| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Letters to the Editor |
The Johns Hopkins School of Medicine Baltimore, Maryland 21287
The sex determining region Y gene (SRY) triggers testis determination (1). In the recent past, it has been shown that mutations of the SRY gene could result in the syndrome of pure gonadal dysgenesis. However, it has also been observed that, in most cases of gonadal dysgenesis, whether complete or partial, no SRY mutation could be detected (reviewed in 2).
Recently, Braun et al. (3) reported a 46,XY true hermaphrodite who had a mutation of SRY in gonadal DNA but not in leukocyte DNA, suggesting that the mutation was post-zygotic. Because of this finding, we have attempted to determine whether post-zygotic mutation of SRY might explain the numerous cases of gonadal dysgenesis in whom no SRY mutation was dected in leukocyte DNA. For this purpose we evaluated 16 subjects with 46,XY gonadal dysgenesis who had a normal SRY sequence in leukocyte DNA, 5 of them having 46,XY complete gonadal dysgenesis, the others having a partial form.
Subjects 212 and 217 were published by Hawkins et al. (4), whereas Subjects 232, 236, and 245 were not previously described. All of them had 46,XY complete gonadal dysgenesis. Subject 245 was unusual as she had multiple congenital abnormalities including cleft palate, low set posteriorly rotated ears, hypoplastic mandible, malrotated left foot, and hypoplastic nails. For comparison, three subjects with 46,XY gonadal dysgenesis and an abnormal SRY sequence in leukocyte DNA were also studied. Subjects 207, 208, and 213 had point mutations at base pairs 326, 374, and 380, respectively, in the open-reading frame of SRY (4).
Our studies also included 11 subjects with 46,XY partial gonadal dysgenesis and a normal SRY sequence in leukocyte DNA. Nine of them have been reported elsewhere (214216 and 220 in Ref. 5, and 221, 241 and 247249 in Ref.6). Subjects 252 and 253 have not been reported. Both subjects had bilateral dysgenetic testes and a mix of Wolffian and Müllerian structures. All subjects were investigated in accordance with the guidelines of the Institutional Review Board.
Paraffin-embedded gonadal tissue was obtained for preparation of DNA. One representative five-micron-thick section was stained with hematoxylin and eosin to confirm the location of gonadal tissue. DNA was extracted from unstained tissue using a modification of the method published by Wright and Manos (7). Leukocyte DNA was also available for each of the subjects.
The SRY open reading frame (bp 1668) was amplified in four overlapping fragments using the following primers: SRY-F: 5'GTAACAAAGAATCTGGTAGA3'; SRY-G: 5'TTTCAGTGCAAAGGAAGGAA3'; SRY-H: 5'CTGTGCAAGAGAATATTCCCG3'; SRY-5: 5'GGCTTCAGTAAGCATTTTCCACTGG3'; SRY-C: 5'GGATAGAGTGAAGCGACCCA3'; SRY-D: 5'GGTAAGTGGCCTAGCTGGTG3'; SRY-E: 5'GCACAGAGAGAAATACCCGAA3'. Primers F and G amplified a sequence from bp -40 to bp 172 of the SRY open reading frame; primers H and 5 a sequence from bp 115 to 369, primers C and D the region from bp 227 to 607 and primers E and D the region from bp 413 to 607. These primer pairs amplified regions with a single melting domain appropriate for subsequent analysis of fragments by DGGE. Primers SRY-F and SRY-H carried a 40 bp GC clamp on their 5' ends (8). Primer SRY-D carried a GC clamp on its 3' end.
Amplifications were performed in 50 µL volumes using 2.0 µL of gonadal tissue digest, (or 50 ng of leukocyte DNA), 50 mmol/L KCl, 10 mmol/L Tris-HCl (pH 8.3), 1.5 mmol/L MgCl2, 200 mmol/L each dNTP, 0.1 µM each primer, and 1.25 units of Taq DNA polymerase under standard conditions. If the results of DGGE using these sequences was abnormal, then amplification of sequences and DGGE were repeated after adding 0.25 units of Pfu DNA polymerase to the PCR reaction mixture. Aliquots of the amplified DNA fragments were loaded onto 6.5% polyacrylamide gels with denaturing gradients from 3570% (100% denaturant is 40% formamide and 7 M urea) (9). Samples were subjected to electrophoresis for 10001300 v hrs at 60 C. The gels were stained in ethidium bromide for visualization of DNA.
Preliminary experiments were performed to evaluate the accuracy and sensitivity of DGGE in detection of SRY mutations. DGGE identified abnormalities in leukocyte DNA from each of the 3 individuals with 46,XY complete gonadal dysgenesis whose SRY mutations had been documented earlier by sequence analysis. As expected, the aberrant fragment was detected using primers C and D in subject 207, 208, and 213, and primers H and 5 in subject 213. In subject 213, the abnormality was detected only after addition of PCR product amplified from a normal male and subsequent heteroduplex formation. By contrast, analysis of SRY by DGGE was normal using leukocyte DNA from 16 subjects who had 46,XY gonadal dysgenesis and normal SRY documented by sequence analysis. Finally, DGGE detected abnormalities when mutant SRY was present as only 5% of the total SRY.
When DGGE analysis of individuals with 46,XY complete gonadal dysgenesis was performed using DNA isolated from gonadal tissue of subjects 212, 217, 232, and 245, all fragments had normal melting behavior. When subject 236 was analyzed, faint heteroduplex bands were detected in fragments amplified using SRY primers H and 5, although the migration of the major band was equivalent to that of a normal male. When this PCR amplification was repeated with addition of Pfu DNA polymerase and fragments were subjected to DGGE, the heteroduplex bands were no longer present.
When DGGE analysis of individuals with 46,XY partial gonadal dysgenesis was performed using DNA isolated from gonadal tissue of subjects 216, 220, 221, 241, 249, 252, and 253, all fragments had normal melting behavior. However, faint bands consistent with heteroduplex formation were seen upon initial analysis of fragments SRY C/D of subject 247, SRY H/5 of subject 215, and SRY F/G of subjects 214 and 248. When these fragments were amplified again in the presence of Pfu DNA polymerase and the new PCR products subjected to DGGE, the heteroduplex bands were absent.
We chose DGGE to screen for mutations in the open-reading frame of SRY in DNA from gonadal tissue because it is a sensitive and reliable technique that in general is able to detect 95% of sequence alterations (9, 10). Although a post-zygotic SRY mutation has been reported in one case of 46,XY true hermaphroditism (3), a condition considered as part of the general spectrum of gonadal dysgenesis, we have not found such mutations in gonadal DNA from any of 16 subjects. Hence, our observation that post-zygotic mutations of SRY are a rare cause of 46,XY gonadal dysgenesis.
Acknowledgments
The authors thank Dr. Ken McElreavey for providing a protocol for performance of DGGE, Dr. Michael Levine for assistance with computer simulations of melting behavior, and Drs. Daniel Postellon and Andrew Labie for donating patient material.
This letter was coauthored by LCDR Fuqua, MC, USN while a fellow in Pediatric Endocrinology at the Johns Hopkins University School of Medicine. The views expressed in this letter are those of the authors and do not reflect the official policy or position of the Department of the Navy, Department of Defense, nor the U.S. Government.
Footnotes
1 Address correspondence to: Gary D. Berkovitz, MD, CMSC 3-110, 600 North Wolfe Street,
Baltimore, Maryland 21287-3311. This research was supported by NIH Grant R01-HD-28318. ![]()
Received October 14, 1996.
References
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |