| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Departments of Pathology (K.I., H.S., N.A., H.N.), Neurological Science (R.-W.S., T.K.), Internal Medicine (K.T.), and Molecular Biology (K.T.), Tohoku University School of Medicine, and the Department of Pathology and Laboratory Medicine, Sendai National Hospital (H.S.), Sendai; and the Second Division, Department of Medicine, Hamamatsu University School of Medicine (K.I., Y.O., T.Y.), Hamamatsu, Japan
Address all correspondence and requests for reprints to: Kazumi Iino, M.D., Department of Pathology, Tohoku University School of Medicine, 21 Seiryou-machi, Aoba-ku, Sendai 98077, Japan.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In 1995, Vaughan et al. demonstrated the presence of urocortin-like immunoreactivity and urocortin gene expression in Edinger-Westphal nucleus, lateral superior olivary nucleus, and septal nucleus of rat central nervous system (CNS) (1). In human CNS, however, the manner of expression of urocortin, including its origin, mechanism of storage, and secretion, remains unknown. By RIA, we found that human pituitary gland contains urocortin in a concentration much higher than that in any other portion of the human CNS. We, therefore, characterized urocortin expression in human pituitary gland by RIA as well as by high performance liquid chromatography (HPLC), immunohistochemistry, messenger ribonucleic acid (mRNA) in situ hybridization, and reverse transcriptase-PCR (RT-PCR). We subsequently examined colocalization of urocortin and anterior pituitary hormones by immunostaining of serial mirror tissue sections combined with computer-based image analysis and by double immunostaining to determine whether urocortin expression is related to that of any specific anterior pituitary hormone. In addition, we studied urocortin immunoreactivity in 52 cases of pituitary adenomas to examine a possible alteration of urocortin expression through a neoplastic transformation.
| Materials and Methods |
|---|
|
|
|---|
Human urocortin peptides and r/hCRF were commercially obtained from Peptide Institute (Osaka, Japan). Genetically recombinant human GH was obtained from Sumitomo Chemical Co. (Osaka, Japan). Rat/human urocortin-(2135) (ARTQSQRERAEQNRI) and YELARTQSQRERAEQNRIIF ([Tyr18]urocortin-(1937)) were purchased from Iwaki Glass Co. (Funabashi, Japan). Chemical reagents for mRNA in situ hybridization were purchased from Research Genetics (Huntsville, AL). Antisera against GH, LH, and FSH were purchased from Dako Co. (Carpenteria, CA). Antisera against ACTH, PRL, and TSH were purchased from Incstar Co. (Stillwater, MN), Nichirei Co. (Tokyo, Japan), and UCB Bioproducts (Brussels, Belgium), respectively. These antisera were all polyclonal antibodies raised in rabbits. Other chemicals used in this study were obtained from Katayama Chemicals Co. (Osaka, Japan) and Wako Chemicals Co. (Osaka, Japan).
Preparation of antiserum against urocortin
The amino acid residues 2135 of human urocortin are completely identical to those of rat urocortin. Antiserum against urocortin was, therefore, raised in a rabbit immunized with a peptide corresponding to amino acid residues 2135 of the rat/human urocortin, which was chemically conjugated to thyrogloblin. Methods of immunization and characterization of the antiserum were previously reported (6).
Human tissues
Human pituitary glands were obtained at autopsy performed within 3 hours postmortem at Department of Pathology, Tohoku University Hospital (Sendai, Japan) from 17 Japanese patients (12 men and 5 women; 5977 yr old). Review of the charts revealed that these patients did not have any neurological or endocrinological disorders or prior histories of glucocorticoid treatment. Ten of these human pituitary glands were processed for morphological studies, and the rest were immediately frozen at -80 C for either RIA and HPLC (4 cases) or RT-PCR analyses (3 cases).
All specimens for morphological studies were fixed in 10% neutral formalin for 2448 h at 4 C for immunohistochemical study and also in 4% paraformaldehyde containing 0.5% glutaraldehyde for 18 h at 4 C for in situ hybridization studies. No significant histopathological abnormalities were detected in these anterior pituitaries.
Various other portions of human brain tissues were also obtained at the
time of autopsy of the subjects in whom urocortin concentrations of
pituitary were determined by RIA. These brain tissues were immediately
frozen at -80 C for RIA. Fifty-two human anterior pituitary adenomas
were obtained at transsphenoidal surgery of the pituitary tumor
conducted at Tohoku University Hospital (Tohoku, Japan), Sendai
National Hospital (Sendai, Japan), and Hamamatsu University Hospital
(Hamamatsu, Japan). Based on preoperative hormonal findings and
immunohistochemical studies using antibodies against GH, ACTH, and PRL,
they were classified as follows: GH-producing adenoma (14 cases),
ACTH-producing adenoma (13 cases), PRL-producing adenoma (11
cases), and nonfunctioning hormonally inactive adenoma (14 cases).
Immunohistochemical findings of these adenomas were summarized in Table 1
. In GH-positive adenomas, 4 of 14 cases
were also partially positive for PRL. The patients with nonfunctioning
hormonally inactive adenomas included 1 case of so-called null cell
tumor and 13 cases of pituitary adenomas that did not demonstrate any
pituitary hormone immunoreactivity, including LH, FSH, and TSH.
|
Specimens weighing approximately 100 mg were boiled at 98 C for 10 min with 1 mL extraction buffer (63 mmol/L Na2HPO4 and 12.7 mmol/L ethylenediamine tetraacetate-Na2, pH 7.4) to denature endogenous proteolytic enzymes. They were subsequently homogenized and centrifuged at 4 C at 10,000 x g for 30 min. The resultant supernatants were lyophilized. The dried extract was reconstituted with RIA buffer (the extraction buffer with 0.1% Triton X-100 and 250,000 U/L aprotinin, pH 7.4). RIA of urocortin was carried out according to the method of Nicholson et al. with some modifications (7). RIA of urocortin was performed as previously reported (6). Briefly, synthetic peptide [Tyr18]-urocortin-(1937) iodinated by the chloramine-T method and purified by Sephadex G-25 gel chromatography was used as the tracer. The standard peptide was human urocortin-(140). Final dilution of the urocortin antiserum was 1:75,000. The intra- and interassay coefficients of variation were 6% and 11%, respectively, with a specific activity of 62.9 tetrabecquerels/mmol. The smallest detectable concentration was 0.4 fmol/tube, and the assay did not cross-react with r/hCRF, ovine CRF, urotensin I, sauvagine, or ACTH.
HPLC analysis
A sample containing pituitary tissue extract was applied to a HPLC column (id, 4.6 x 100 mm; Wakocil-II3C18, Wako Chemicals, Osaka, Japan) equilibrated with 0.1% trifluoroacetic acid-20% acetonitrile and was eluted with a linear gradient to 0.1% trifluoroacetic acid-70% acetonitrile for 60 min at a flow rate of 1 mL/min. The urocortin immunoreactivity of the fractions were analyzed by RIA, as described above.
RT-PCR
Total RNA was extracted from tissues by the guanidine thiocyanate-cesium chloride method. Total RNA (6 µg) was denatured at 65 C for 5 min and then transcribed at 37 C for 60 min in a reaction mixture (30 µL) containing 0.75 µg oligo(deoxythymidine)1218 (Pharmacia, Uppsala, Sweden), 0.5 mmol/L deoxy-NTPs, and 600 U reverse transcriptase (Moloney murine leukemia virus reverse transcriptase, Life Technologies, Gaithersburg, MD). The reaction mixture was then heated at 95 C for 5 min and immediately chilled on ice. Two microliters of the reaction mixture were subjected to PCR using Taq DNA polymerase (Pharmacia, Piscataway, NJ). The sense primer was 5'-CAGGCGAGCGGCCGCG-3', and the antisense primer was 5'-CTTGCCCACCGAGTCGAAT-3'. These oligonucleotide primers were designed according to the report by Petraglia et al. (8). Human full-term placenta in which urocortin mRNA was detected (8) was included as a positive control. Denaturation, annealing, and elongation were carried out at 94 C for 15 sec, at 62 C for 0.5 min, and at 72 C for 1 min, respectively, and the reactions were repeated for 30 cycles. Amplification products were subjected to electrophoresis in 5% polyacrylamide gel stained with ethidium bromide and viewed on an ultraviolet box. The negative control contained all reagents, but substituted 2 µL H2O for the RT reaction product.
Immunohistochemistry
Immunostaining of urocortin and pituitary hormones, including GH, ACTH, PRL, LH, FSH, and TSH, were performed on serial mirror tissue sections cut at 3 µm from paraffin-embedded specimens.
After deparaffinization, the sections were mounted on clean poly-L-lysine-coated glass slides (Matsunami Co., Tokyo, Japan). To retrieve urocortin antigenicity, the sections were pretreated by hydrated autoclaving in 10 mmol/L sodium citrate buffer (pH 6.0) at 120 C for 5 min and were allowed to cool for approximately 1 h at room temperature (9, 10). The slides were then placed in 100% methanol with 0.3% (vol/vol) hydrogen peroxide for 30 min to block endogenous peroxidase activity and then treated with 1% (vol/vol) normal goat serum for 30 min at room temperature in a moisture chamber. Primary antibodies were applied on the tissue section for 18 h at 4 C. Optimal dilution of the antiurocortin antiserum was 1:2500. After washing in 0.01 mol/L phosphate-buffered saline, specimens were incubated with biotinylated antirabbit immunoglobulin for 30 min at room temperature and subsequently incubated with peroxidase-conjugated streptavidin for 20 min, using a Histofine immunostaining kit (Nichirei Co., Tokyo, Japan). The sections were again washed with 0.01 mol/L phosphate-buffered saline, and antigen-antibody complexes were visualized by immersion in 3.3'-diaminobenzidine (DAB) solution (0.01 mol/L DAB in 0.05 mol/L Tris-HCl buffer, pH 7.6, containing 0.01 mol/L sodium azide and 0.006% hydrogen peroxide).
For absorption test of immunoreactivity for urocortin, an antibody-antigen mixture containing equal volumes of the optimally diluted antiserum to urocortin and urocortin peptide solution (20 µmol/L, final concentration) was incubated for 18 h at 4 C. After centrifugation, the resultant supernatants were used as preabsorbed antibody. Negative control of the absorption test in which urocortin peptide was replaced by r/hCRH or GH solution (20 µmol/L, final concentration) was performed in parallel.
Double immunostaining for urocortin and GH, ACTH, or PRL was performed according to the method of Sasano et al. (11) with some modifications. Immunoreactivity of GH, ACTH, or PRL was first visualized as brown by DAB using the routine streptavidin-biotin method described above, and the reacted tissue sections were subsequently incubated in 0.2 mol/L Tris HCl buffer (pH 8.2) for 5 min at room temperature. Urocortin immunostaining was subsequently performed on the same reacted tissue sections using alkaline phosphatase-conjugated antirabbit antibodies (Dako), and the immunoreactivity was visualized as red employing new fuchsin salt (Merck, Darmstadt, Germany).
Evaluation of urocortin and pituitary hormone immunoreactivity in serial mirror tissue sections
Six pairs of mirror image section were individually treated with the urocortin antiserum and GH, ACTH, PRL, LH, FSH, or TSH antiserum, respectively, as primary antibodies. The images were then directly captured through a digital charge coupled device camera (ProgRes 3012 PPC, Kontron Elektronik Co., Encring, Germany) with a PRI-Macintosh interface board attached to an operating light microscope (Carl Zeiss Co., Jena, Germany). Resolution was set at 998 x 774 pixel. The images were subsequently transferred to a Power Macintosh 9500/120 personal computer-controlled operating system and processed with Macintosh software Adobe Photoshop 3.0J (San Jose, CA).
Screen images for the examination were selected randomly in the serial mirror sections of anterior pituitary gland. At least 100 urocortin-immunopositive anterior pituitary cells were evaluated in the screen images. The percentages of GH-, PRL-, and ACTH-immunopositive cells among the urocortin-immunopositive cells were determined.
Preparation of complementary DNA probes for in situ hybridization
The sequence of the 28-base urocortin oligonucleotide probe used for in situ hybridization analysis consisted of ATTGACCTCACCTTTCACCTGCTGCGGA (nucleotides 305332). Sense oligonucleotide probe was used as a negative control. The probes were synthesized with a 3'-biotinylated tail (Brigati tail; 5'-probe-biotin-biotin-biotin-TAG-TAG-biotin-biotin-biotin-3') (12).
In situ hybridization
In situ hybridization was performed in 10 normal human pituitary glands and 27 pituitary adenomas, including GH-producing adenoma (8 cases), ACTH-producing adenoma (7 cases), PRL-producing adenoma (6 cases), and nonfunctioning hormonally inactive adenoma (6 cases). In situ hybridization was performed by use of a manual capillary actions system (MicroProbe staining system, Fisher Scientific, Pittsburgh, PA) with a modification of previously reported methods (13, 14). Tissue sections (3 µm, applied to Probe On Plus slides, Fisher Scientific) were rapidly dewaxed, cleared, with alcohol, rehydrated with a Tris-based buffer, pH 7.4 (Universal Buffer, Research Genetics, Huntsville, AL), and digested with pepsin (2.5 mg/mL; Research Genetics) for 3 min at 105 C. The probe was applied in formamide-free diluent, and the slides were heated to 105 C for 3 min, cooled for approximately 1 min at room temperature, and allowed to hybridize at 45 C for 60 min. The sections were then washed twice with 2 x SSC (standard saline citrate) at 45 C (3 min/wash) and incubated with alkaline phosphatase-conjugated streptavidin (Research Genetics). After washing twice in AP chromogen buffer, pH 9.5 (Research Genetics), at room temperature, hybridization products were visualized as red using fast red salt. The slides were counterstained with hematoxylin, air-dried, and coverslipped for microscopic examination.
Statistical analysis
Numerical results were expressed as the mean ± SEM. Statistical analysis was performed by one-way ANOVA, followed by Duncans multiple range test as appropriate. P < 0.05 was considered as significant.
| Results |
|---|
|
|
|---|
Immunoreactive urocortin concentrations in tissue extracts of
human CNS available for examination were summarized in Table 2
. Immunoreactive urocortin
concentrations in pituitary tissue extracts were 103.25 ± 39.05
ng/g wet wt. It was significantly higher than those in other portions
of CNS obtained from the same patients, including cerebellum, cerebrum,
hypothalamus, and Edinger-Westphal nuclei. The immunoreactive urocortin
concentrations in pituitary gland were approximately 50100 times
higher than those in other portions of human CNS.
|
Results of HPLC analysis of urocortin in human anterior pituitary
gland were shown in Fig. 1
. The major
portion of urocortin immunoreactivity determined by RIA constituted a
peak with the same chromatographic mobility to human urocortin-(140)
standard. A minor component represented by an arrowhead was
also eluted before this peak.
|
The RT-PCR study demonstrated the expression of urocortin mRNA in
three human pituitaries and human full-term placenta. A 145-bp DNA
band, corresponding to the expected length, was amplified in all
samples (Fig. 2
). The negative control
demonstrated no amplification products.
|
Urocortin-immunoreactive cells were observed in all pituitary
glands examined. The immunoreactivity of urocortin was abolished by the
urocortin antiserum preabsorbed with the antigen, but remained
unchanged by the antiserum preabsorbed with r/hCRH or GH.
Urocortin-positive pituitary cells were widely present in anterior
pituitary gland, with dominant distribution in the lateral or
acidophilic wings (Fig. 3
, A and B)
(15). There were no differences in patterns of urocortin
immunolocalization between female and male subjects.
|
The results of examination in serial mirror tissue sections are
summarized in Table 3
. Examples of
immunohistochemical staining of urocortin and GH, ACTH, or PRL in
serial mirror tissue sections were shown in Fig. 4
, AC, respectively. Some 76.55 ±
3.06% of urocortin-positive cells demonstrated GH immunoreactivity,
whereas 22.25 ± 3.02% of urocortin-positive cells expressed PRL.
Less than 1% of urocortin-positive cells were immunohistochemically
positive for ACTH, LH, FSH, and TSH. Some 81.47 ± 1.85% of
somatotrophs were also positive for urocortin immunoreactivity.
Examples of double immunostaining of urocortin and either GH or PRL are
illustrated in Fig. 5
, A and B,
respectively. The great majority of GH-immunoreactive cells, appearing
brown as a result of DAB colorimetric reaction, were also positive for
urocortin, appearing red as a result of new fuchsin colorimetric
reaction (Fig. 5A
). On the other hand, some PRL-immunoreactive cells,
appearing brown, were positive for urocortin, appearing red (Fig. 5B
).
|
|
|
Urocortin mRNA hybridization signals appearing red as a result of
fast red salt reaction were detected in the cytoplasm of human anterior
pituitary gland cells (Fig. 6A
). In
negative controls using the sense oligonucleotide probe, no significant
accumulation of urocortin mRNA was detected (Fig. 6B
). The distribution
of urocortin mRNA hybridization signals was comparable to that of
urocortin immunoreactivity.
|
Urocortin immunoreactivity was not present in any of pituitary adenomas examined, except one case of GH-producing adenoma and one case of nonfunctioning adenoma. Nonneoplastic anterior pituitary gland cells attached to the adenomas demonstrated urocortin immunoreactivity in all cases in which nonneoplastic pituitary was available for examination. A urocortin-positive adenoma from a 23-yr-old woman was a GH-producing adenoma with scattered foci of PRL- and ACTH-positive tumor cells. Another case of urocortin-positive pituitary adenoma was a 70-yr-old female. This case had been diagnosed as chromophobe adenoma.
Urocortin mRNA hybridization signals were detected only in two cases among 27 cases examined. A urocortin mRNA-positive adenoma from a 23-yr-old man was a GH-producing adenoma. Another case was a 55-yr-old male and had been diagnosed as a nonfunctioning, hormonally inactive chromophobe adenoma. These adenomas positive for urocortin mRNA were immunohistochemically negative for urocortin. Two pituitary adenomas that were immunohistochemically positive for urocortin did not demonstrate any significant accumulation of urocortin mRNA hybridization signals. Nonneoplastic anterior pituitary gland cells demonstrated urocortin mRNA hybridization signals when available for examination. In a negative control using the sense oligonucleotide probe, no significant accumulation of urocortin mRNA was detected.
| Discussion |
|---|
|
|
|---|
is distributed in
the brain, whereas CRF receptor 2ß appears in both the brain and the
periphery (18). Urocortin has been demonstrated to bind to both CRF
receptors 1 and 2, but has a much higher affinity for CRF receptor 2
(1). In addition, the distribution of urocortin nerve fibers has been
demonstrated to be correlated with that of CRF receptor 2. These
findings indicate that urocortin may be an endogenous ligand for CRF
receptor 2 and may modify some CRF functions through CRF receptor 2
rather than through CRF receptor 1. However, urocortin was also
demonstrated to stimulate ACTH release from dispersed rat anterior
pituitary cells, and the affinity of urocortin to the CRF receptor 1
was higher than that of CRF (1). Possible roles of urocortin in
physiological functions in the CNS and peripheral system have not been
well characterized. In this study, we first demonstrated that urocortin was expressed in human anterior pituitary gland. The urocortin concentration in the human pituitary gland was much higher than that in other portions of the CNS, including Edinger-Westphal nucleus and lateral inferior olivary nucleus, in which urocortin was first detected in rat CNS (1). HPLC analysis also revealed that the major component of urocortin immunoreactivity determined by RIA corresponds to human urocortin molecules and a minor component that may represent a precursor molecule of urocortin. Further investigation using mRNA in situ hybridization and RT-PCR studies revealed that urocortin is actually synthesized in human pituitary glands. We then employed both double immunostaining, in which urocortin and pituitary hormones were visualized as different colors in the same cells, and immunostaining in serial mirror tissue sections in which the serial sections were placed on mirror images to examine expressions of urocortin and pituitary hormones in the same cells. These two immunohistochemical studies revealed that the great majority of GH-immunoreactive cells express urocortin immunoreactivity, and corticotrophs were immunohistochemically negative for urocortin. CRF receptor 1, to which urocortin is known to bind (1), distributes in corticotrophs of anterior pituitary gland. Therefore, urocortin, synthesized and possibly secreted mainly in somatotrophs of human pituitary glands, may act on corticotrophs, which are considered to express CRF receptor 1, through an intrapituitary paracrine fashion. The absence of urocortin expression in corticotrophs in the normal pituitary gland suggests that urocortin does not act on these cells in an intrapituitary autocrine fashion. However, there is no evidence concerning whether urocortin is secretable, because the presence of signal peptide in the precursor for urocortin and the presence of authentic urocortin mRNA in the human pituitary are not known. It awaits further investigations, including colocalization of GH and urocortin in the same secretory granule by immunoelectron microscopy, and secretion of urocortin from the pituitary cells in vitro to clarify possible biological roles of urocortin in human anterior pituitary glands.
A number of neuropeptides that regulate the production and/or secretion of pituitary hormones have been known to be expressed in anterior pituitary cells (19, 20). Among these neuropeptides, vasoactive intestinal peptide was first established as an autocrine regulator of the function of anterior pituitary, especially in lactotrophs and somatotrophs (21, 22). In addition, neurotransmitters that are distributed widely in mammalian brain, including calcitonin-gene related peptides (CGRP) and substance P, were also expressed in the pituitary gland. These two neuropeptides have been demonstrated to be involved in paracrine and/or autocrine regulation of pituitary hormone secretion. In 1990, Roth et al. reported the presence of substance P immunoreactivity in TSHß-immunoreactive cells in human anterior pituitary gland and substance P-immunoreactive nerve fibers in posterior pituitary gland, suggesting a possible relationship between substance P and TSH secretion (23, 24). In 1994, Steel et al. reported that CGRP was expressed in rat and human anterior pituitary cells and posterior lobe nerve fibers, and most of the CGRP-immunoreactive cells in anterior pituitary were gonadotrophs (25). Urocortin is also distributed widely in rat CNS, like other neurotransmitters, such as substance P and CGRP (25, 26, 27). Therefore, urocortin is also considered as one of the neuropeptides involved in autocrine or paracrine regulation of anterior pituitary functions. In the present study, however, nerve fibers in posterior gland were shown to be immunohistochemically negative for urocortin, indicating that urocortin is not released from nerve terminals via posterior nerve fibers, in contrast to substance P and CGRP.
We also performed urocortin immunohistochemistry and mRNA in situ hybridization in several different types of human anterior pituitary adenomas. Urocortin immunoreactivity was not detected in any of these adenomas, except in two cases. In addition, urocortin mRNA hybridization signals were detected only in two cases. The adenoma cases immunohistochemically positive for urocortin did not express urocortin mRNA, and those expressing urocortin mRNA were immunohistochemically negative for urocortin. These discrepancies may be due to some technical factors, including unavailability of the specimens fixed in 4% paraformaldehyde with glutaraldehyde and possible differences in sensitivity of detection between immunohistochemistry and mRNA hybridization. These results also suggest that human somatotroph cells may lose their ability to produce urocortin through the process of neoplastic transformation, and that urocortin may be involved in human pituitary functions of normal, but not neoplastic, gland. The absence of urocortin expression in corticotroph adenomas is also consistent with that in ACTH cells in the normal pituitary glands. Interestingly, neuropeptides/neurotransmitters that are reported to be expressed in normal pituitary gland, including substance P and vasoactive intestinal peptide, are also expressed in pituitary neoplasms (28, 29). These findings suggest that the possible biological roles of urocortin in human anterior pituitary gland are different from those of other previously reported neuropeptides.
In conclusion, the present study demonstrated the expression of urocortin and its mRNA in the human anterior pituitary. The great majority of urocortin-immunoreactive cells coexpressed GH. These findings may indicate a novel paracrine or autocrine role of urocortin in the production and/or secretion of anterior pituitary hormones.
Received June 24, 1997.
Revised July 23, 1997.
Accepted August 1, 1997.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. R. Lindsay and L. K. Nieman The Hypothalamic-Pituitary-Adrenal Axis in Pregnancy: Challenges in Disease Detection and Treatment Endocr. Rev., October 1, 2005; 26(6): 775 - 799. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Florio, M. Torricelli, L. Galleri, G. De Falco, E. Leucci, G. Calonaci, E. Picciolini, G. Ambrosini, E. A. Linton, and F. Petraglia High Fetal Urocortin Levels at Term and Preterm Labor J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5361 - 5365. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Fukuda, K. Takahashi, T. Suzuki, M. Saruta, M. Watanabe, T. Nakata, and H. Sasano Urocortin 1, Urocortin 3/Stresscopin, and Corticotropin-Releasing Factor Receptors in Human Adrenal and Its Disorders J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4671 - 4678. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Saruta, K. Takahashi, T. Suzuki, A. Torii, M. Kawakami, and H. Sasano Urocortin 1 in Colonic Mucosa in Patients with Ulcerative Colitis J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5352 - 5361. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Takahashi, K. Totsune, O. Murakami, M. Saruta, M. Nakabayashi, T. Suzuki, H. Sasano, and S. Shibahara Expression of Urocortin III/Stresscopin in Human Heart and Kidney J. Clin. Endocrinol. Metab., April 1, 2004; 89(4): 1897 - 1903. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kageyama, C. Li, and W. W. Vale Corticotropin-Releasing Factor Receptor Type 2 Messenger Ribonucleic Acid in Rat Pituitary: Localization and Regulation by Immune Challenge, Restraint Stress, and Glucocorticoids Endocrinology, April 1, 2003; 144(4): 1524 - 1532. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. Speert, S. J. MCClennen, and A. F. Seasholtz Sexually Dimorphic Expression of Corticotropin-Releasing Hormone-Binding Protein in the Mouse Pituitary Endocrinology, December 1, 2002; 143(12): 4730 - 4741. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Holloway, D. C. Howe, G. Chan, V. L. Clifton, R. Smith, and J. R. G. Challis Urocortin: a mechanism for the sustained activation of the HPA axis in the late-gestation ovine fetus? Am J Physiol Endocrinol Metab, July 1, 2002; 283(1): E165 - E171. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kimura, K. Takahashi, K. Totsune, Y. Muramatsu, C. Kaneko, A. D. Darnel, T. Suzuki, M. Ebina, T. Nukiwa, and H. Sasano Expression of Urocortin and Corticotropin-Releasing Factor Receptor Subtypes in the Human Heart J. Clin. Endocrinol. Metab., January 1, 2002; 87(1): 340 - 346. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. SLOMINSKI, J. WORTSMAN, A. PISARCHIK, B. ZBYTEK, E. A. LINTON, J. E. MAZURKIEWICZ, and E. T. WEI Cutaneous expression of corticotropin-releasing hormone (CRH), urocortin, and CRH receptors FASEB J, August 1, 2001; 15(10): 1678 - 1693. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Muramatsu, N. Sugino, T. Suzuki, K. Totsune, K. Takahashi, A. Tashiro, M. Hongo, Y. Oki, and H. Sasano Urocortin and Corticotropin-Releasing Factor Receptor Expression in Normal Cycling Human Ovaries J. Clin. Endocrinol. Metab., March 1, 2001; 86(3): 1362 - 1369. [Abstract] [Full Text] |
||||
![]() |
J. Schwartz Intercellular Communication in the Anterior Pituitary Endocr. Rev., October 1, 2000; 21(5): 488 - 513. [Abstract] [Full Text] |
||||
![]() |
K. Kageyama, G. E. Gaudriault, M. J. Bradbury, and W. W. Vale Regulation of Corticotropin-Releasing Factor Receptor Type 2{beta} Messenger Ribonucleic Acid in the Rat Cardiovascular System by Urocortin, Glucocorticoids, and Cytokines Endocrinology, July 1, 2000; 141(7): 2285 - 2293. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Slominski, B. Roloff, J. Curry, M. Dahiya, A. Szczesniewski, and J. Wortsman The Skin Produces Urocortin J. Clin. Endocrinol. Metab., February 1, 2000; 85(2): 815 - 823. [Abstract] [Full Text] |
||||
![]() |
S. Matsuzaki, T. Fukaya, T. Suzuki, T. Murakami, H. Sasano, and A. Yajima Oestrogen receptor {alpha} and ß mRNA expression in human endometrium throughout the menstrual cycle Mol. Hum. Reprod., June 1, 1999; 5(6): 559 - 564. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Petraglia, P. Florio, C. Benedetto, L. Marozio, A. M. Di Blasio, C. Ticconi, E. Piccione, S. Luisi, A. R. Genazzani, and W. Vale Urocortin Stimulates Placental Adrenocorticotropin and Prostaglandin Release and Myometrial Contractility in Vitro J. Clin. Endocrinol. Metab., April 1, 1999; 84(4): 1420 - 1423. [Abstract] [Full Text] |
||||
![]() |
H. Sasano, T. Suzuki, Y. Matsuzaki, T. Fukaya, M. Endoh, H. Nagura, and M. Kimura Messenger Ribonucleic Acid in Situ Hybridization Analysis of Estrogen Receptors {alpha} and {beta} in Human Breast Carcinoma J. Clin. Endocrinol. Metab., February 1, 1999; 84(2): 781 - 785. [Abstract] [Full Text] |
||||
![]() |
A. V. Turnbull, J. Vaughan, J. E. Rivier, W. W. Vale, and C. Rivier Urocortin Is Not a Significant Regulator of Intermittent Electrofootshock-Induced Adrenocorticotropin Secretion in the Intact Male Rat Endocrinology, January 1, 1999; 140(1): 71 - 78. [Abstract] [Full Text] |
||||
![]() |
S. J. McClennen, D. N. Cortright, and A. F. Seasholtz Regulation of Pituitary Corticotropin-Releasing Hormone-Binding Protein Messenger Ribonucleic Acid Levels by Restraint Stress and Adrenalectomy Endocrinology, November 1, 1998; 139(11): 4435 - 4441. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Takeyama, H. Sasano, T. Suzuki, K. Iinuma, H. Nagura, and S. Andersson 17{beta}-Hydroxysteroid Dehydrogenase Types 1 and 2 in Human Placenta: An Immunohistochemical Study with Correlation to Placental Development J. Clin. Endocrinol. Metab., October 1, 1998; 83(10): 3710 - 3715. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |