes. The protein concentration in each specimen was determined by the method of Bradford, using a Coomassie protein assay kit (Pierce Chemical Co., Rockford, IL) and albumin as the standard. Statistical analysis comparing the different levels of HGF in the conditioned medium was performed using one-way ANOVA and the Student-Newman-Keuls post-hoc test.

Villous core fibroblasts were isolated as previously described (10) by further enzymatic digestion of second trimester villous core with 2 mg/mL collagenase (Sigma Chemical Co.) in {alpha}MEM (Life Technologies, Grand Island, NY) for 20 min at 37 C. Primary cell cultures were established in {alpha}MEM containing 20% FCS (Sigma Chemical Co.) in 25-cm2 culture flasks (Becton Dickinson Co., Oxnard, CA), grown to confluence (7–10 days), and passed into 75-cm2 flasks (Becton Dickinson Co.) in MEM{alpha} with 10% FCS. Immunohistochemical staining of confluent cell cultures was performed as previously described (10) and showed greater than 95% vimentin-positive cells, with little to no cytokeratin-positive cells, thereby indicating a negligible amount of trophoblast contamination of the cultures. Staining with CD-45 revealed a small proportion (<5%) of positive cells.

Experiments were performed to determine whether trophoblast cells stimulate the production of HGF by isolated villous core fibroblasts. Isolated villous core fibroblasts (500,00 cells, second passage) were plated into 4.5-cm2 culture dishes in 5 mL {alpha}MEM with 10% FCS. This gives an initial plating density of cells that is semiconfluent to confluent. Approximately 6 h later, the medium was replaced with fresh medium, and isolated trophoblast cells (500,000) were added on top of the fibroblasts. In addition, villous core fibroblasts and isolated trophoblast cells (500,000/well) were cultured separately. The cells were cultured for 72 h, and the medium was then recovered and stored at -20 C until assayed for HGF. Statistical analysis comparing the different levels of HGF in the conditioned medium was performed using one-way ANOVA and the Student-Newman-Keuls post-hoc test.

A sandwich enzyme-linked immunosorbent assay (ELISA) for human HGF was developed in our laboratory using commercially available reagents. Polystyrene 96-well plates (Costar Corp., Cambridge, MA) were coated with mouse monoclonal antibody to human HGF (R&D Systems, Minneapolis, MN) at a concentration of 2 µg/mL in 0.2 mol/L Na2CO3 buffer, pH 9.6, for 18–22 h at 4 C. The plates were washed with phosphate-buffered saline with 0.5% Tween-20 (PBST) and blocked with 1% BSA (Sigma Chemical Co.) in phosphate-buffered saline for 1 h at 37 C. After washing the plates with PBST, 100 µL of the conditioned medium samples in duplicate or human recombinant HGF standard in triplicate (R&D Systems) were added to the plates and incubated at room temperature for 2 h. The plates were then washed with PBST and incubated with 100 µL goat anti-HGF antibody (R&D Systems) at a concentration of 2 µg/mL in PBST for 2 h at room temperature. The plates were washed with PBST and then incubated with 100 µL of a 1:7500 dilution of peroxidase-conjugated mouse antigoat IgG (Pierce Chemical Co.) for 1 h at room temperature. The wells were washed with PBST and developed with a 0.1% O-phenylenediamine dihydrochloride substrate (Sigma Chemical Co.) in 0.1 mol/L citric acid buffer, pH 4.5, with 0.02% H2O2 for 30 min at room temperature. The reaction was stopped by the addition of an equal volume of 2 mol/L H2SO4, and the plates were read at 490 nm in a V-max Kinetic Microplate Reader (Molecular Devices Corp., Palo Alto, CA). The assay sensitivity and range was 240 pg/mL to 60 ng/mL. To validate the assay, samples that were either serially diluted or to which known amounts of the HGF standard were added were compared to the standard curve to demonstrate appropriate parallelism. The within-assay coefficient of variation was 4% at 20 ng/mL, 7% at 4 ng/mL, and 15% at 0.8 ng/mL. All sample comparisons were run in the same assay to eliminate between-assay variability. Medium samples from the IL-1ß dose-response experiments were also assayed for IL-6 using an IL-6 ELISA developed in our laboratory, as previously described (11).

RT-PCR was performed on early (n = 3) and term (n = 3) placental samples by first isolating total RNA from placental villi using the acid guanidinium isothiocyanate-phenol-chloroform extraction method. First strand synthesis was performed on 1 µg total RNA using the specific human c-met or HGF 3'-primers and SuperScript II ribonuclease H- reverse transcriptase (Life Technologies). Yeast RNA (Sigma Chemical Co.) was used as a negative control. The complementary DNA was amplified using the GeneAmp system of DNA amplification (Perkin-Elmer/Cetus, Norwalk, CT). Samples were incubated in a thermocycler (Coy Laboratory Products, Ann Arbor, MI) with oligonucleotide primers and Taq polymerase. Denaturing was carried out at 94 C for 1 min, followed by primer annealing at 58 C (c-met) or 53 C (HGF) for 1 min and primer extension at 72 C for 2 min. After 30 cycles, the amplified product was fractionated in a 1.5% agarose gel by electrophoresis and stained with ethidium bromide for visualization under UV illumination.

The primers were synthesized in the Nucleic Acid Core Facility at Virginia Commonwealth University using an Applied Biosystems 380A DNA synthesizer (Foster City, CA). The sequences of the HGF primers were 5'-191 ggacaaaggaaaagaag 208 and 3'-681 gattgcttgtgaaacacc 664. The sequences of the c-met primers were 5'-226 tcctcgtgctcctgtttacc 245 and 3'-865 tctttcgtttcctttagccttc 844.

To perform Western blot analysis for Met, intact placental villi or isolated trophoblast were homogenized in RIPA buffer (5 mmol Tris, 150 mmol NaCl, 1% Nonidet P-40, 0.5% Na deoxycholate, and 0.1% SDS, pH 7.5). The homogenate was clarified by centrifugation, and the total protein content of the supernate was determined by a Coomassie protein assay using albumin as the standard (Pierce Chemical Co.). For Met Western analysis, 50 µg total cellular protein were fractionated in a denaturing 7.5% SDS-polyacrylamide gel by electrophoresis. The fractionated protein samples were then transferred to nitrocellulose membranes, and nonspecific binding was blocked for 2 h in 5% nonfat dry milk in TBS. The membranes were incubated with 2 µg/mL rabbit IgG antibody (Santa Cruz Biotechnology, Santa Cruz, CA) developed against a synthetic Met peptide. Development of the Western blots was performed using the Amersham ECL system (Amersham Corp., Arlington Heights, IL).

Immunohistochemical staining for HGF was performed on 10-µm frozen sections of placenta postfixed in acetone at 4 C for 10 min. The primary antibody that was used for HGF detection was a goat antihuman HGF antibody (2 µg/mL; R&D Systems). Immunohistochemical staining for Met was performed on formalin-fixed, paraffin-embedded, 5-µm sections of placenta using the rabbit IgG anti-Met antibody (0.5 µg/mL; Santa Cruz Biotechnology). Localization of the primary antibody was performed using the Vectastain Elite kit (Vector Laboratories, Burlingame, CA) and diaminobenzadine as the color substrate. Negative controls included preabsorption of the primary antibody with excess Met peptide (Santa Cruz Biotechnology) or substituting the specific primary antibody with nonspecific antibody of the same type and concentration.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Initial studies using RT-PCR demonstrated the expression of both HGF and c-met mRNA in all placental samples tested from both early and term pregnancies. The predicted RT-PCR product size for HGF (490 bp) and c-met (639 bp) was readily seen after electrophoresis in 1.5% agarose gels and staining with ethidium bromide (Fig. 1Go).



View larger version (62K):
[in this window]
[in a new window]
  		Figure 1. RT-PCR of placental RNA for HGF and c-met. An ethidium bromide-stained gel shows the predicted size bands of 490 bp for HGF and 639 bp for c-met from a representative term placental sample. Yeast RNA was used as a negative control.

 
The placenta readily produces and secretes HGF. Both early second trimester and term placental villi demonstrated steady linear production of HGF in vitro over the 48-h culture period (Fig. 2Go). The production rate of HGF was 2.1-fold higher in early second trimester placenta (8.1 ng/h·g tissue) than that in term placenta (3.8 ng/h·g tissue; P < 0.01).



View larger version (18K):
[in this window]
[in a new window]
  		Figure 2. Production of HGF in early second trimester and term placental villous explant cultures. Immunoreactive HGF was measured in the culture medium by ELISA. The early second trimester placental villous production rate of HGF was 2.1-fold higher than that of term placental villi (P < 0.01). The error bars represent the SEM.

 
When isolated trophoblast and villous core tissue from term placentas were cultured separately over 72 h, no detectable HGF was produced by the trophoblast (Fig. 3Go). In contrast, the villous core tissue did produce significant amounts of detectable HGF. Interestingly, intact placental villi produced 24-fold more HGF (P < 0.001) than did isolated villous core tissue.



View larger version (17K):
[in this window]
[in a new window]
  		Figure 3. HGF production over 72 h standardized to total tissue protein in term placental samples. Immunoreactive HGF was measured in the culture medium by ELISA. The site of HGF production is the villous core, as there was no HGF measured in trophoblast-conditioned medium, whereas all villous core samples had detectable HGF. Compared to intact placental villi (whole tissue), villous core produced 24-fold less HGF (P < 0.001). Note that the HGF axis is logarithmic. The bars represent the mean and SEM for each experimental group.

 
Because placental villous core tissue produced less HGF than intact placental villi, coculture experiments with isolated trophoblast and placental villous core fibroblasts from early pregnancies were performed to determine whether trophoblast stimulate villous core fibroblasts HGF production. As seen in the previous experiments, trophoblast did not produce any detectable HGF, whereas all villous core fibroblast samples produced significant amounts of detectable HGF (1.49 ng/mL). No significant stimulatory effect was seen in villous core fibroblast HGF production (1.51 ng/mL) with the addition of trophoblast cells (Fig. 4Go). In addition, IL-1ß did not stimulate the production of HGF in intact term placental villi (Fig. 5Go). In the same samples, however, IL-1ß did stimulate the production of IL-6 in a dose-dependent fashion.



View larger version (18K):
[in this window]
[in a new window]
  		Figure 4. Studies were performed to determine whether trophoblast cells stimulate the production of HGF by placental villous core fibroblasts in early gestation placental samples. Trophoblast and villous core fibroblasts (500,000 cells/well) were cultured separately and together for 72 h, and the medium was then measured for HGF. Immunoreactive HGF was measured in the culture medium by ELISA. Coculture of trophoblast with villous core fibroblasts did not increase HGF production. Trophoblast cells demonstrated no HGF production. The bars represent the mean and SEM for each experimental group.

 


View larger version (19K):
[in this window]
[in a new window]
  		Figure 5. Term placental explants (n = 5) were cultured for 24 h with 0.1–100 ng/mL IL-1ß. The medium was then assayed for immunoreactive HGF and IL-6 by ELISA. IL-1ß stimulated the placental production of IL-6 in a specific dose-response fashion. IL-1ß had no effect on placental HGF production. The bars represent the mean and SEM for each experimental group.

 
Immunohistochemistry of HGF in both early second trimester and term placenta demonstrated diffuse localization to the villous core. There was no evidence of localization of HGF to the trophoblast (Fig. 6AGo). In contrast, placental Met was primarily localized to placental cytotrophoblast and, to a lesser degree, syncytiotrophoblast and isolated cells in the villous core (Fig. 6CGo). Western blot analysis confirmed the presence of Met in both intact placental villi and isolated trophoblast cells (Fig. 7Go). Both trophoblast cells and intact placental villi demonstrated the expected 140-kDa band representing the ß-subunit of the 190-kDa {alpha}ß heterodimeric Met protein. An additional band of approximately 100–110 kDa was seen in intact placental villous tissues, but not in trophoblast. This probably represents an alternate transmembrane Met protein, which is known to have tyrosine kinase activity and is encoded by a 7-kilobase mRNA transcript (12).



View larger version (112K):
[in this window]
[in a new window]
  		Figure 6. Immunohistochemical staining for HGF and Met. A, HGF and Met is localized to the villous core in a 16-week gestation placental sample. No staining is seen in cytotrophoblast or syncytiotrophoblast. B, Negative control using nonspecific goat IgG as the primary antibody. Preabsorption of the anti-HGF antibody with HGF gives identical results. C, Staining for Met in a 19-week placenta was seen primarily in cytotrophoblast cells (arrows). Occasional cells in the villous core also stained for Met. D, Negative control for Met using nonspecific rabbit IgG as the primary antibody. Preabsorption of the anti-Met antibody with synthetic Met peptide gave identical results.

 


View larger version (34K):
[in this window]
[in a new window]
  		Figure 7. Western blot analysis for Met of trophoblast and intact placental villous protein homogenates in a representative term placental sample. Both trophoblast and placenta demonstrated the expected 140-kDa band, with an additional 100- to 110-kDa band found in the placental tissue.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In this study, we have shown that the placenta produces HGF, and the site of HGF production is the villous core. In trophoblasts, however, the absence of immunohistochemical staining and the lack of in vitro production suggest that these cells do not produce HGF. These findings are consistent with in situ hybridization studies that localized HGF mRNA expression to the placental villous core, but not to the trophoblast (13). Our study, which demonstrated HGF production by isolated villous core fibroblasts cells, supports previous findings that placental villous core fibroblasts produce bioactive scatter factor in vitro (14). As HGF and scatter factor are, in fact, the same protein encoded by the same gene, the scatter factor bioactivity seen in that study was probably due to the HGF produced by those cells. Although one early study found immunohistochemical localization of HGF to trophoblast and attributed these findings to production of HGF in these cells (7), the findings in our study and others do not support this hypothesis. Finally, our study found that placental HGF production was significantly higher during the early second trimester compared to that by term placenta. This is consistent with findings of higher levels of HGF in amniotic fluid from early second trimester pregnancies compared to term pregnancies (15) and suggests that the placenta is a significant source of amniotic fluid HGF.

In contrast to placental HGF expression, Met is mainly expressed in cytotrophoblast and, to a lesser degree, in syncytiotrophoblast and isolated cells in the villous core. These findings suggest that HGF/Met may play a role in trophoblast proliferation. Support for this hypothesis can be found in a study that demonstrated increased [3H]thymidine incorporation in trophoblast cultured with HGF, although actual cell proliferation was not shown (13). Finally, the decreased expression of Met seen in differentiated syncytiotrophoblast compared to cytotrophoblast stem cells suggests that down-regulation of Met in cytotrophoblast may play a role in trophoblast differentiation. The localization of Met to cells in the villous core also suggests the possibility of a local autocrine/paracrine action of villous core HGF production. One possible role could be in the regulation of placental fibroblast proliferation, as HGF can regulate the proliferation of 3T3 fibroblasts that express Met (16).

Factors that regulate placental HGF production remain unclear. An interesting finding in this study was intact placental villi produced 24-fold more HGF than did isolated villous core. This would suggest that removing trophoblast from the villous core also removes factors produced by trophoblast that stimulate villous core HGF production. Unfortunately, coculture experiments of isolated trophoblast with villous core fibroblasts in this study did not demonstrate stimulation of HGF production in villous core fibroblasts. One possible explanation for this finding is that the isolation of cytotrophoblast cells from the placental villi initiates a process in these cells resulting in their differentiation into syncytotrophoblast (17). If nondifferentiating cytotrophoblast stem cells in intact placental villi are responsible for regulating villous core fibroblast HGF production, these studies would not be able to demonstrate this effect.

IL-1 is known to stimulate both HGF and IL-6 production in fibroblasts from different tissues (4, 18). We have previously shown that IL-1 plays a role in stimulating the production of colony-stimulating factor-1 (CSF-1), granulocyte CSF, and IL-6 in isolated placental villous core mesenchymal cells (19, 20, 21). In this study, IL-1ß stimulated IL-6 production in intact placental villi. However, no effect by IL-1ß on placental villous HGF production was found. Similar results were found with isolated villous core fibroblasts (data not shown). One possible explanation for the lack of IL-1 stimulation of HGF production is that the placenta produces transforming growth factor-ß1, which is known to inhibit IL-1 induction of HGF production (5). Inhibition of transforming growth factor-ß using neutralizing antibodies would be one approach to test this hypothesis. It is evident that the regulation of HGF production in the placenta may not be identical to that in previously described systems and warrants further investigation.

This study and previous reports demonstrate that the placental villous core is an important endocrine tissue during pregnancy. In addition to HGF, the placental villous core is the main site of CSF-1, granulocyte CSF, IL-6, and stem cell factor production in the placenta (19, 20, 21, 22). Given the fact that Met is primarily expressed on trophoblast cells, as are other hematopoietic growth factor receptors, the placental villous core probably plays an important role in the regulation of trophoblast growth and function.


   Footnotes
 
1 This work was supported by NIH Grant HD-29023. Back

Received August 2, 1996.

Revised November 8, 1996.

Accepted November 22, 1996.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Michalopoulos G, Houck KA, Dolan ML, Dolan ML. 1984 Control of hepatocyte replication by two serum factors. Cancer Res. 44:4414–4419.[Abstract/Free Full Text]
  2. Rubin JS, Donald P, Aaronson SA. 1993 Hepatocyte growth factor/scatter factor and its receptor, the c-met proto-oncogene product. Biochim Biophys Acta. 1155:357–371.[Medline]
  3. Morag P, Michael D, Karen K, Braun MJ, Gonda MA, Vande Woude G. 1987 Sequence of met protooncogene cDNA has features characteristic of the tyrosine kinase family of growth-factor receptors. Proc Natl Acad Sci USA. 84:6379–6383.[Abstract/Free Full Text]
  4. Matsumoto K, Okazaki H, Nakamura T. 1992 Up-regulation of hepatocyte growth factor gene expression by interleukin-1 in human skin fibroblasts. Biochem Biophys Res Commun. 188:235–243.[CrossRef][Medline]
  5. Gohda E, Matsunaga T, Kataoka, Yamamoto I. 1992 TGF-ß is a potent inhibitor of hepatocyte growth factor secretion by human fibroblasts. Cell Biol Int Rep. 16:917–926.[Medline]
  6. Tsarfaty I, Resau RH, Rulong S, Keydar I, Faletto D, Vande Woude G. 1992 The met proto-oncogene receptor and lumen formation. Science. 257:1258–1261.[Abstract/Free Full Text]
  7. Wolf HK, Zarnegar R, Oliver L, Michalopoulos GK. 1991 Hepatocyte growth factor in human placenta and trophoblastic disease. Am J Pathol. 138:1035–1043.[Abstract]
  8. Uehara Y, Minowa O, Mori C, et al. 1995 Placental defect and embryonic lethality in mice lacking hepatocyte growth factor/scatter factor. Nature. 373:702–705.[CrossRef][Medline]
  9. Kauma S. 1993 Interleukin-1ß stimulates colony-stimulating factor-1 production in human term placenta. J Clin Endocrinol Metab. 76:701–793.[Abstract]
  10. Kauma S, Walsh S, Nestler T, Turner T. 1992 Interleukin-1 is induced in the human placenta by endotoxin and isolation procedures for trophoblasts. J Clin Endocrinol Metab. 75:951–955.[Abstract]
  11. Kauma S, Turner T, Harty J. 1994 Interleukin-1ß stimulates interleukin-6 production in placental villous core mesenchymal cells. Endocrinology. 134:457–460.[Abstract]
  12. Rodrigues GA, Park M. 1993 Isoforms of the met receptor tyrosine kinase. In: Goldberg ID, Rosen EM, eds. Hepatocyte growth factor-scatter factor and the c-met receptor. Basel: Birkhauser Verlag Basel; 167–179.
  13. Saito S, Sakakura S, Enomoto M, Ichijo M, Matsumoto K, Nakamura T. 1995 Hepatocyte growth factor promotes the growth of cytotrophoblasts by the paracrine mechanism. J Biochem. 117:671–676.[Abstract/Free Full Text]
  14. Rosen E, Meromsky L, Romero R, Setter E, Goldberg I. 1990 Human placenta contains an epithelial scatter protein. Biochem Biophys Res Commun. 168:1082–1088.[CrossRef][Medline]
  15. Horibe N, Okamoto T, Itakura A, et al. 1995 Levels of hepatocyte growth factor in maternal serum and amniotic fluid. Am J Obstet Gynecol. 173:937–942.[CrossRef][Medline]
  16. Rong S, Oskarsson M, Faletto DL, et al. 1993 Tumorigenesis induced by co-expression of human hepatocyte growth factor and the human met protooncogene leads to high levels of expression of the ligand and receptor. Cell Growth Diff. 4:563–569.[Abstract]
  17. Klinman H, Nestler J, Sermasi E, Sanger J, Strauss J. 1986 Purification, characterization, and in vitro differentiation of cytotrophoblasts from human term placenta. Endocrinology. 188:1567–1581.
  18. Le J, Vilcek J. 1989 Interleukin 6: a multifunctional cytokine regulating immune reactions and the acute phase protein response. Lab Invest. 61:588–602.[Medline]
  19. Harty J, Kauma S. 1992 Interleukin-1ß stimulates colony-stimulating factor-1 production in placental villous core mesenchymal cells. J Clin Endocrinol Metab. 75:947–950.[Abstract]
  20. Vandermolen T, Kauma S, Turner T. 1996 1996 Interleukin-1ß and tumor necrosis factor-{alpha} stimulate granulocyte colony-stimulating factor production by placental villous core mesenchymal cells. J Soc Gynecol Invest. 3:172.[CrossRef][Medline]
  21. Kauma S, Herman Y, Wang Y, Walsh SW. 1993 Differential mRNA expression and production of interleukin-6 in placental trophoblast and villous core compartments. Am J Reprod Immunol. 30:131–135.
  22. Kauma S, Huff T, Krystal G, Ryan J, Takacs P, Turner T. 1996 The expression of stem cell factor and its receptor c-kit in human endometrium and placental tissues during pregnancy. J Clin Endocrinol Metab. 81:1261–1266.[Abstract]



This article has been cited by other articles:


Home page
 Hum Reprod UpdateHome page
C. Ferretti, L. Bruni, V. Dangles-Marie, A.P. Pecking, and D. Bellet
Molecular circuits shared by placental and cancer cells, and their implications in the proliferative, invasive and migratory capacities of trophoblasts
Hum. Reprod. Update, March 1, 2007; 13(2): 121 - 141.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
P. Murthi, V. Doherty, J. Said, S. Donath, S. P. Brennecke, and B. Kalionis
Homeobox Gene HLX1Expression Is Decreased in Idiopathic Human Fetal Growth Restriction
Am. J. Pathol., February 1, 2006; 168(2): 511 - 518.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
M. Hayashi, M. Sakata, T. Takeda, M. Tahara, T. Yamamoto, Y. Okamoto, R. Minekawa, A. Isobe, M. Ohmichi, K. Tasaka, et al.
Up-Regulation of c-met Protooncogene Product Expression through Hypoxia-Inducible Factor-1{alpha} Is Involved in Trophoblast Invasion under Low-Oxygen Tension
Endocrinology, November 1, 2005; 146(11): 4682 - 4689.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. Lecuit, D. M. Nelson, S. D. Smith, H. Khun, M. Huerre, M.-C. Vacher-Lavenu, J. I. Gordon, and P. Cossart
Targeting and crossing of the human maternofetal barrier by Listeria monocytogenes: Role of internalin interaction with trophoblast E-cadherin
PNAS, April 20, 2004; 101(16): 6152 - 6157.
[Abstract] [Full Text] [PDF]

Home page
 J. Histochem. Cytochem.Home page
I. Iida, K. Johkura, R. Teng, S. Kubota, L. Cui, X. Zhao, N. Ogiwara, Y. Okouchi, K. Asanuma, J. Nakayama, et al.
Immunohistochemical Localization of Hepatocyte Growth Factor Activator (HGFA) in Developing Mouse Liver Tissues: Heterogeneous Distribution of HGFA Protein
J. Histochem. Cytochem., September 1, 2003; 51(9): 1139 - 1149.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
A. Dokras, L. M.G. Gardner, E. A. Seftor, and M. J.C. Hendrix
Regulation of Human Cytotrophoblast Morphogenesis by Hepatocyte Growth Factor/Scatter Factor
Biol Reprod, October 1, 2001; 65(4): 1278 - 1288.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
K. Nasu, T. Sugano, N. Matsui, H. Narahara, Y. Kawano, and I. Miyakawa
Expression of Hepatocyte Growth Factor in Cultured Human Endometrial Stromal Cells Is Induced through a Protein Kinase C-Dependent Pathway
Biol Reprod, May 1, 1999; 60(5): 1183 - 1187.
[Abstract] [Full Text]

Home page
 Am. J. Pathol.Home page
D. A. Somerset, X.-F. Li, S. Afford, A. J. Strain, A. Ahmed, R. K. Sangha, M. J. Whittle, and M. D. Kilby
Ontogeny of Hepatocyte Growth Factor (HGF) and Its Receptor (c-met) in Human Placenta : Reduced HGF Expression in Intrauterine Growth Restriction
Am. J. Pathol., October 1, 1998; 153(4): 1139 - 1147.
[Abstract] [Full Text] [PDF]

Home page
 Reproductive SciencesHome page
M. Lail-Trecker, R. Gulati, and J. J. Peluso
A Role for Hepatocyte Growth Factors/Scatter Factor in Regulating Normal and Neoplastic Cells of Reproductive Tissues
Reproductive Sciences, May 1, 1998; 5(3): 114 - 121.
[Abstract] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
D. A. Somerset, M. D. Kilby, A. J. Strain, and S. Afford
Differential Expression of HGF and Met in Human Placentai
J. Clin. Endocrinol. Metab., April 1, 1998; 83(4): 1400a - 1401.
[Full Text]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kauma, S.
Right arrow Articles by Weatherford, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kauma, S.
Right arrow Articles by Weatherford, S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals