| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Cecil H. and Ida Green Center for Reproductive Biology Sciences and the Departments of Obstetrics-Gynecology and Biochemistry (N.M., S.A.) and Cell Biology and Neuroscience (J.R.H.), University of Texas Southwestern Medical Center, Dallas, Texas 75235
Address all correspondence and requests for reprints to: Stefan Andersson, Ph.D., Green Center for Reproductive Biology Sciences, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, Texas 75235-9051. E-mail: andersson{at}grnctr.swmed.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-hydroxydehydroepiandrosterone sulfate to estriol (1, 2). The site of 16-hydroxydehydroepiandrosterone sulfate formation
is the fetal liver by the conversion of dehydroepiandrosterone sulfate
(3). For more than 35 yr, controversy has existed concerning the estrogen secretory products of the human placenta. Gurpide and co-workers (4) showed 30 yr ago that more than 90% of the 17ß-estradiol and estriol synthesized in trophoblasts enters the maternal circulation, and it is generally agreed that 17ß-estradiol and estriol, but not estrone, are secreted directly into maternal blood in the intervillous space (5). In contrast, there is a sizable umbilical vein-umbilical artery gradient for estrone, suggesting that estrone enters the fetal circulation from the syncytiotrophoblast (6, 7). Steroids that leave trophoblasts toward the fetal blood compartment, however, do not enter fetal blood directly, but must first enter the intravillous tissue and then traverse the wall of the fetal capillaries (8).
The interconversion of 17ß-estradiol and estrone is catalyzed by different isozymes of 17ß-hydroxysteroid dehydrogenase (17ßHSD) (9). 17ßHSD type 1 catalyzes the reduction of estrone to 17ß-estradiol, whereas 17ßHSD type 2 catalyzes the oxidation of 17ß-estradiol to estrone. Other steroid substrates for the type 2 isozyme are the bioactive androgens, testosterone and dihydrotestosterone (10). Both isozymes are expressed in high levels in placental tissue (10, 11, 12, 13), and immunohistochemical analysis of human placenta has shown that cytochrome P-450 aromatase (converts androstenedione to estrone) and 17ßHSD type 1 are both confined to the syncytiotrophoblast (14). The cellular localization of 17ßHSD type 2 in placenta and other tissues, however, is unknown.
To gain further insight into the physiological role of 17ßHSD type 2 and to address again the secretion of 17ß-estradiol (or estrone) from syncytiotrophoblast, we investigated the cell type-specific expression of the enzyme by ribonucleic acid (RNA) blotting and immunohistochemical staining of human placenta and fetal liver. The results indicate that 17ßHSD type 2 is localized in the endothelial cells of the fetal capillaries and larger vessels of the placenta and in the hepatocytes of fetal liver.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Human fetal liver (14–18 weeks gestation) was obtained at the time of elective abortion of pregnancy for reasons other than liver disease. The consent forms and protocols for collecting human fetal liver and term placenta were approved by the institutional review board of the University of Texas Southwestern Medical Center. Human tissues for RNA isolation and immunoblotting were immediately snap-frozen in liquid nitrogen and stored at -80 C. Tissues for immunohistochemical analysis, embedded in OCT compound (Sakura Finetek, Torrance, CA), were snap-frozen in 2-methylbutane cooled in liquid nitrogen, and stored desiccated at -80 C.
RNA blotting
Total RNA was purified from frozen tissue using the RNA STAT-60 System (Tel-Test "B," Friendswood, TX) according to the manufacturer’s instructions. Ten micrograms of total RNA was size-fractionated by electrophoresis, transferred to a nylon membrane, hybridized with a 32P-labeled 17ßHSD type 2 complementary DNA (cDNA) probe, washed under high stringency conditions, and exposed to x-ray film as previously described (13).
Production of recombinant 17ßHSD type 2 fusion protein
To generate a 17ßHSD type 2 cDNA suitable for subcloning into
the bacterial expression vector pQE-30 (Qiagen, Chatsworth, CA), the
following two primers were used in a PCR amplification with the human
17ßHSD type 2 cDNA (10) as template: 5'-oligonucleotide,
GCGCGGATCCAGCACTTTCTTCTCGGACACA (corresponding 5'
3' to
the BamHI cloning site and sequence for 17ßHSD type 2);
and 3'-oligonucleotide, GCGCAAGCTTCTAGGTGGCCTTTTTCTTGTA
(corresponding 3'5' to the HindIII cloning site and
17ßHSD type 2 sequence). The amplified PCR product was digested with
BamHI and HindIII and inserted into pQE-30,
designated pQE30–17ßHSD2. The resulting pQE30–17ßHSD2 recombinant
plasmid encodes a fusion protein of 398 amino acids. The
carboxy-terminal 386 amino acids comprise the 17ßHSD type 2 protein
(amino acids 2–387) and the amino-terminal 12 amino acids includes an
initiator methionine and six consecutive histidine residues.
PQE30–17ßHSD2 was transformed into Escherichia coli host
strain M15(pREP4) (Qiagen, Chatsworth, CA), grown to midlog phase in
1 l Luria Bertoni broth cultures at 37 C, and induced with
isopropylthio-ß-galactoside (2 mmol/L) for 3 h. The cells were
collected by centrifugation and processed by a detergent washing
procedure as described previously (15). The final inclusion body pellet
was dissolved by a 30-s homogenization using a Brinkmann Polytron
(Brinkmann, Westbury, NY) at maximum setting in a buffer containing
1.5% (wt/vol) sodium N-lauroylsarcosine and 10 mmol/L
Tris-HCl (pH 8.0) and dialyzed against PBS overnight at 4 C. This
fraction contained 17ßHSD type 2 fusion protein with a purity of
approximately 90% as revealed by SDS-polyacrylamide gel
electrophoresis.
Production of monoclonal antibodies
The monoclonal antibody, mAb-C2–12 (subclass IgG1/
),
directed against 17ßHSD type 2, was produced by immunizing mice with
a synthetic carboxy-terminal peptide, [C]RALRMPNYKKKAT, corresponding
to amino acids 375–387 in 17ßHSD type 2. The peptide was coupled to
keyhole limpet hemocyanin using
m-maleimidobenzoyl-N-hydroxysulfosuccinimide
ester (Pierce, Rockford, IL) (16). Mice were immunized with 25 µg
coupled peptide in RIBI Adjuvant System (Ribi Immunochem Research,
Hamilton, MT); 3 days after the second boost, the spleen was dissected
out, and spleen cells were mixed with the myeloma cell line X.63-Ag 14
at a ratio of 4:1 and fused with 50% polyethylene glycol 1500 as
previously described (17). Production of the monoclonal antibody
mAb-EC2–14 (subclass IgG3/) and hybridoma screening were performed
according to a method previously described to produce monoclonal
antibodies directed against bacterially produced proteins (15). Ig was
purified by column chromatography using protein G-agarose (Sigma
Chemical Co., St. Louis, MO) (16).
Immunoblotting
Transfection of human embryonic kidney 293 cells with an expression plasmid (pCMV-17ßHSD2) encoding the full-length 17ßHSD type 2 protein or vector (pCMV) was performed as previously described (10). Forty-eight hours after transfection, the cells were harvested and frozen at -80 C as a pellet. Immunoblot analysis of homogenates of human tissues and transfected 293 cells was performed with peroxidase-conjugated antimouse IgG using the Enhanced Chemiluminescence (ECL) Western Blotting Detection System kit (Amersham, Arlington Heights, IL) as described previously (15).
Immunohistochemistry
Eight-micron cryosections were fixed with acetone for 10 min at room temperature, then immunoperoxidase staining was performed using the ABC Vectastain detection system (Vector Laboratories, Burlingame, CA) as described previously (18). The monoclonal antibodies mAb-C2–12, mAb-EC2–14, antihuman CD34 (IOM 34, Amac, Westbrook, ME), mouse IgG1 (MOPS 21, Sigma), and mouse IgG3 (FLOP 21, Sigma) were used at 10 µg/mL. All antibodies were diluted in phosphate-buffered saline except mAb-EC2–14, for which the NaCl concentration was increased to 500 mmol/L to prevent nonspecific binding. Color development (red) was performed with 3-amino-9-ethyl carbazole, and the sections were counterstained with hematoxylin. Sections were observed on a Leitz Laborlux-F brightfield microscope (Optronicf model ZI-470, Leitz, Rockleigh, NJ) using the Macintosh Quadra equipped with a Raster Opf Z4 MXTV frame grabber board. Photographs were taken using a Kodak XLF 8600 disub printer and Kodak ektatherm XLF print media (Eastman Kodak, Rochester, NY).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. The dissections
included regional components of the placental vasculature. The
chorionic arteries and veins on the placental surface branch to enter
the cotyledons as stem vessels. These include the major truncus chori
that branch into primary, secondary, and tertiary rami, which ramify
into the sinusoidal network of the terminal villi (8). High levels of
17ßHSD type 2 messenger RNA (mRNA; 
1.5 kb) were detected in
placental villous tissue, tertiary vascular rami, whole placenta, and
fetal liver. Very low levels of 17ßHSD type 2 mRNA were observed in
chorionic vein, chorionic plate, truncus chori, and primary/secondary
rami. There was no evidence for significant levels of 17ßHSD type 2
mRNA in decidua parietalis, chorion laeve, placental amnion membrane,
reflected amnion membrane, chorionic artery, or fetal blood.
|
. A
protein of 45,000 daltons is specifically detected by mAb-C2–12 and
mAb-EC2–14 in placenta and fetal liver as well as in transfected 293
cells expressing recombinant 17ßHSD type 2 protein. The recognition
of 17ßHSD type 2 was abolished by preincubating mAb-C2–12 with
the antigenic carboxy-terminal peptide; however, this peptide was
unable to abolish binding of mAb-EC2–14 to the enzyme (data not
shown).
|
). Cryosections
from eight placental tissues, including the chorionic plate and
vessels, as well as corresponding umbilical cords were immunostained
with mAb-C2–12 and mAb-EC2–14. The expression pattern was identical
in all eight specimens. Strong positive immunostaining was detected in
the endothelial cells lining the capillaries and sinusoids in placental
villi when sections were incubated with mAb-C2–12 (Fig. 3A) or mAb-EC2–14 (Fig. 3B). An
identical staining pattern was seen in adjacent sections stained for
CD34, which is expressed by endothelial cells, confirming the identity
of the cells containing 17ßHSD type 2 immunoreactivity (data not
shown). In contrast, no staining was seen in the trophoblast lining the
placental villi. Pairs of cotyledonary vessels in the stem villi showed
positive staining in the endothelial cells of one vessel only when
incubated with mAb-C2–12 (Fig. 3C) and mAb-EC2–14 (Fig. 3D). The
integrity of endothelial cells in both vessels was confirmed by
incubating adjacent sections of tissue with an antihuman CD34 antibody
(data not shown). Chorionic plate samples were taken with either a
chorionic vein or artery, based on anatomical criteria, and the
presence of endothelial cells was confirmed by anti-CD34 staining.
Endothelial cells lining the chorionic veins of the chorionic plate
also stained positive with mAb-C2–12 (Fig. 3E) and mAb-EC2–14 (data
not shown), but those of chorionic arteries did not (Fig. 3F). In
addition, no immunostaining was observed in endothelial cells lining
the umbilical artery, umbilical vein, and the junction between
chorionic vein and the umbilical vein or in decidua parietalis, amnion
membrane, or chorionic plate (data not shown).
|
).
Positive immunostaining was detected in hepatocytes when sections were
incubated with mAb-C2–12 (Fig. 4, A–C) and mAb-EC2–14 (Fig. 4D).
Staining was found to be most intense in hepatocytes surrounding the
portal tract and central vein compared with midzonal regions when
sections were incubated (Fig. 4, C and D). No staining was observed in
hematopoietic cells or endothelial cells lining the portal tract,
central vein, or liver sinusoids (Fig. 4, C and D) or bile ductules.
The integrity of endothelial cells was confirmed by incubating tissue
sections with an antihuman CD34 antibody (data not shown).
Consistently, no immunostaining was observed when irrelevant monoclonal
antibodies of subclass IgG1 (Fig. 4E) or IgG3 (Fig. 4F) were incubated
with placenta or liver sections. Also, the recognition of 17ßHSD type
2 was abolished by preincubating mAb-C2–12 with the antigenic
carboxy-terminal peptide; however, this peptide was unable to abolish
binding of mAb-EC2–14 to the enzyme (data not shown).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To define further the cell type(s) in which 17ßHSD type 2 is localized, immunohistochemical analysis of human placenta was conducted. The validation of a positive signal in a particular tissue (cell) by immunohistochemical analysis may be problematic if a given antibody cross-reacts with an irrelevant protein with a similar epitope. Consequently, to address this important issue we generated monoclonal antibodies directed against different epitopes of 17ßHSD type 2 protein to determine whether the same pattern would be expressed with both antibodies. mAb-C2–12 is directed against a synthetic carboxy-terminal peptide, and mAb-EC2–14 is directed against a bacterially produced 17ßHSD type 2 fusion protein. That the monoclonal antibodies recognize different epitopes of 17ßHSD type 2 protein was confirmed by two different experiments. First, mAb-EC2–14 could not bind to the carboxy-terminal peptide in an enzyme-linked immunosorbent assay, whereas mAb-C2–12 bound to the peptide; second, free carboxy-terminal peptide could not abolish binding of mAb-EC2–14 to 17ßHSD type 2 protein in immunoblotting and immunohistochemical experiments, whereas the free peptide could abolish binding of mAb-C2–12 to the protein. We were unable to test whether binding of mAb-EC2–14 and mAb-C2–12 to 17ßHSD type 2 could be abolished by preincubating the antibodies with the fusion protein because the 17ßHSD type 2 fusion protein is purified from the inclusion body fraction of E. coli cells and, thus, is soluble only under strongly denaturing conditions that result in denaturation of the antibodies. Using the two monoclonal antibodies, we demonstrated that the endothelial cell is the cell type in placenta that exclusively expresses the 17ßHSD type 2 enzyme.
The finding of high levels of oxidative 17ßHSD type 2 enzyme in endothelial cells of capillaries and sinusoids in terminal villi provides an explanation as to why estrone is the major C18 steroid present in fetal umbilical venous blood. Furthermore, our results explain the observation by Tremblay and co-workers (19), that the mRNA encoding 17ßHSD type 1, but not 17ßHSD type 2, was expressed in primary cultures of trophoblasts, in contrast to whole placenta and fetal cotyledons, that contained large amounts of both mRNAs.
The 17ßHSD type 2 protein is, however, not observed in all endothelial cells of the placenta. In contrast to high levels of type 2 protein in endothelial cells of capillaries and sinusoids in terminal villi, no immunoreactive 17ßHSD type 2 could be demonstrated in endothelial cells lining the chorionic artery of the chorionic plate, umbilical artery, and umbilical vein. Furthermore, a dichotomy of expression is observed in the endothelial cells of cotyledonary vessels in the stem villi. This spatial gradient of 17ßHSD type 2 immunostaining in endothelial cells (i.e. high levels in terminal villi, the site of feto-maternal exchange) to no detectable protein in the endothelial cells lining large fetal placental vessels, especially those leading into the placenta, is in concordance with one proposed physiological role of the enzyme, namely to protect the fetus from placental and maternally derived bioactive estrogen and androgen.
The finding that the 17ßHSD type 2 enzyme is confined to the
hepatocytes in fetal liver supports the hypothesis that its
physiological role is to inactivate steroids. The majority of steroid
metabolism takes place in the hepatocytes, the major cell type in the
liver. Other enzymes confined to the hepatocyte and relevant to steroid
metabolism include steroid 5/ß-reductases, 3/ß-hydroxysteroid
dehydrogenases, cytochromes P-450, UDP-glucuronosyltransferases, and
steroid sulfotransferases. The higher level of 17ßHSD type 2 protein
in hepatocytes surrounding the portal tract and central vein compared
with midzonal regions is in contrast to expression of a
drug-inactivating cytochrome P-450 enzyme, P-450 IIIA, showing uniform
expression in all hepatocytes regardless of intralobular localization
in fetal liver (20). Interestingly, during postnatal and adult life,
expression of P-450 IIIA was restricted to hepatocytes surrounding
central vein and midzonal regions (20). Hence, it is conceivable that
hepatocyte expression of 17ßHSD type 2 also may shift after birth.
This issue is important to an understanding of the metabolic pathway of
a particular steroid, i.e. whether the steroid is
metabolized as it traverses from blood (portal vein and hepatic artery)
to blood (central vein) as a result of a spatial gradient of expression
of particular steroid-metabolizing enzymes or simply because the
substrate specificities of the various metabolizing enzymes in the
hepatocytes are determining the pathway.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received May 19, 1997.
Revised August 1, 1997.
Accepted August 6, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-hydroxysteroid dehydrogenase activity. J Biol
Chem. 169:12964–12969.
-reductase type 1 in
human scalp and prostate. Ann NY Acad Sci. 784:27–39.[Medline]
This article has been cited by other articles:
 |
|
 |
|
  S. Andersson, D. Minjarez, N. P. Yost, and R. A. Word Estrogen and Progesterone Metabolism in the Cervix during Pregnancy and Parturition J. Clin. Endocrinol. Metab., June 1, 2008; 93(6): 2366 - 2374. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. J Su, Y.-H. Cheng, R. T Chatterton, Z.-H. Lin, P. Yin, S. Reierstad, J. Innes, and S. E Bulun Regulation of 17-Beta Hydroxysteroid Dehydrogenase Type 2 in Human Placental Endothelial Cells Biol Reprod, September 1, 2007; 77(3): 517 - 525. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-H. Cheng, A. Imir, T. Suzuki, V. Fenkci, B. Yilmaz, H. Sasano, and S. E. Bulun SP1 and SP3 Mediate Progesterone-Dependent Induction of the 17beta Hydroxysteroid Dehydrogenase Type 2 Gene in Human Endometrium Biol Reprod, October 1, 2006; 75(4): 605 - 614. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. M. Barnes, S. Huang, A. Kaipainen, D. Sanoudou, E. J. Chen, G. S. Eichler, Y. Guo, Y. Yu, D. E. Ingber, J. B. Mulliken, et al. Evidence by molecular profiling for a placental origin of infantile hemangioma PNAS, December 27, 2005; 102(52): 19097 - 19102. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Ginsberg, D. Hattis, R. Miller, and B. Sonawane Pediatric Pharmacokinetic Data: Implications for Environmental Risk Assessment for Children Pediatrics, April 1, 2004; 113(4/S1): 973 - 983. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Burton, T. A. Henderson, S. G. Hillier, J.I. Mason, F. Habib, R. M. Brenner, and H. O.D. Critchley Local levonorgestrel regulation of androgen receptor and 17{beta}-hydroxysteroid dehydrogenase type 2 expression in human endometrium Hum. Reprod., December 1, 2003; 18(12): 2610 - 2617. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Chai, P. Brereton, T. Suzuki, H. Sasano, V. Obeyesekere, G. Escher, R. Saffery, P. Fuller, C. Enriquez, and Z. Krozowski 17{beta}-Hydroxysteroid Dehydrogenase Type XI Localizes to Human Steroidogenic Cells Endocrinology, May 1, 2003; 144(5): 2084 - 2091. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Lindqvist and S. Andersson Biochemical Properties of Purified Recombinant Human beta -Carotene 15,15'-Monooxygenase J. Biol. Chem., June 21, 2002; 277(26): 23942 - 23948. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Yang, Z. Fang, B. Gurates, M. Tamura, J. Miller, K. Ferrer, and S. E. Bulun Stromal PRs Mediate Induction of 17{beta}-Hydroxysteroid Dehydrogenase Type 2 Expression in Human Endometrial Epithelium: A Paracrine Mechanism for Inactivation Of E2 Mol. Endocrinol., December 1, 2001; 15(12): 2093 - 2105. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Utsunomiya, T. Suzuki, C. Kaneko, J. Takeyama, J. Nakamura, K. Kimura, M. Yoshihama, N. Harada, K. Ito, R. Konno, et al. The Analyses of 17{beta}-Hydroxysteroid Dehydrogenase Isozymes in Human Endometrial Hyperplasia and Carcinoma J. Clin. Endocrinol. Metab., July 1, 2001; 86(7): 3436 - 3443. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Ito, T. Suzuki, T. Moriya, H. Utsunomiya, A. Sugawara, R. Konno, S. Sato, and H. Sasano Retinoid Receptors in the Human Endometrium and Its Disorders: A Possible Modulator of 17{beta}-Hydroxysteroid Dehydrogenase J. Clin. Endocrinol. Metab., June 1, 2001; 86(6): 2721 - 2727. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Bonenfant, C. H. Blomquist, P. R. Provost, R. Drolet, P. D’Ascoli, and Y. Tremblay Tissue- and Site-Specific Gene Expression of Type 2 17{beta}-Hydroxysteroid Dehydrogenase: In Situ Hybridization and Specific Enzymatic Activity Studies in Human Placental Endothelial Cells of the Arterial System J. Clin. Endocrinol. Metab., December 1, 2000; 85(12): 4841 - 4850. [Abstract] [Full Text]
|
|
|
|
|
|
J. Takeyama, T. Suzuki, G. Hirasawa, Y. Muramatsu, H. Nagura, K. Iinuma, J. Nakamura, K.-i. Kimura, M. Yoshihama, N. Harada, et al. 17{beta}-Hydroxysteroid Dehydrogenase Type 1 and 2 Expression in the Human Fetus J. Clin. Endocrinol. Metab., January 1, 2000; 85(1): 410 - 416. [Abstract] [Full Text]
|
|
|
|
|
|
S. Leivonen, Y.-s. Piao, H. Peltoketo, P. Numchaisrika, R. Vihko, and P. Vihko Identification of Essential Subelements in the hHSD17B1 Enhancer: Difference in Function of the Enhancer and That of the hHSD17BP1 Analog Is due to -480C and -486G Endocrinology, August 1, 1999; 140(8): 3478 - 3487. [Abstract] [Full Text]
|
|
|
|
|
|
K. Zeitoun, K. Takayama, H. Sasano, T. Suzuki, N. Moghrabi, S. Andersson, A. Johns, L. Meng, M. Putman, B. Carr, et al. Deficient 17{beta}-Hydroxysteroid Dehydrogenase Type 2 Expression in Endometriosis: Failure to Metabolize 17{beta}-Estradiol J. Clin. Endocrinol. Metab., December 1, 1998; 83(12): 4474 - 4480. [Abstract] [Full Text]
|
|
|
|
|
|
J. Takeyama, H. Sasano, T. Suzuki, K. Iinuma, H. Nagura, and S. Andersson 17{beta}-Hydroxysteroid Dehydrogenase Types 1 and 2 in Human Placenta: An Immunohistochemical Study with Correlation to Placental Development J. Clin. Endocrinol. Metab., October 1, 1998; 83(10): 3710 - 3715. [Abstract] [Full Text]
|
|
|
|
|
|
N. Moghrabi, I. A. Hughes, A. Dunaif, and S. Andersson Deleterious Missense Mutations and Silent Polymorphism in the Human 17{beta}-Hydroxysteroid Dehydrogenase 3 Gene (HSD17B3) J. Clin. Endocrinol. Metab., August 1, 1998; 83(8): 2855 - 2860. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
