| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Department of Obstetrics and Gynecology, National University of Singapore, Republic of Singapore 119074; and Lady Davis Institute for Medical Research, Sir Mortimer B. Davis-Jewish General Hospital, Departments of Human Genetics and Medicine, McGill University (M.A.T., L.P.), Montreal, Canada H3T 1E2
Address all correspondence and requests for reprints to: Dr. E. L. Yong, Department of Obstetrics and Gynecology, National University Hospital, Lower Kent Ridge Road, Republic of Singapore 119074.
| Abstract |
|---|
|
|
|---|
23 Gln). Whole cell transfection
experiments using AR constructs harboring 15, 20, and 31 Gln repeats
and a luciferase reporter gene with an androgen response element
promoter confirmed an inverse relationship between Gln number and
trans-regulatory activity. Immunoblot analyses indicated
that the reduced androgenicity of the AR was unlikely to be due to a
change in AR protein content. The data indicate a direct relation
between length of the AR polyglutamine tract and the risk of defective
spermatogenesis that is attributable to the decreased functional
competence of AR with longer glutamine tracts. | Introduction |
|---|
|
|
|---|
| Subjects and Methods |
|---|
|
|
|---|
Trinucleotide repeat allele analysis
DNA was extracted from the peripheral blood of patients and
control subjects using standard techniques (10). The CAG repeat segment
was amplified using primers ALS and A2 (Fig. 1
) (4). One microcurie of
[
-33P]deoxy-ATP was added to make a final reaction
volume of 25 µL. We used a 2-step 30-cycle amplification protocol in
which the denaturing temperature was 95 C for 45 s, and the
combined annealing and extension temperature was 68 C for 1.5 min. In
the first cycle the sample was denatured for 5 min. The GGC repeat
segment was amplified using 70% deaza-GTP, thermostable vent DNA
polymerase, and the primers A7.1 (CTCATCCTGGCACACTCTCTTCACAGC) and A8
(GGACTGGGATAGGGCACTCTGCTCACC; Fig. 1
). Denaturing temperatures of 98 C
for 1 min and annealing/extension at 70 C for 5 min were used for 40
cycles to amplify this GC-rich region. The reactions were terminated
with 20 µL of a solution containing 95% formamide in 20 mmol/L
ethylenediamine tetraacetate and 0.05% of bromophenol blue and xylene
cyanol. The mixture was heat denatured for 3 min at 95 C before being
electrophoresed on an 8% polyacrylamide-7 mol/L urea sequencing gel at
70 watts for 6 h. Gels were dried and exposed to Kodak X-Omat film
(Eastman Kodak, Rochester, NY) overnight. The size of the most
prominent (usually upper doublet) band was determined by comparison
with PCR products of known lengths and also with dideoxy sequencing
ladders. Each allele was examined on at least two separate occasions
using different PCR reactions, and alleles of the same size were
examined together to eliminate any discrepancies in length. Some
repeats were also directly sequenced to confirm the accuracy of the
length assignments, and these were subsequently used as reference
samples. Sequencing was performed using automated fluorescent
sequencing (Perkin-Elmer, Foster City, CA) in both the forward and
reverse directions.
|
The rest of the coding sequence of AR (exons 28) was examined by PCR-SSCP and silver staining (10) to screen for other associated subtle mutations in our group of patients. This was to ensure that our data were not confounded by exonic mutations that were linked to any particular trinucleotide repeat allelle. Mutations so uncovered were not included in this report.
Construction of CAG expression plasmids
Two AR alleles with polyglutamine sizes at the extremes of our range were selected, 1 with 31 glutamines (Gln) from an infertile patient, and the other with 15 Gln from a normal control. The segments containing either 15 or 31 polyglutamine repeats were amplified from genomic DNA using the primer pairs A1 and A2 (3) and high fidelity Pfu DNA polymerase (Stratagene, La Jolla, CA). The amplified fragments containing the CAG trinucleotide tract were gel purified and double digested with EagI and BfrI, and the central fragment with overhanging ends was ligated to an AR expression plasmid (BHEXE-pAR) that had the corresponding segment excised. The resulting vectors, encoding ARs with 31 and 15 Gln, were used along with the original BHEXE-pAR (20 Gln) for cotransfection experiments. The spliced portions were sequenced to confirm the lengths of polyglutamine tracts as well as to exclude any inadvertent mutations.
Measurement of AR function
Plasmid constructs were transfected into COS-7 cells, a
heterologous mammalian cell line that does not express endogenous AR.
The reporter gene was pMAMneo-LUC (Clontech, Palo Alto CA), containing
the luciferase gene coupled to the mouse mammary tumor virus long
terminal repeat. The mouse mammary tumor virus long terminal repeat has
several ARE that make it a strong promoter when activated by
ligand-bound AR. COS-7 cells were transiently transfected using the
lipofection technique. A DNA mix containing expression vector (1 µg),
pMAMneo-LUC (1 µg) and pßGal (0.5 µg) was preincubated for 45 min
at room temperature with 10 µL Lipofectamine (Promega, Madison, WI)
in 400 µL serum-free medium. The DNA-liposome complexes were
overlayed onto 8095% confluent COS-7 cells in a total volume of 2.4
mL, and transfection was continued for 1624 h before the addition of
growth medium containing 10% charcoal-stripped FCS,
penicillin-streptomycin, a 5
-reductase inhibitor (finasteride,
10-7 mol/L), and the indicated amounts of androgens. After
4048 h of incubation, the cells were rinsed twice with
phosphate-buffered saline and lysed with 400 µL reporter lysis buffer
(Promega). Cells were scraped from the petri dishes, and after one
freeze-thaw cycle, the cell lysates were cleared by centrifugation at
12,000 x g for 10 min. Cell lysates (20 µL) were
added to 100 µL luciferase substrate, and luciferase activity
measured with a luminometer. Transfection efficiency was assessed by
ß-galactosidase activity and luciferase activity normalized by the
protein content of the cell lysates. Total protein in the supernatant
was quantified using the method of Lowry et al. (11), with
BSA as the standard.
Western analysis
Immunoblot analyses were used to study the effect of polyglutamine length on levels of AR protein. Equal volumes of 2 x SDS-PAGE gel loading buffer (100 mmol/L Tris Cl, pH 6.8; 200 mmol/L dithiothreitol; 4% SDS; 0.2% bromophenol blue; and 20% glycerol) were added to the cell extracts (30 µg total protein), and the samples of cleared cell lysates were heated to 100 C for 5 min before loading onto a 7% SDS-PAGE gel. Electrophoresis was carried out in SDS-PAGE running buffer (25 mmol/L Tris, 250 mmol/L glycine, and 0.1% SDS) at 80 V for 1.5 h. The gel was preequilibrated for 15 min in transfer buffer (48 mmol/L Tris base, 39 mmol/L glycine, and 20% methanol) before electroblotting (100 V, 1 h) onto nitrocellulose membrane (Hybond ECL, Amersham, Singapore) using the Mini Trans-Blot Cell (Bio-Rad, Hercules, CA). We used the rabbit monoclonal antibody, PG-21 (a gift from Dr. G. Prins), to recognize the first 21 N-terminal amino acids of the human AR. AR-antibody complexes were subsequently visualized by enhanced chemiluminescence following the manufacturers protocol (ECL System, Amersham).
Statistical analyses
The computed odds ratio (OR) was used as an estimate of the relative risk. Confidence intervals (CIs) on the OR were constructed based on the logarithmic transformation method of Katz (12). Students t test was used to evaluate differences in trans-activation experiments. Values of P < 0.05 were considered significant.
| Results |
|---|
|
|
|---|
|
-33P]deoxy-ATP, and
their sizes were determined by comparison with sequencing ladders on
denaturing polyacrylamide gels (Fig. 2
|
|
|
| Discussion |
|---|
|
|
|---|
28 Gln), although still in the polymorphic
range, was associated with a significantly increased risk of defective
spermatogenesis. There was a trend whereby the greater the
spermatogenic defect, the greater the proportion of patients with long
polyglutamine tracts. In contrast, short polyglutamine tracts were
significantly associated with reduced risk of infertility. These
differences were not due to ethnic origins (22), as the racial
composition of patients and controls were similar, the majority being
of Southern Chinese descent. The maximum polyglutamine length encountered in our patients was 31 Gln, well short of the 40 or more Gln found in SBMA patients. Although there is evidence that the pathologically expanded tracts found in SBMA patients can reduce AR trans-activation (23), our data suggest that the polymorphic expansions in Gln number encountered in our patients could also significantly reduce AR function in vitro. There was an inverse relationship between the length of the polyglutamine tract and the ability to trans-activate a reporter gene with AREs in its promoter. This reduced trans-activation was seen with both of the physiological androgens, testosterone and DHT, and at doses of DHT between 10100 nmol/L. Relatively high doses of androgens were selected because androgen levels are 50- to 100-fold higher in the testes than those in plasma (24). High concentrations of androgens, although greater than their Kd in vitro, appear essential for sperm production, as spermatogenesis could be impaired when testosterone levels in seminiferous tubule fluid were below 45 nmol/L (16). Examination of messenger ribonucleic acid and protein expression of AR constructs harboring 066 Gln suggest that repeat expansion could be associated with reduced AR messenger ribonucleic acid and protein expression (25). Reduction of immunodetectable AR with increasing polyglutamine length was not observed in our study, although the range examined (1531 Gln) could be too narrow for these differences to be evident.
Thus, both in vivo and in vitro data support the concept that the longer its Gln repeat, the less androgenic the AR. On the other hand, short Gln repeats are associated with increased risk of the androgen-dependent tumor, prostate cancer (26). Prostate cancer can be considered a manifestation of an excessive response to androgens, and androgen suppression or ablation therapy has been used to control the malignancy (27). A length less than 23 Gln was associated with a 2-fold increased risk of the cancer (7). Cases with short polyglutamine lengths had an earlier age of onset of prostate cancer (8), increased extraprostatic extension, and higher histological grade of tumor (28). Interestingly, ARs with polyglutamine lengths of 23 or fewer, the same size that was found to give an excessive risk of prostate cancer (7), were associated with a reduced risk of male infertility in the present study, suggesting that the greater androgenicity associated with the shorter Gln repeats could boost germ cell replication but at the long term risk of overstimulating the growth of prostatic tissue. Collectively, the evidence supports the hypothesis that the Gln repeat has a role in AR function by fine-tuning the balance between excess and deficient receptor function. The highly polymorphic nature of the Gln repeat would imply a subtle gradation of AR function among individuals, possibly allowing alleles with evolutionary advantages to be selected and transmitted to future generations.
None of our patients with moderate expansion of the CAG repeat segment
exhibit any sign of neuromuscular disease. The greatest CAG repeat
number in our patients was 31, whereas all cases of SBMA have segment
lengths above 40 (4). Besides SBMA, Gln repeat expansions have been
implicated in several other neurodegenerative disorders (29),
including, Huntingtons disease, spinocerebellar ataxia type 1,
dentatorubral-pallidoluysian atrophy, and Machado-Josephs
disease. In these neurodegenerative diseases, there is no overlap
between disease-causing alleles and their normal counterparts. Moderate
expansion of the polyglutamine tract (2831 Gln) exerts a modulatory
effect on the usual AR function, whereas expansion beyond a threshold
(
40 Gln) is likely to trigger a separate process that is neurotoxic.
The size distribution of polyglutamine alleles in our patients with
defective spermatogenesis overlapped that of fertile controls.
Polyglutamine expansion confers an increased risk, but is not an
absolute index of male infertility. This is not surprising, as
conception is still possible with reduced sperm counts, albeit the
chance of success is less than normal. In some of our cases repeat
expansion may be one of several factors (30) contributing to defective
spermatogenesis.
In summary, this study suggests for the first time that subjects with long polyglutamine tracts in their AR have a significantly increased risk of defective spermatogenesis. Cases with 28 or more Gln in their AR protein have a 4-fold higher risk of male infertility compared to fertile controls. On the other hand, ARs with short Gln repeats are associated with a reduced risk of male infertility. In vitro expression of a range of AR variants encountered in our subjects showed an inverse relationship between the length of the Gln repeat and trans-activation function. Thus, both in vivo and in vitro data suggest that the length of the Gln repeat could have an etiological role in male infertility through its effect on AR trans-activation competence. Further study of the structural mechanisms of regulation by the AR Gln repeats and the genes so regulated could lead to a greater understanding of trinucleotide repeat tracts in general, and the design of rational hormonal therapy (13) for male infertility in particular.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received June 3, 1997.
Revised July 30, 1997.
Accepted August 5, 1997.
| References |
|---|
|
|
|---|
18) in the androgen receptor gene in
human prostate cancer. Biochem Biophys Res Commun. 198:7480.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
S. Chatterjee, R. Singh, S. Kadam, A. Maitra, K. Thangaraj, P. Meherji, and D. Modi Longer CAG repeat length in the androgen receptor gene is associated with premature ovarian failure Hum. Reprod., December 1, 2009; 24(12): 3230 - 3235. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Stouffs, H. Tournaye, I. Liebaers, and W. Lissens Male infertility and the involvement of the X chromosome Hum. Reprod. Update, November 1, 2009; 15(6): 623 - 637. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. A. Badran, I. Fahmy, W. M. Abdel-Megid, K. Elder, R. Mansour, and M. Kent-First Length of Androgen Receptor-CAG Repeats in Fertile and Infertile Egyptian Men J Androl, July 1, 2009; 30(4): 416 - 425. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Davies, K. Watt, S. M Kelly, C. Clark, N. C Price, and I. J McEwan Consequences of poly-glutamine repeat length for the conformation and folding of the androgen receptor amino-terminal domain J. Mol. Endocrinol., November 1, 2008; 41(5): 301 - 314. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. E. MacLean, W. S. M. Chiu, C. Ma, J. F. McManus, R. A. Davey, R. Cameron, A. J. Notini, and J. D. Zajac A floxed allele of the androgen receptor gene causes hyperandrogenization in male mice Physiol Genomics, October 8, 2008; 33(1): 133 - 137. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Biggs, M. D. Davis, D. L. Eaton, N. S. Weiss, D. B. Barr, D. R. Doody, S. Fish, L. L. Needham, C. Chen, and S. M. Schwartz Serum Organochlorine Pesticide Residues and Risk of Testicular Germ Cell Carcinoma: A Population-Based Case-Control Study Cancer Epidemiol. Biomarkers Prev., August 1, 2008; 17(8): 2012 - 2018. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Page, J. K. Amory, and W. J. Bremner Advances in Male Contraception Endocr. Rev., June 1, 2008; 29(4): 465 - 493. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Shah, H. J. Antoine, M. Pall, K. D. Taylor, R. Azziz, and M. O. Goodarzi Association of Androgen Receptor CAG Repeat Polymorphism and Polycystic Ovary Syndrome J. Clin. Endocrinol. Metab., May 1, 2008; 93(5): 1939 - 1945. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Eberhard, O. Stahl, M. Cwikiel, E. Cavallin-Stahl, Y. Giwercman, E. C. Salmonson, and A. Giwercman Risk factors for post-treatment hypogonadism in testicular cancer patients. Eur. J. Endocrinol., April 1, 2008; 158(4): 561 - 570. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Davis-Dao, E. D. Tuazon, R. Z. Sokol, and V. K. Cortessis Male Infertility and Variation in CAG Repeat Length in the Androgen Receptor Gene: A Meta-analysis J. Clin. Endocrinol. Metab., November 1, 2007; 92(11): 4319 - 4326. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bhasin Approach to the Infertile Man J. Clin. Endocrinol. Metab., June 1, 2007; 92(6): 1995 - 2004. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Amaral, J. Ramalho-Santos, and J. C. St John The expression of polymerase gamma and mitochondrial transcription factor A and the regulation of mitochondrial DNA content in mature human sperm Hum. Reprod., June 1, 2007; 22(6): 1585 - 1596. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tiido, A. Rignell-Hydbom, B.A.G. Jonsson, L. Rylander, A. Giwercman, and Y.L. Giwercman Modifying effect of the AR gene trinucleotide repeats and SNPs in the AHR and AHRR genes on the association between persistent organohalogen pollutant exposure and human sperm Y : X ratio Mol. Hum. Reprod., April 1, 2007; 13(4): 223 - 229. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Radpour, M. Rezaee, A. Tavasoly, S. Solati, and A. Saleki Association of Long Polyglycine Tracts (GGN Repeats) in Exon 1 of the Androgen Receptor Gene With Cryptorchidism and Penile Hypospadias in Iranian Patients J Androl, January 1, 2007; 28(1): 164 - 169. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rajender, V. Rajani, N. J. Gupta, B. Chakravarty, L. Singh, and K. Thangaraj No Association of Androgen Receptor GGN Repeat Length Polymorphism With Infertility in Indian Men J Androl, November 1, 2006; 27(6): 785 - 789. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Werner, P.-M. Holterhus, G. Binder, H.-P. Schwarz, M. Morlot, D. Struve, C. Marschke, and O. Hiort The A645D Mutation in the Hinge Region of the Human Androgen Receptor (AR) Gene Modulates AR Activity, Depending on the Context of the Polymorphic Glutamine and Glycine Repeats J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3515 - 3520. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. B. Lundin, A. Nordenskjold, A. Giwercman, and Y. L. Giwercman Frequent Finding of the Androgen Receptor A645D Variant in Normal Population J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 3228 - 3231. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Albertelli, A. Scheller, M. Brogley, and D. M. Robins Replacing the Mouse Androgen Receptor with Human Alleles Demonstrates Glutamine Tract Length-Dependent Effects on Physiology and Tumorigenesis in Mice Mol. Endocrinol., June 1, 2006; 20(6): 1248 - 1260. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Rajpert-De Meyts Developmental model for the pathogenesis of testicular carcinoma in situ: genetic and environmental aspects Hum. Reprod. Update, May 1, 2006; 12(3): 303 - 323. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Guarducci, F. Nuti, L. Becherini, M. Rotondi, G. Balercia, G. Forti, and C. Krausz Estrogen receptor {alpha} promoter polymorphism: stronger estrogen action is coupled with lower sperm count Hum. Reprod., April 1, 2006; 21(4): 994 - 1001. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wang, E. M. John, and S. A. Ingles Androgen Receptor and Prostate-Specific Antigen Gene Polymorphisms and Breast Cancer in African-American Women Cancer Epidemiol. Biomarkers Prev., December 1, 2005; 14(12): 2990 - 2994. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Zinn, P. Ramos, F. F. Elder, K. Kowal, C. Samango-Sprouse, and J. L. Ross Androgen Receptor CAGn Repeat Length Influences Phenotype of 47,XXY (Klinefelter) Syndrome J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5041 - 5046. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Terry, I. De Vivo, L. Titus-Ernstoff, M.-C. Shih, and D. W. Cramer Androgen Receptor Cytosine, Adenine, Guanine Repeats, and Haplotypes in Relation to Ovarian Cancer Risk Cancer Res., July 1, 2005; 65(13): 5974 - 5981. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ferlin, A. Garolla, A. Bettella, L. Bartoloni, C. Vinanzi, A. Roverato, and C. Foresta Androgen receptor gene CAG and GGC repeat lengths in cryptorchidism Eur. J. Endocrinol., March 1, 2005; 152(3): 419 - 425. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. S. Brum, P. M. Spritzer, F. Paris, M. A. Maturana, F. Audran, and C. Sultan Association Between Androgen Receptor Gene CAG Repeat Polymorphism and Plasma Testosterone Levels in Postmenopausal Women Reproductive Sciences, February 1, 2005; 12(2): 135 - 141. [Abstract] [PDF] |
||||
![]() |
E. L. Aschim, A. Nordenskjold, A. Giwercman, K. B. Lundin, Y. Ruhayel, T. B. Haugen, T. Grotmol, and Y. L. Giwercman Linkage between Cryptorchidism, Hypospadias, and GGN Repeat Length in the Androgen Receptor Gene J. Clin. Endocrinol. Metab., October 1, 2004; 89(10): 5105 - 5109. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Krausz, E. Guarducci, L. Becherini, S. degl'Innocenti, L. Gerace, G. Balercia, and G. Forti The Clinical Significance of the POLG Gene Polymorphism in Male Infertility J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4292 - 4297. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ruhayel, K. Lundin, Y. Giwercman, C. Hallden, M. Willen, and A. Giwercman Androgen receptor gene GGN and CAG polymorphisms among severely oligozoospermic and azoospermic Swedish men Hum. Reprod., September 1, 2004; 19(9): 2076 - 2083. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Buchanan, M. Yang, A. Cheong, J. M. Harris, R. A. Irvine, P. F. Lambert, N. L. Moore, M. Raynor, P. J. Neufing, G. A. Coetzee, et al. Structural and functional consequences of glutamine tract variation in the androgen receptor Hum. Mol. Genet., August 15, 2004; 13(16): 1677 - 1692. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ferlin, L. Bartoloni, G. Rizzo, A. Roverato, A. Garolla, and C. Foresta Androgen receptor gene CAG and GGC repeat lengths in idiopathic male infertility Mol. Hum. Reprod., June 1, 2004; 10(6): 417 - 421. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Eberhard, O. Stahl, Y. Giwercman, M. Cwikiel, E. Cavallin-Stahl, K.B. Lundin, P. Flodgren, and A. Giwercman Impact of therapy and androgen receptor polymorphism on sperm concentration in men treated for testicular germ cell cancer: a longitudinal study Hum. Reprod., June 1, 2004; 19(6): 1418 - 1425. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Milatiner, D. Halle, M. Huerta, E. J. Margalioth, Y. Cohen, A. Ben-Chetrit, M. Gal, T. Mimoni, and T. Eldar-Geva Associations between androgen receptor CAG repeat length and sperm morphology Hum. Reprod., June 1, 2004; 19(6): 1426 - 1430. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Wang, T. S. Udayakumar, T. S. Vasaitis, A. M. Brodie, and J. D. Fondell Mechanistic Relationship between Androgen Receptor Polyglutamine Tract Truncation and Androgen-dependent Transcriptional Hyperactivity in Prostate Cancer Cells J. Biol. Chem., April 23, 2004; 279(17): 17319 - 17328. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Raber Androgens, ApoE, and Alzheimer's Disease Sci. Aging Knowl. Environ., March 17, 2004; 2004(11): re2 - re2. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Modugno Ovarian Cancer and Polymorphisms in the Androgen and Progesterone Receptor Genes: A HuGE Review Am. J. Epidemiol., February 15, 2004; 159(4): 319 - 335. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. O. Roberts, E. J. Bergstralh, J. M. Cunningham, S. J. Hebbring, S. N. Thibodeau, M. M. Lieber, and S. J. Jacobsen Androgen Receptor Gene Polymorphisms and Increased Risk of Urologic Measures of Benign Prostatic Hyperplasia Am. J. Epidemiol., February 1, 2004; 159(3): 269 - 276. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Liede, W. Zhang, M. L. D. L. Matsuda, A. Tan, and S. A. Narod Androgen Receptor Gene Polymorphism and Breast Cancer Susceptibility in the Philippines Cancer Epidemiol. Biomarkers Prev., September 1, 2003; 12(9): 848 - 852. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.B. Lundin, A. Giwercman, J. Richthoff, P-A. Abrahamsson, and Y.L. Giwercman No association between mutations in the human androgen receptor GGN repeat and inter-sex conditions Mol. Hum. Reprod., July 1, 2003; 9(7): 375 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Woodhouse, S. Reisz-Porszasz, M. Javanbakht, T. W. Storer, M. Lee, H. Zerounian, and S. Bhasin Development of models to predict anabolic response to testosterone administration in healthy young men Am J Physiol Endocrinol Metab, May 1, 2003; 284(5): E1009 - E1017. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Mengual, J. Oriola, C. Ascaso, J. L. Ballesca, and R. Oliva An Increased CAG Repeat Length in the Androgen Receptor Gene in Azoospermic ICSI Candidates J Androl, March 1, 2003; 24(2): 279 - 284. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Liao, L.-Y. Chen, A. Zhang, A. Godavarthy, F. Xia, J. C. Ghosh, H. Li, and J. D. Chen Regulation of Androgen Receptor Activity by the Nuclear Receptor Corepressor SMRT J. Biol. Chem., February 7, 2003; 278(7): 5052 - 5061. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Suter, K. E. Malone, J. R. Daling, D. R. Doody, and E. A. Ostrander Androgen Receptor (CAG)n and (GGC)n Polymorphisms and Breast Cancer Risk in a Population-Based Case-Control Study of Young Women Cancer Epidemiol. Biomarkers Prev., February 1, 2003; 12(2): 127 - 135. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Richthoff, M. Spano, Y.L. Giwercman, B. Frohm, K. Jepson, J. Malm, S. Elzanaty, M. Stridsberg, and A. Giwercman The impact of testicular and accessory sex gland function on sperm chromatin integrity as assessed by the sperm chromatin structure assay (SCSA) Hum. Reprod., December 1, 2002; 17(12): 3162 - 3169. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. F. Satterfield, S. M. Jackson, and L. J. Pallanck A Drosophila Homolog of the Polyglutamine Disease Gene SCA2 Is a Dosage-Sensitive Regulator of Actin Filament Formation Genetics, December 1, 2002; 162(4): 1687 - 1702. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Thangaraj, M. B. Joshi, A. G. Reddy, N. J. Gupta, B. Chakravarty, and L. Singh CAG Repeat Expansion in the Androgen Receptor Gene Is Not Associated With Male Infertility in Indian Populations J Androl, November 1, 2002; 23(6): 815 - 818. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Dejager, H. Bry-Gauillard, E. Bruckert, B. Eymard, F. Salachas, E. LeGuern, S. Tardieu, R. Chadarevian, P. Giral, and G. Turpin A Comprehensive Endocrine Description of Kennedy's Disease Revealing Androgen Insensitivity Linked to CAG Repeat Length J. Clin. Endocrinol. Metab., August 1, 2002; 87(8): 3893 - 3901. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. L. Giwercman, A. Nordenskjold, E. M. Ritzen, K. O. Nilsson, S.-A. Ivarsson, U. Grandell, and A. Wedell An Androgen Receptor Gene Mutation (E653K) in a Family with Congenital Adrenal Hyperplasia due to Steroid 21-Hydroxylase Deficiency as well as in Partial Androgen Insensitivity J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2623 - 2628. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Nelson and J. S. Witte Androgen Receptor CAG Repeats and Prostate Cancer Am. J. Epidemiol., May 15, 2002; 155(10): 883 - 890. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Heinlein and C. Chang Androgen Receptor (AR) Coregulators: An Overview Endocr. Rev., April 1, 2002; 23(2): 175 - 200. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Haiman, M. Brown, S. E. Hankinson, D. Spiegelman, G. A. Colditz, W. C. Willett, P. W. Kantoff, and D. J. Hunter The Androgen Receptor CAG Repeat Polymorphism and Risk of Breast Cancer in the Nurses' Health Study Cancer Res., February 1, 2002; 62(4): 1045 - 1049. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hickey, A. Chandy, and R. J. Norman The Androgen Receptor CAG Repeat Polymorphism and X-Chromosome Inactivation in Australian Caucasian Women with Infertility Related to Polycystic Ovary Syndrome J. Clin. Endocrinol. Metab., January 1, 2002; 87(1): 161 - 165. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ishii, S. Sato, K. Kosaki, G. Sasaki, K. Muroya, T. Ogata, and N. Matsuo Micropenis and the AR Gene: Mutation and CAG Repeat-Length Analysis J. Clin. Endocrinol. Metab., November 1, 2001; 86(11): 5372 - 5378. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mifsud, A. T. Choon, D. Fang, and E.L. Yong Prostate-specific antigen, testosterone, sex-hormone binding globulin and androgen receptor CAG repeat polymorphisms in subfertile and normal men Mol. Hum. Reprod., November 1, 2001; 7(11): 1007 - 1013. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zitzmann, M. Brune, B. Kornmann, J. Gromoll, S. von Eckardstein, A. von Eckardstein, and E. Nieschlag The CAG Repeat Polymorphism in the AR Gene Affects High Density Lipoprotein Cholesterol and Arterial Vasoreactivity J. Clin. Endocrinol. Metab., October 1, 2001; 86(10): 4867 - 4873. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Modugno, J. L. Weissfeld, D. L. Trump, J. M. Zmuda, P. Shea, J. A. Cauley, and R. E. Ferrell Allelic Variants of Aromatase and the Androgen and Estrogen Receptors: Toward a Multigenic Model of Prostate Cancer Risk Clin. Cancer Res., October 1, 2001; 7(10): 3092 - 3096. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Yu and D. J. Handelsman Pharmacogenetic Polymorphisms of the AR and Metabolism and Susceptibility to Hormone- Induced Azoospermia J. Clin. Endocrinol. Metab., September 1, 2001; 86(9): 4406 - 4411. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. ROHRER, T. H. WISE, D. D. LUNSTRA, and J. J. FORD Identification of genomic regions controlling plasma FSH concentrations in Meishan-White Composite boars Physiol Genomics, August 30, 2001; 6(3): 145 - 151. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. A. Hughes Minireview: Sex Differentiation Endocrinology, August 1, 2001; 142(8): 3281 - 3287. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Suzuki, I. Sasagawa, T. Tateno, J. Ashida, T. Nakada, K. Muroya, and T. Ogata Mutation screening and CAG repeat length analysis of the androgen receptor gene in Klinefelter's syndrome patients with and without spermatogenesis Hum. Reprod., August 1, 2001; 16(8): 1653 - 1656. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Giguere, E. Dewailly, J. Brisson, P. Ayotte, N. Laflamme, A. Demers, V.-I. Forest, S. Dodin, J. Robert, and F. Rousseau Short Polyglutamine Tracts in the Androgen Receptor Are Protective against Breast Cancer in the General Population Cancer Res., August 1, 2001; 61(15): 5869 - 5874. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. N. Lim, R. M. Nixon, H. Chen, I. A. Hughes, and J. R. Hawkins Evidence That Longer Androgen Receptor Polyglutamine Repeats Are a Causal Factor for Genital Abnormalities J. Clin. Endocrinol. Metab., July 1, 2001; 86(7): 3207 - 3210. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Westberg, F. Baghaei, R. Rosmond, M. Hellstrand, M. Landen, M. Jansson, G. Holm, P. Bjorntorp, and E. Eriksson Polymorphisms of the Androgen Receptor Gene and the Estrogen Receptor {beta} Gene Are Associated with Androgen Levels in Women J. Clin. Endocrinol. Metab., June 1, 2001; 86(6): 2562 - 2568. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. von Eckardstein, A. Syska, J. Gromoll, A. Kamischke, M. Simoni, and E. Nieschlag Inverse Correlation between Sperm Concentration and Number of Androgen Receptor CAG Repeats in Normal Men J. Clin. Endocrinol. Metab., June 1, 2001; 86(6): 2585 - 2590. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Muroya, I. Sasagawa, Y. Suzuki, T. Nakada, T. Ishii, and T. Ogata Hypospadias and the androgen receptor gene: mutation screening and CAG repeat length analysis Mol. Hum. Reprod., May 1, 2001; 7(5): 409 - 413. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Sasagawa, Y. Suzuki, T. Tateno, T. Nakada, K. Muroya, and T. Ogata CAG repeat length of the androgen receptor gene in Japanese males with cryptorchidism Mol. Hum. Reprod., November 1, 2000; 6(11): 973 - 975. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mifsud, S. Ramirez, and E. L. Yong Androgen Receptor Gene CAG Trinucleotide Repeats in Anovulatory Infertility and Polycystic Ovaries J. Clin. Endocrinol. Metab., September 1, 2000; 85(9): 3484 - 3488. [Abstract] [Full Text] |
||||
![]() |
D.S. Cram, B. Song, R.I. McLachlan, and A.O. Trounson CAG trinucleotide repeats in the androgen receptor gene of infertile men exhibit stable inheritance in female offspring conceived after ICSI Mol. Hum. Reprod., September 1, 2000; 6(9): 861 - 866. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. W. Hsing, Y.-T. Gao, G. Wu, X. Wang, J. Deng, Y.-L. Chen, I. A. Sesterhenn, F. K. Mostofi, J. Benichou, and C. Chang Polymorphic CAG and GGN Repeat Lengths in the Androgen Receptor Gene and Prostate Cancer Risk: A Population-based Case-Control Study in China Cancer Res., September 1, 2000; 60(18): 5111 - 5116. [Abstract] [Full Text] |
||||
![]() |
O. Hiort, P.-M. Holterhus, T. Horter, W. Schulze, B. Kremke, M. Bals-Pratsch, G. H. G. Sinnecker, and K. Kruse Significance of Mutations in the Androgen Receptor Gene in Males with Idiopathic Infertility J. Clin. Endocrinol. Metab., August 1, 2000; 85(8): 2810 - 2815. [Abstract] [Full Text] |
||||
![]() |
J. Lim, F. J. Ghadessy, A. A. R. Abdullah, L. Pinsky, M. Trifiro, and E. L. Yong Human Androgen Receptor Mutation Disrupts Ternary Interactions between Ligand, Receptor Domains, and the Coactivator TIF2 (Transcription Intermediary Factor 2) Mol. Endocrinol., August 1, 2000; 14(8): 1187 - 1197. [Abstract] [Full Text] |
||||
![]() |
H.N. Lim, H. Chen, S. McBride, A.M. Dunning, R.M. Nixon, I.A. Hughes, and J.R. Hawkins Longer polyglutamine tracts in the androgen receptor are associated with moderate to severe undermasculinized genitalia in XY males Hum. Mol. Genet., March 22, 2000; 9(5): 829 - 834. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Dadze, C. Wieland, S. Jakubiczka, K. Funke, E. Schroder, B. Royer-Pokora, R. Willers, and P.F. Wieacker The size of the CAG repeat in exon 1 of the androgen receptor gene shows no significant relationship to impaired spermatogenesis in an infertile Caucasoid sample of German origin Mol. Hum. Reprod., March 1, 2000; 6(3): 207 - 214. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Irvine, H. Ma, M. C. Yu, R. K. Ross, M. R. Stallcup, and G. A. Coetzee Inhibition of p160-mediated coactivation with increasing androgen receptor polyglutamine length Hum. Mol. Genet., January 22, 2000; 9(2): 267 - 274. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Dunning, S. McBride, J. Gregory, F. Durocher, N. A. Foster, C. S. Healey, N. Smith, P. D. P. Pharoah, R. N. Luben, D. F. Easton, et al. No association between androgen or vitamin D receptor gene polymorphisms and risk of breast cancer Carcinogenesis, November 1, 1999; 20(11): 2131 - 2135. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. de Kretser and H. W. G. Baker Infertility in Men: Recent Advances and Continuing Controversies J. Clin. Endocrinol. Metab., October 1, 1999; 84(10): 3443 - 3450. [Full Text] [PDF] |
||||
![]() |
A. B. Spurdle, G. S. Dite, X. Chen, C. J. Mayne, M. C. Southey, L. E. Batten, H. Chy, L. Trute, M. R. E. McCredie, G. G. Giles, et al. Androgen Receptor Exon 1 CAG Repeat Length and Breast Cancer in Women Before Age Forty Years J Natl Cancer Inst, June 2, 1999; 91(11): 961 - 966. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.J. Ghadessy, S.L. Liow, and E.L. Yong Mutations in the promoter region of the androgen receptor gene are not common in males with idiopathic infertility Mol. Hum. Reprod., March 1, 1999; 5(3): 287 - 290. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Komori, H. Kasumi, R.-i. Kanazawa, K. Sakata, Y. Nakata, H. Kato, and K. Koyama CAG repeat length in the androgen receptor gene of infertile Japanese males with oligozoospermia Mol. Hum. Reprod., January 1, 1999; 5(1): 14 - 16. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |