help button home button Endocrine Society JCEM JCEM Call for Nominations for EIC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kaji, H.
Right arrow Articles by Chihara, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kaji, H.
Right arrow Articles by Chihara, K.
The Journal of Clinical Endocrinology & Metabolism Vol. 82, No. 11 3705-3709
Copyright © 1997 by The Endocrine Society


Original Studies

Novel Compound Heterozygous Mutations of Growth Hormone (GH) Receptor Gene in a Patient with GH Insensitivity Syndrome1

Hidesuke Kaji, Osamu Nose, Hitoshi Tajiri, Yutaka Takahashi, Keiji Iida, Tetsuya Takahashi, Yasuhiko Okimura, Hiromi Abe and Kazuo Chihara

Third Division, Department of Medicine, Kobe University School of Medicine (H.K., Y.T., K.I., T.T., Y.O., H.A., K.C.), Kobe, Japan; Nose Clinic (O.N.), Kobe, Japan; and Department of Pediatrics, Osaka University School of Medicine (H.T.), Osaka, Japan

Address all correspondence and requests for reprints to: Hidesuke Kaji, Third Division, Department of Medicine, Kobe University School of Medicine, Kobe, Japan.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
A girl with severe growth retardation had the clinical features of Laron syndrome. Her serum insulin-like growth factor-I level was completely unresponsive to exogenous GH administration. The serum GH-binding protein (GHBP) level was below the detectable limit in the patient, but it was normal in her parents and brother. Her parents and brother were normal in their height. Amplification with PCR and direct sequencing of her GH receptor gene revealed compound heterozygous mutations. The allele from her mother contained a transversion of G to T in exon 7 that could introduce a stop codon in place of a glutamic acid at amino acid 224. Another mutation was found in the allele in her father and also identified in her brother. It was a C deletion at position 981 in exon 10 that could introduce a frame shift, thereby causing the production of 20 novel amino acids (310–329) instead of the wild-type sequence, the premature termination at codon 330, and the subsequent deletion of the C terminal portion of the intracellular domain. RT-PCR of her father’s lymphocytes and sequencing of its complementary DNA revealed that only the wild-type GH receptor messenger RNA was expressed in his lymphocytes, though the mechanism remains unclear. These results suggest that neither of the mutant alleles could generate a functional GH receptor, which would be consistent with the patient’s severe growth retardation and undetectable serum GHBP.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
PARTIAL deletion (1) and 28 different mutations (2, 3, 4) in the GH receptor (GHR) gene have been reported so far in classical GH-insensitivity syndrome (GHIS), which is an autosomal recessive disorder with a phenotype similar to that of severe GH deficiency, except that GH levels are normal or elevated. Recently, four different mutations of GHR gene have also been reported in idiopathic short stature with a partial GH insensitivity (5). Most of the reported mutations were located in the region coding for the extracellular domain of the GHR and caused a functional disruption.

Kou et al. (6) and we (7) previously reported a heterozygous missense mutation, Pro561Thr, located in the cytoplasmic domain of the GHR gene in patients with short stature. However, the functional significance of this heterozygous mutation is questionable, because we found this heterozygous mutation in approximately 15% of the normal population, and there was no correlation with height (8). Recently, Woods et al. (3) reported on a Laron syndrome patient with a high GH-binding protein (GHBP) level caused by a homozygous splice site mutation of the GHR gene that resulted in skipping of exon 8, which codes for a transmembrane domain, and that also resulted in exon 9 being translated out of the reading frame with a stop codon at the fifth amino acid downstream.

We report here novel compound heterozygous mutations of the GHR gene exons 7 and 10, which encode part of the extracellular and cytoplasmic domains, respectively, as the cause of severe growth retardation in a patient.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Subjects

The clinical profile of this girl patient has been reported previously (9). She was born at full term to nonconsanguineous parents. She was 47 cm in height and 3130 g in weight at birth. In her family, height was 165 cm (-0.96 SD) in her father, 153 cm (-0.92 SD) in her mother, and 138 cm (-0.03 SD) in her elder brother at the age of 10 yr and 5 months. She had severe but proportional growth retardation with 71 cm (-7.6 SD) in height, 8.4 kg (-3.6 SD) in weight, 2 yr of bone age, and with a prominent forehead and small nose with retracted bridge at the age of 4 yr and 2 months. Her baseline plasma GH level was as high as 21.6–59.4 ng/mL, with enhanced peak plasma GH (ng/mL) levels of 89.5 in response to arginine, 79.5 in response to glucagon, >90 in response to L-dopa, and 377 in response to GHRH at 4 yr and 10 months. When plasma insulin-like growth factor-I (IGF-I) level (µg/L) was measured by direct RIA, it was refractory to daily subcutaneous administration of recombinant human GH (0.32 U/kg per day) for 10 days according to the protocol by Rudman et al. (10): 87.5 at day 0, 87.9 at day 1, 95.9 at day 3, 96.8 at day 5, and 82.6 at day 10 of GH administration at the age of 5 yr. Height velocity was 0.7 and 0 cm/2 months before and after GH administration, respectively. At the age of 6 yr and 2 months, the plasma IGF-I levels were <4 µg/L by RIA after extraction with acid and ethanol, which was more reliable than direct RIA. At the age of 9 yr and 1 month she was 85.4 cm in height (-8.0 SD), 11.8 kg in weight (-3.3 SD), and 3 yr of bone age. The plasma IGF-I levels were still <4 µg/L by RIA after extraction. The basal plasma IGF-binding protein-3 (IGFBP-3) levels (milligrams per liter) measured with a RIA (11) were 0.30–0.34 in this patient (the normal value is 3.10 ± 0.46). Then treatment with IGF-I was started at a dose of 0.15 mg/kg once a day. Plasma IGFBP-3 level was 2.15 in this patient at the age of 13 yr (the normal value is 3.88 ± 0.59). It was 2.2 in her father, 5.67 in her mother (the normal value is 3.25 ± 0.49), and 3.5 in her brother at the age of 15 yr and 5 months (the normal value is 3.53 ± 0.49). Plasma GHBP levels (picomoles per liter), measured with a ligand-mediated immunofunctional assay, were <15.6 in the patient, 136 in her father, 98.6 in her mother, and 202 in her brother (the normal value is 222 ± 115 in men and 180 ± 92 in women).

DNA isolation, PCR, and direct sequencing of the GHR gene

Genomic DNA was extracted from the blood of the subject by the following method as described previously (7, 8, 12). Whole blood (100 µL) was mixed with 400 µL of a 10 mM Tris-HCl buffer (pH 7.5) containing 5 mM MgCl2, 0.32 M sucrose, and 1% Triton X-100. The mixture was supplemented with proteinase K (10 mg/mL) and 10% SDS and then incubated at 37 C for 30 min. The genomic DNA was extracted with phenol and chloroform and precipitated with ethanol. The GHR gene fragment from exon 2 to exon 10 was amplified with 0.5 U Taq polymerase (Perkin Elmer Cetus, Norwalk, CT) in a final volume of 20 µL of a 20 mM Tris-HCl buffer (pH 8.3) containing 25 mM KCl, 0.25 mM deoxynucleotide triphosphates (dNTPs), 2.5 mM MgCl2, and 250 mM exon-specific primers including the sequence of M13 primers at the 5' end of the forward or reverse primers as shown in Fig. 1aGo. The reaction mixture was overlaid with mineral oil and incubated using a thermocycler (Astec Co., Tokyo, Japan) programmed to repeat the following cycle 35 times: 1 min at 94 C, 2 min at 52 C, and 2 min at 72 C. The amplified GHR gene was electrophoresed on a 1% SeaPlaque agarose gel and purified by Wizard PCR (Promega Co., Madison, WI). The amplified and purified GHR DNA was directly cycle-sequenced using a M13 prism kit (Applied Biosystems, Tokyo, Japan) with the dideoxy chain-termination method and applied on an autosequencer (ABI prism 377 DNA sequencer, Applied Biosystems). The results were analyzed using DNAsis (Hitachi Software Engineering Co., Tokyo, Japan). To confirm these mutations in the patient and her family, the PCR-amplified DNA fragments of exon 7 were digested with MaeI, and those in exon 10 with BsmI, which could digest only the mutant alleles.



View larger version (47K):
[in this window]
[in a new window]
 
Figure 1. Identification of GH receptor gene mutations. a, Schematic representation of primer design to amplify each of exons of GH receptor gene encoding extracellular domain (), transmembrane domain ({blacksquare}), and cytoplasmic domain (). M13 primer sequence was added at 5' end of each forward or reverse primer as shown by (•). b, Sequence analysis of GH receptor gene exon 7 from control and patient. A heterozygous G to T transversion at nucleotide 724 was found. c, Sequence analysis of GH receptor gene exon 10 from control and patient. A heterozygous single cytosine deletion at nucleotide 981 was found.

 
RNA isolation, RT-PCR, and sequencing of GHR messenger RNA (mRNA)

RT-PCR was performed as described previously (7, 12). Briefly, lymphocytes were separated by density-gradient centrifugation with the monopoly resolving medium Ficoll-Hypaque (Flow Labs., Costa Mesa, CA). The RNA was extracted from the lymphocytes with the acid guanidinium isothiocyanate/phenol chloroform method (12). The RNA (0.5 µg) was reverse-transcribed with avian myeloblastosis virus reverse transcriptase (GIBCO BRL, Gaithersburg, MD) in a 20-µL reaction buffer containing dNTPs, random hexamers, RNase inhibitor, and MgCl2 at 37 C for 30 min, followed by heating at 95 C for 5 min. Then, 1–2 µL of the complementary DNA (cDNA) mixture was amplified with Taq polymerase (Perkin Elmer Cetus) in a buffer containing dNTPs, MgCl2, and primers designed to amplify from the nucleotide 681 in exon 7 to nucleotide 1015 in exon 10 (forward primer: GTGCGTGTGAGATCCAAACAACGA, and reverse primer: CACTGTGGAATTCGGGTTTATA). The PCR products were electrophoresed on 1% SeaPlaque agarose gels and visualized by staining with ethidium bromide. The amplified cDNA was purified by Wizard PCR and directly cycle-sequenced with the dideoxy chain-termination method using a dye terminator kit (Applied Biosystems) and an autosequencer.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
As shown in Fig. 1bGo, the direct sequencing of exon 7 of the GHR gene in the patient revealed peaks of both G and T at position 724 in contrast to only a single peak of G in the control. The G to T transversion changed codon 224 from GAG (Glu) to TAG (stop) (Fig. 2bGo). The direct sequencing of exon 10 of the GHR gene in this patient showed another abnormality, i.e. a point deletion of C at the position 981 in one allele and the normal nucleotide in the other, resulting in the formation of overlapping peaks in the sequences downstream from position 981 (Fig. 1cGo). In the control subject, there was only a single peak indicating the wild-type sequence in both alleles. The deletion of a single cytosine was found in codon 309 of exon 10 resulting in a frame shift of translation that would, if translated, produce 20 novel amino acids from codons 310 to 329 and terminate translation at codon 330 because of the appearance of a stop codon (TAG) (Fig. 2cGo). No other sequences of the GHR gene exons 2–10 showed any meaningful mutation in this patient (data not shown).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 2. Wild-type and mutant GH receptors if translated. a, Wild-type GH receptor. b, G to T transversion at nucleotide 724 caused change from a glutamic acid (GAG) to a termination (TAG) codon at codon 224 (extracellular domain of GH receptor). c, A single cytosine deletion at nucleotide 981 resulted in a frame shift, thereby causing production of 20 novel amino acids (310–329), as shown in bold letters, instead of wild-type sequence and termination by a premature stop codon at codon 330.

 
A heterozygous mutation of the GHR gene with a C deletion at position 981 was identified in her father and brother, neither of whom showed the G to T transversion at position 724 (data not shown). In contrast, the heterozygous mutation G->T at position 724 was identified in her mother, who did not show the deletion of cytosine at position 981 (data not shown). These results were confirmed by PCR-restriction fragment length polymorphism (Fig. 3Go). In this patient and her mother, but not her father and brother, one half of the PCR products of exon 7 of the GHR gene (280 bp) were digested by MaeI, which could digest only the G->T mutant at nucleotide 724, resulting in two fragments of 173 and 107 bp. In this patient and her father and brother, but not her mother, one half of the PCR products of exon 10 of the GHR gene (576 bp) were digested by BsmI, which could digest only the mutant GHR gene with a C deletion at nucleotide 981, resulting in two fragments of 513 and 63 bp, although the smaller fragment could not be clearly identified. Neither the G->T transversion at 724 nor the C deletion at 981 was identified in 20 control subjects (data not shown).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 3. Pedigree and genotype in family of this patient. Both alleles were mutated in this patient. Mutant allele with G->T mutation at 724 had one MaeI site, whereas normal allele did not have this cleavage site. Exon 7 from patient and her father, mother, and brother were amplified by PCR and digested with MaeI. Mutant allele with C deletion at 981 had one BsmI site, whereas normal allele did not have this cleavage site. Exon 10 from this patient and her family were amplified by PCR and digested with BsmI.

 
A partial sequence of the GHR cDNA was reverse transcribed and amplified by PCR from her father’s lymphocytes. A PCR product of the expected size could be amplified, but the direct sequencing of this fragment showed only the wild-type GHR cDNA without the coexistence of the mutant GHR cDNA with the C deletion at nucleotide 981 (data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
We identified novel compound heterozygous mutations in a girl with typical GHIS. This report is of interest, because only one compound heterozygote with classical GHIS has previously been described in a patient from Spain (2). Our paper has convincing genetic studies that add to its interest, because the single allelic defects have no effect on the carrier parents or brother. One of the mutations was a G to T transversion in exon 7 that could introduce a stop codon in place of a glutamic acid at amino acid 224 (Glu224stop), causing a truncation of the molecule, and thereby deleting the C terminal portion of the GH-binding domain as well as the transmembrane and intracellular domains. This mutant GHR, even if it was translated, would possess no obvious function. The second mutation was a C deletion at nucleotide 981 in exon 10 that resulted in a frame shift, thereby causing the production of 20 novel amino acids (310–329) instead of the wild-type sequence, the premature termination at amino acid 330, and the deletion of the subsequent C terminal portion of the intracellular domains when this mutant GHR gene was transcribed and translated.

The patient’s father and brother possessed the mutation of the C deletion at nucleotide 981 in exon 10 in only one allele with the normal sequence in the other allele. The mutation in her mother was also heterozygous: one allele exhibited the G->T transversion at nucleotide 724 in exon 7, and the other showed the normal sequence. However, all of them had normal height and serum GHBP levels, suggesting that the wild-type GHR expressed from the normal allele could function sufficiently, or that the mutant GHR, if expressed, did not have a dominant negative effect on normal GHR function.

Taken together, not only the G->T transversion at nucleotide 724 but also the C deletion at nucleotide 981 were essential for the pathogenesis of the patient’s growth failure. It should be determined whether the mutated GHR with the C deletion at 981 is functional or not if it is expressed. The previous study of truncated GHRs using site-directed mutagenesis (14, 15, 16, 17, 18, 19) revealed that GHR1–310 was sufficient to bind GH (14) but not to associate with and phosphorylate Jak2 (15), to stimulate Spi 2.1 gene promoter activity (16, 17), to phosphorylate some signal-transducing molecules (18), or to induce two GH-dependent cellular events (lipogenesis and protein synthesis) (19). There are two possibilities to explain why GHBP was not detected in the serum of this patient. One possibility is that the mutant allele with the C deletion at 981 produced a truncated GHR that lacks the signal transduction motif required for the generation of GHBP, an extracellular domain of the GHR, although the mechanism of GHBP generation is not fully understood yet (20, 21, 22). However, recent reports (23, 24) have shown that a short isoform of the human GHR truncating 97.5% of the intracellular domain of the receptor may be involved in the increased release of GHBP, probably because of the lack of a motif in box 2 required for receptor internalization (25). Alternatively, this allele with the C deletion at 981 might not be transcribed or translated. To elucidate these possibilities, we tried to identify the expression of the mutant GHR mRNA in lymphocytes from the patient’s father who had the heterozygous C deletion at 981 in the GHR gene because, unfortunately, we could not obtain a large enough blood sample to extract mRNA from the patient. The GHR mRNA could be clearly detected in his lymphocytes with the RT-PCR method. However, only the wild-type GHR cDNA was identified in his PCR products by direct sequencing. Thus, it is likely that the mutant GHR mRNA encoding the C deletion at 981 either could not be transcribed or, if it were transcribed, was very unstable. It remains to be clarified why the mRNA for the mutant GHR with the C deletion at 981 was not detected. It is possible to speculate that an as yet undefined mutation might exist in the other region like promoter of this mutant GHR gene allele affecting gene transcription, or the structural change of GHR gene by C deletion at 981 itself caused an instability or repressed transcription activity of this mutant gene. Nevertheless, our results obtained up to now indicate that neither of the mutant alleles could produce any functional GHR, which is responsible for the patient’s severe growth retardation and undetectable serum GHBP level.


    Acknowledgments
 
We thank Dr. F. Kurimoto (Mitsubishi Kagaku Bio-Clinical Labs., Tokyo, Japan) for measurement of GHBP and IGFBP-3.


    Footnotes
 
1 This work was supported in part by grants-in-aid for scientific research from the Japanese Ministry of Education, Science and Culture, from the Japanese Ministry of Health and Welfare, and from Growth Science Foundation. Back

Received May 5, 1997.

Revised July 9, 1997.

Accepted July 15, 1997.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Godowski J, Leung W, Meacham R, et al. 1989 Characterization of the human growth hormone receptor gene and demonstration of a partial gene deletion in two patients with Laron type dwarfism. Proc Natl Acad Sci USA. 86:8083–8087.[Abstract/Free Full Text]
  2. Berg M, Argente J, Chernausek S, et al. 1993 Diverse growth hormone receptor gene mutations in Laron syndrome. Am J Hum Genet. 52:998–1005.[Medline]
  3. Woods KA, Fraser NC, Postel-Vinay M, Savage MO, Clark AJ. 1996 A homozygous splice site mutation affecting the intracellular domain of the growth hormone (GH) receptor resulting in Laron syndrome with elevated GH-binding protein. J Clin Endocrinol Metab. 81:1686–1690.[Abstract]
  4. Rosenbloom AL, Rosenfeld RG, Guevara-Aguirre J. 1997 Growth hormone insensitivity. Pediatr Clin N Am. 44:423–442.[CrossRef][Medline]
  5. Goddard AD, Covello R, Luoh S, et al. 1995 Mutations of the growth hormone receptor in children with idiopathic short stature. N Engl J Med. 333:1093–1098.[Abstract/Free Full Text]
  6. Kou K, Lajara R, Rotwein P. 1993 Amino acid substitutions in the intracellular part of the growth hormone receptor in a patient with the Laron syndrome. J Clin Endocrinol Metab. 76:54–59.[Abstract]
  7. Kaji H, Ohashi S, Abe H, Chihara K. 1994 Regulation of the growth hormone (GH) receptor and GH-binding protein mRNA. Proc Soc Exp Biol Med. 206:257–262.[Abstract]
  8. Chujo S, Kaji H, Takahashi Y, Okimura Y, Abe H, Chihara K. 1996 No correlation of growth hormone receptor gene mutation P561T with body height. Eur J Endocrinol. 134:560–562.[Abstract]
  9. Nishi Y, Okada S, Tajiri H, et al. 1993 Effect of IGF-I on isolated GH deficiency type 1A and Laron-type dwarfism. Pediatr Adolesc Endocrinol. 24:244–253.
  10. Rudman D, Kutner MH, Fleming GA, et al. 1978 Effect of 10-day courses of human growth hormone on height of short children. J Clin Endocrinol Metab. 46:28–35.[Medline]
  11. Hasegawa Y, Hasegawa T, Aso T, et al. 1992 Usefulness and limitation of measurement of insulin-like growth factor binding protein-3 (IGFBP-3) for diagnosis of growth hormone deficiency. Endocrine J. 39:585–591.
  12. Takahashi Y, Kaji H, Okimura Y, Goji K, Abe H, Chihara K. 1996 Short stature caused by a mutant growth hormone. N Engl J Med. 334:432–436.[Free Full Text]
  13. Chomoczynski P, Sacchi N. 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 162:156–159.[Medline]
  14. Colosi P, Wong K, Leong SR, Wood WI. 1993 Mutational analysis of the intracellular domain of the human growth hormone receptor. J Biol Chem. 268:12617–12622.[Abstract/Free Full Text]
  15. Smit LS, Meyer DJ, Billestrup N, Norstedt G, Schwartz J, Carter-Su C. 1996 The role of the growth hormone (GH) receptor and JAK1 and JAK2 kinases in the activation of stats 1, 3, and 5 by GH. Mol Endocrinol. 10:519–533.[Abstract]
  16. Billstrup N, Bouchelouche P, Allevato G, Ilondo M, Nielsen J. 1995 Growth hormone receptor C-terminal domains required for growth hormone-induced intracellular free Ca2+ oscillations and gene transcription. Proc Natl Acad Sci USA. 92:2725–2729.[Abstract/Free Full Text]
  17. Hansen LH, Wang X, Kopchick JJ, et al. 1996 Identification of tyrosine residues in the intracellular domain of the growth hormone receptor required for transcriptional signaling and stat 5 activation. J Biol Chem. 271:12669–12673.[Abstract/Free Full Text]
  18. Wang X, Souza SC, Kelder B, Cioffi JA, Kopchick JJ. 1995 A 40-amino acid segment of the growth hormone receptor cytoplasmic domain is essential for GH-induced tyrosine-phosphorylated cytosolic proteins. J Biol Chem. 270:6261–6266.[Abstract/Free Full Text]
  19. Lobie PE, Allevato G, Nielsen JH, Norstedt G, Billestrup N. 1995 Requirement of tyrosine residues 333 and 338 of the growth hormone (GH) receptor for selected GH-stimulated function. J Biol Chem. 270:21745–21750.[Abstract/Free Full Text]
  20. Trivedi B, Daughaday WH. 1988 Release of growth hormone binding protein from IM-9 lymphocytes by endopeptidase is dependent on sulfydryl group inactivation. Endocrinology. 123:2201–2206.[Abstract]
  21. Sotiropoulos A, Goujon L, Simonin G, Kelly PA, Postel-Vinay MC, Finidori J. 1992 Evidence for generation of the growth hormone-binding protein through proteolysis of the growth hormone membrane receptor. Endocrinology. 132:1863–1865.[Abstract]
  22. Harrison SM, Barnard R, Ho KY, Rajkovic I, Waters MJ. 1995 Control of growth hormone (GH) binding protein release from human hepatoma cells expressing full-length GH receptor. Endocrinology. 136:651–659.[Abstract]
  23. Dastot F, Sobrier M-L, Duquesnoy P, Duriez B, Gossens M, Amselem S. 1996 Alternatively spliced forms in the cytoplasmic domain of the human growth hormone (GH) receptor regulate its ability to generate a soluble GH-binding protein. Proc Soc Natl Acad Sci USA. 93:10723–10728.[Abstract/Free Full Text]
  24. Ross RJM, Esposito N, Shen XY, et al. 1997 A short isoform of the human growth hormone receptor functions as a dominant negative inhibitor of the full-length receptor and generates large amounts of binding protein. Mol Endocrinol. 11:265–273.[Abstract/Free Full Text]
  25. Argetsinger LS, Carter-Su C. 1996 Mechanism of signaling by growth hormone receptor. Physiol Rev. 76:1089–1107.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
P. Fang, S. Riedl, S. Amselem, K. L. Pratt, B. M. Little, G. Haeusler, V. Hwa, H. Frisch, and R. G. Rosenfeld
Primary Growth Hormone (GH) Insensitivity and Insulin-Like Growth Factor Deficiency Caused by Novel Compound Heterozygous Mutations of the GH Receptor Gene: Genetic and Functional Studies of Simple and Compound Heterozygous States
J. Clin. Endocrinol. Metab., June 1, 2007; 92(6): 2223 - 2231.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M Maamra, A Milward, H Z. Esfahani, L P Abbott, L A Metherell, M O Savage, A J L Clark, and R J M Ross
A 36 residues insertion in the dimerization domain of the growth hormone receptor results in defective trafficking rather than impaired signaling
J. Endocrinol., February 1, 2006; 188(2): 251 - 261.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
K. Iida, J. P. del Rincon, D.-S. Kim, E. Itoh, K. T. Coschigano, J. J. Kopchick, and M. O. Thorner
Regulation of full-length and truncated growth hormone (GH) receptor by GH in tissues of lit/lit or bovine GH transgenic mice
Am J Physiol Endocrinol Metab, September 1, 2004; 287(3): E566 - E573.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Z. Laron
Laron Syndrome (Primary Growth Hormone Resistance or Insensitivity): The Personal Experience 1958-2003
J. Clin. Endocrinol. Metab., March 1, 2004; 89(3): 1031 - 1044.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Milward, L. Metherell, M. Maamra, M. J. Barahona, I. R. Wilkinson, C. Camacho-Hubner, M. O. Savage, C. M. Bidlingmaier, A. J. L. Clark, R. J. M. Ross, et al.
Growth Hormone (GH) Insensitivity Syndrome due to a GH Receptor Truncated after Box1, Resulting in Isolated Failure of STAT 5 Signal Transduction
J. Clin. Endocrinol. Metab., March 1, 2004; 89(3): 1259 - 1266.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Salerno, B. Balestrieri, E. Matrecano, A. Officioso, R. G. Rosenfeld, S. Di Maio, G. Fimiani, M. V. Ursini, and C. Pignata
Abnormal GH Receptor Signaling in Children with Idiopathic Short Stature
J. Clin. Endocrinol. Metab., August 1, 2001; 86(8): 3882 - 3888.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
K. Iida, Y. Takahashi, H. Kaji, N. Onodera, M. O. Takahashi, Y. Okimura, H. Abe, and K. Chihara
The C422F Mutation of the Growth Hormone Receptor Gene Is Not Responsible for Short Stature
J. Clin. Endocrinol. Metab., November 1, 1999; 84(11): 4214 - 4219.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
J. Wojcik, M. A. Berg, N. Esposito, M. E. Geffner, N. Sakati, E. O. Reiter, S. Dower, U. Francke, M.-C. Postel-Vinay, and J. Finidori
Four Contiguous Amino Acid Substitutions, Identified in Patients with Laron Syndrome, Differently Affect the Binding Affinity and Intracellular Trafficking of the Growth Hormone Receptor
J. Clin. Endocrinol. Metab., December 1, 1998; 83(12): 4481 - 4489.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
J. L. Walker, P. A. Crock, S. N. Behncken, S. W. Rowlinson, L. M. Nicholson, T. J. C. Boulton, and M. J. Waters
A Novel Mutation Affecting the Interdomain Link Region of the Growth Hormone Receptor in a Vietnamese Girl, and Response to Long-Term Treatment with Recombinant Human Insulin-Like Growth Factor-I and Luteinizing Hormone-Releasing Hormone Analogue
J. Clin. Endocrinol. Metab., July 1, 1998; 83(7): 2554 - 2561.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kaji, H.
Right arrow Articles by Chihara, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kaji, H.
Right arrow Articles by Chihara, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals