| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
From the Clinical Research Centers |
Department of Reproductive Medicine (O.K., M.Y., L.V., S.S.C.Y.), University of California-San Diego, School of Medicine, La Jolla, California 92093-0633; and Department of Pediatrics (M.Y.), University of California, San Francisco
Address all correspondence (no reprints available) to: S. S. C. Yen, Department of Reproductive Medicine, University of California-San Diego, School of Medicine, La Jolla, California 92093-0633.
| Abstract |
|---|
|
|
|---|
Treatment with GHRH analog resulted in a significant increase (107 and
70% in men and women, respectively) in the 12-h integrated GH
secretion (P < .05) and serum IGF-I levels (28%)
(P < .001) in both men and women by 4 weeks and
lasted 12 weeks for IGF-I and 16 weeks for GH. Activation of the immune
system occurred in both sexes within 4 weeks. A 30% increase
(P < .001) in lymphocytes expressing the
transferrin receptor (CD71) and in monocytes (CD14)
(P < .05) occurred within 4 weeks. By 16 weeks,
there was a significant increase (30%) in B cells (CD20)
(P < .01), in cells expressing the T cell receptor
/ß (20%) (P < .01), and T cell receptor
/
(40%) (P < .0001). There were no changes
in the number of T cells (CD3), T cell subsets (CD4, CD8), or natural
killer cell (CD57) over the treatment period. The increase in B cell
number was associated with enhanced responsiveness (50%) to the B cell
mitogens: pokeweed mitogen (P < .01 or better) and
Staphylococus aureus cells (P < .001), and a
transient increase at 4 weeks in circulating IgG (P
< .0001), IgM, and IgA (P < .001). T cells were
functionally activated, as evidenced by a 50% increase in
responsiveness to phytohemagglutinin (P < .01 or
better), 70% increase in the number of lymphocytes expressing the IL-2
receptor (IL-2R) (CD25) (P < .001), and enhanced
IL-2R messenger RNA expression and basal IL-2 secretion (50%)
(P < .05) at 16 weeks of treatment. Furthermore,
circulating soluble IL-2 receptor rose significantly (15%)
(P < .05) within 4 weeks of treatment and remained
elevated for the duration of the study. There were no sex differences
in the immune response to GHRH analog and no adverse effects. These
results indicate that GHRH analog administration has profound
immune-enhancing effects and may be of therapeutic benefit in states of
compromised immune function.
| Introduction |
|---|
|
|
|---|
By contrast to GH and IGF-I, relatively little is known about the function of GHRH in the immune system (for review, see Ref.16). Immunoreactive GHRH, its messenger RNA (mRNA), and binding of GHRH have been reported in rodent lymphocytes (17, 18, 19). Human lymphocytes have been shown to synthesize and release a biologically active GHRH peptide capable of stimulating GH release from both the pituitary and lymphocytes (20). Northern blot analysis detected two GHRH mRNA transcripts in lymphocytes, one similar in size to the hypothalamic species of 0.75 Kb and a larger transcript of approximately 10 Kb (20). Though the action of lymphocyte-derived GHRH is currently unknown, supraphysiologic concentrations significantly inhibited the chemotactic response of human peripheral lymphocytes (21) and natural killer (NK) cell activity in vitro (22). Different forms and doses of GHRH have different biological properties; GHRH (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29), but not GHRH (144), at low concentrations stimulated, whereas high concentrations inhibited phytohemagglutinin (PHA)-induced lymphoproliferation, interleukin (IL)-2 secretion, and IL-2 receptor expression on activated human peripheral lymphocytes (23).
Information on the in vivo effects of somatotrophic peptide on human and primate immune function is scant. GH replacement in GH-deficient children resulted in increased responsiveness to mitogen-induced cell proliferation (24), and long-term therapy was found to be either without an effect (25) or to decrease the number of B lymphocytes without altering serum Igs (26). Other investigators found that in GH deficient children, rhGH therapy increased the number of peripheral transferrin receptors CD3+ and CD8+ cells, while decreasing the number of CD4+ cells and IgM production in vitro (27). Crist et al. found that hGH administration activated NK cell function in postmenopausal women (28). Kiess et al. reported that 3 weeks of treatment with GHRH (144) did not restore the decreased NK cell activity of GH-deficient children (29, 30). Most recently, LeRoith et al. reported that GH and IGF-I administration in aged female monkeys elicited a marked activation of the immune system, as determined by histologic assessments of spleen and lymph nodes and an enhanced in vivo response to tetanus toxoid (31). However, it was not determined whether the GH effects were IGF-I mediated (31). To date, there is no data on the immune effects of GHRH administration in age-advanced humans.
Because both GH and IGF-I have mitogenic effects in the immune system, we hypothesized that restoration of the GH-IGF-I axis in aging men, through the administration of GHRH, would elicit immune activation. In this report, we present findings on the in vivo effects of the GHRH analog [Nle27]GHRH (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29)-NH2 on immune cell function in aging men and women.
| Materials and Methods |
|---|
|
|
|---|
Twenty volunteers (10 women, 9 men) participated in this study. One subject dropped out of the study for reasons unrelated to the effects of GHRH analog. Men had a mean age of 66.9 yr (range 6171) and body mass index of 24.5 kg/m2 (range 2028), and women had a mean age of 64.6 yr (range 5570) and body mass index of 24.3 kg/m2 (range 1731). Subjects were healthy, nonsmokers, and on no medications other than daily hormone replacement therapy in 8 of 10 women (Premarin, 0.625 mg; Provera, 2.5 mg). Medical illness was excluded by history, physical examination, complete blood count, and chemistry profile. All subjects took the Beck depression test before commencing the study. The protocol was approved by the Human Subjects Committee of the University of California-San Diego. Subjects gave oral and written consent.
Study design
The study design was a single-blind placebo-controlled trial of 5 months duration. At 2100 h, subjects self-injected (sc, into their thighs) placebo (saline) for the first 4 weeks, followed by 16 weeks of [Nle27]GHRH (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29)-NH2, at a dose of 10 µg/kg BW. The GHRH analog (kindly provided by Dr. J. Rivier, Salk Institute, La Jolla, CA) has been shown to have full biologic activity, in terms of stimulating pituitary GH secretion (32). A solution of GHRH analog in 5-mL vials was provided to the subjects monthly at a dose of 2 mg/mL. Vials were stored frozen until dispensed to the subjects, then kept at 4 C for 10 days. HPLC analysis showed the peptide was stable at 4 C for at least 2 weeks.
Study protocol
Subjects were seen and interviewed, regarding potential side effects, on a twice-a-month or monthly basis. Fasting blood samples were obtained between 0800 and 0900 h for immune studies, hormone measurements, and safety laboratory tests (complete blood count and chemistry profile). Subjects were admitted to the CRC for assessment of 12-h GH pulsatility at baseline, after 4 weeks of placebo treatment, and at the end of GHRH analog treatment at 0700 h after an overnight fast. At 1800 h, an iv line was inserted, and blood samples were obtained at 10-min intervals for 12 h, beginning at 2000 h, for GH determination. At 2100 h, subjects received an sc injection of placebo (saline) during their first admission and GHRH analog at weeks 4 and 16. Blood pressure and body weight were monitored at each visit.
Hormone measurements
Serum GH concentrations were determined using an RIA with an interassay CV of 6% at 1.4 µg/L and 6.0 µg/L, 8% at 1.0 µg/L, and 2.5% at 4.2 µg/L, and a sensitivity of 0.9 µg/L. IGF-I was measured after acid-ethanol extraction using a Corning Nichols Institute RIA kit with an intraassay CV of 6% and sensitivity of 135 ng/mL.
GHRH antibodies
Sera from all subjects, before and after 4 months of treatment with GHRH analog, were tested for the presence of antibodies to GHRH by a competitive binding assay using I-125 GHRH (144) with initial dilution of 1:5 and 1:50 (Peninsula Labs, Belmont, CA).
Immune studies
Lymphocytes were isolated from freshly drawn blood by Ficoll-Hypaque (Sigma, St. Louis, MO) centrifugation (33). Cells were then washed three times with PBS buffer, counted in a hemocytometer, and suspended in the appropriate concentration in RPMI-1640 containing 1% glutamine, 1% penicillin-streptomycin, and 10% FCS.
Mitogen assays. Lymphocytes were incubated at a concentration of 1 x 106 cells/mL, in the presence of PHA (Murex Diagnostics, Norcross, GA) at 0.1 and 2 µg/mL, pokeweed mitogen (PWM; Gibco, Gettysburg, PA) at 0.5 and 5 µg/mL, and Staphylococus aureus cells (SAC; Calbiochem, La Jolla, CA) at a dilution of 1:1000 for 6 days in 5% CO2 and 37 C, at which time 0.2 µCi of 3H-thymidine was added. Cells were harvested 18 h later onto filters and counted in a liquid scintillation counter. Control wells contained only buffer. Results were expressed in terms of stimulation index determined as follows: cpm in mitogen containing wells/cpm in control wells.
Flow cytometry. Cells (2 x 105) were incubated with monoclonal antibodies (Beckton-Dickinson, Mountain View, CA) against various cell surface antigens. After 20 min of incubation at 4 C, the cells were washed two times and fixed with 2% paraformaldehyde (33). Cells were then analyzed in a FACS scan flow cytometer (Beckton-Dickinson Immunocytometry Systems, San Jose, CA) using two gates: one specifically for lymphocytes excluding monocytes; and a larger gate that included both monocytes and lymphocytes. Data were analyzed by Lysys II software.
NK cell cytotoxicity assay was done, as previously described (33), with
minor modifications. Briefly, target K-562 cells were incubated with
chromium-51 for 2 h in 5% CO2 and 37 C, after which,
cells were washed two times with PBS and adjusted to a concentration of
105 cells per mL in RPMI-1640 with 10% FCS. Target cells
were then incubated with lymphocytes from the subjects at
effector-to-target ratios of 50:1 and 100:1 for 4 h in 5%
CO2 and 37 C, at which time, 100 µL of the well contents
were counted in a
counter. Target cells were incubated with and
without 3% SDS, for measurement of spontaneous and maximum release.
The specific lysis was determined as follows: (experimental
release)-(spontaneous release)/(maximum release)-(spontaneous
release).
Cytokine secretion/Igs. Next, 1 x 106 cells/mL were incubated with and without PHA (20 µg/mL) for 48 h in 5% CO2 at 37 C. After 48 h, the cell-free contents were stored at -70 C, for subsequent measurement of IL-2 by an enzyme-linked immunosorbent assay (ELISA) kit (Biosource, Camarillo, CA) with a sensitivity of 8.7 pg/mL. Soluble IL-2 receptor (IL-2R) was measured by ELISA (Genzyme, Boston, MA) with a sensitivity of 100 pg/mL. Igs were measured by radial immunodiffusion (The Binding Site, La Jolla, CA).
Cytokine gene expression. Total RNA was extracted from frozen cells according to the method of Chomczynski (34). The OD260/280 ratio of extracted RNA from peripheral lymphocytes was routinely at or greater than 1.8. RT-PCR was performed as follows: In a 20 µL reaction, 1 µg total RNA and 100 ng Random Primers (Promega, Madison, WI) were heated at 95 C for 1 min and cooled briefly on ice before adding 5x reverse transcription buffer (250 mmol/L Tris-HCl, pH 8.3; 375 mmol/L KCl; 15 mmol/L MgCl2; 50 mmol/L DTT), deoxy-ribonucleoside triphosphate (1.5 mmol/L final concentration), 8 units RNAguard (Pharmacia LKB Biotechnology, Piscataway, NJ), and 200 units Moloney murine leukemia virus RT (Promega). After 1 h at 37 C, the reaction was terminated by heating at 95 C for 5 min before cooling on ice. Amplification of the reverse-transcribed complementary DNA (cDNA) was accomplished by subjecting up to 5 µL of the cDNA to a 100-µL PCR reaction containing 50 mmol/L KCl, 10 mmol/L Tris-HCl (pH 9) at 25 C, 0.1% Triton X-100, 2 mmol/L MgCl2, 0.2 mmol/L of each of the deoxy-ribonucleoside triphosphates, 50 pmol of each primer, 2.5 units Tag DNA polymerase (Promega), and 100 µL light mineral oil in a thermal cycler (Coy Corporation, Grass Lake, MI). The PCR reaction was allowed to proceed for 30 cycles (95 C for 1 min, 55 C for 2 min, and 72 C for 3 min) before arresting the reaction in its logarithmic phase by rapid cooling at 4 C. PCR primers for IL-2 and IL-2R were purchased from Stratagene (La Jolla, CA). For the IL-2 message, the upstream and downstream primers for generating a 457-bp PCR product were 5' ATGTACAGGATGCAACTCCTGTCTT 3' and 5'GTCAGTGTTGAGATGATGATGCTTTGAC 3', respectively. For the IL-2R message, the primer set for a 391-bp PCR product was: 5' GACGATGACCCGCCA 3' (upstream) and 5' CCTCGACGCACTGATAAT 3' (downstream). As an internal control, the primer set (upstream) 5' CAAAAGGGTCATCATCTCTG 3', (downstream) 5' CCTGCTTCACCA CCTTCTTG 3' for generating a 446-bp PCR product specific for the glyceraldehyde-3-phosphate dehydrogenase message, as previously described (35), was included in each PCR reaction. To confirm the identity of the PCR products and to further quantitate them, an aliquot of each PCR reaction was run in a 0.7% agarose gel in TE buffer. The electrophoresed gel was then blotted onto a Magna Charge nylon membrane (Micron Seperations Inc, Westborough, MA) according to Southern (36). Hybridization and washing were performed, as described by Church and Gilbert (37), using 32P-random primed probes (38) specific for each message under investigation (cDNA probes were obtained from the American Type Culture Collection, Rockville, MD). The membrane was exposed for autoradiography to a XAR-5 film (Eastman Kodak, Rochester, NY). Radioactive message bands on the membrane were cut out and the amount of radioactivity determined by scintillation counting. The radioactivity count for the glyceraldehyde-3-phosphate dehydrogenase was used to normalize those for the IL-2 and IL-2R messages. Under these conditions, the amounts of PCR products detectable were proportional to input DNA templates in control PCR experiments.
Statistics
All data were analyzed by two-factor ANOVA with repeated measures. Post hoc testing compared responses to GHRH analog and placebo by the Fischers exact test. Data are presented as the mean (±SE), and P < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
GH/IGF-I
Data related to GH/IGF-I response to GHRH analog administration
have been reported elsewhere (39). Briefly, there was a significant
increase in the integrated 12-h GH level in response to GHRH in both
men (107%) (P < .05) and women (70%)
(P < .01). Desensitization to the GH-releasing effect
of GHRH did not occur after 4 months of treatment. As a result of
activation of GH secretion, serum IGF-I rose significantly (28 and 27%
in men and women, respectively) (P < .001) by 4 weeks;
and by 16 weeks, the levels returned to baseline in both genders (Table 1
).
|
/ß
(P < .01), and T cell receptor
/
(P < .0001) occurred at 16 weeks.
|
|
|
|
|
|
The nightly administration of GHRH analog was well tolerated without adverse effects. The long-term administration of GHRH analog did not result in formation of circulating antibodies to the GHRH analog in all subjects tested, before and after 4 months of treatment with GHRH analog.
| Discussion |
|---|
|
|
|---|
The in vivo data presented here, using GHRH (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29) analog, are in agreement with the in vitro findings of Valtorta et al. (23). They found that low doses of GHRH (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29), but not GHRH (144), stimulated PHA-induced lymphocyte proliferation, whereas high doses inhibited IL-2 production, IL-2R mRNA expression, and lymphocyte proliferation. These findings suggest a direct action of GHRH analog on immune cells and raise the intriguing possibility that distinct sequences within the GHRH molecule may have opposing effects on immune function.
The GH-IGF-I axis was activated in response to the GHRH analog administration. Both GH and IGF-I are known to enhance immune function and influence peripheral lymphocytes by yet undetermined mechanisms (3, 6). The lack of correlation between the time course of changes in GH-IGF-I levels and immune function seen in our study, together with reports on the in vivo effects of rhGH on peripheral lymphocyte subsets (24, 25, 26, 27) and NK cell function (28), are different from those induced by GHRH analog treatment. Further, although data on the effects of IGF-I on human immune function are not available, IGF-I administration in aging monkeys increased the number of CD8+ T cells (T suppressor) in the peripheral blood (31). This finding also differs from our results, showing no effect on T cell number in response to GHRH analog, although the dose and mode of administration of these hormones could potentially influence the results. Differences in the immune response evoked by GH and IGF-I, as compared with GHRH analog, suggest that the immune effects of this analog can not satisfactorily be explained by the modest rise in serum IGF-I and GH levels.
Our data indicate that all components of the peripheral immune system
seem to be activated by GHRH analog administration. It is proposed that
T cells potentially play a key role in orchestrating the immune
response to GHRH. Because immune cells express GHRH/GH/IGF-I and their
respective receptors (3, 6), GHRH might trigger its mitogenic effect by
sequentially activating the IL-2 receptor gene expression, thereby
inducing proliferation and activation of T cells at physiological
concentrations of IL-2 (41). As T cells are activated, a portion of the
cell surface IL-2 receptor would be shed into the circulation and bind
IL-2, thereby neutralizing its effect. An autofeedback system may be
postulated to include the up-regulation of IL-2 receptor, and IL-2
action with modulation by sIL-2R (41). Activation of IL-2 and its
receptor also may be instrumental for B cell production of Igs and
functional activation of monocytes (41, 42, 43). The lack of effect of GHRH
analog on NK cells is to be expected, because these cells express only
the IL-2R
(41), which does not seem to be a target of GHRH. The
importance of GHRH in regulating T cell function has been demonstrated
in a study of transgenic mice harboring the human GHRH promoter fused
to the coding sequences from the virus. These mice were found to have
severe thymic hyperplasia, primarily involving the epithelial component
of the gland (44). In another study, transgenic mice producing human
GHRH were found to have increased splenic progenitor cell colony
formation and DNA synthesis in vivo and in vitro
(45). These observations collectively support the proposition that GHRH
analog may act directly on the immune cells.
One of the limitations of our study was the use of peripheral lymphocytes to provide insight into the whole immune system. Westermann and Pabst (46) have raised concerns about use of peripheral lymphocytes as an experimental window on the lymphoid system. They have argued that blood represents only about 2% of the total lymphocyte pool in the adult human, and these cells are affected by various factors such as time of sampling, stress, drugs, and various diseases. Thus, the effects of GHRH analog described here may not be truly representative of the immune status of the subjects. The second limitation was that a control group of young individuals was not used, and therefore, it is difficult to conclude that a rejuvenation of the immune system occurred as a result of GHRH analog administration. However, the immunoscenecent phenotype, characterized primarily by a decline in T cell function and decreased IL-2R expression (2), was restored by GHRH analog treatment (findings resemble the youthful phenotype). Nonetheless, the manner in which activation of the peripheral immune compartment translates to the ability to mount an immune response to a foreign antigen remains to be elucidated.
In summary, we have demonstrated that the administration of GHRH analog in humans has profound stimulatory effects on the immune system in vivo. T cell activation may be the initial inciting event that leads to activation of monocytes and B lymphocytes through yet unidentified cytokine pathways. The immune-enhancing effects of GHRH analog may have potential benefits in immunodeficient states, particularly those associated with depressed T cell function. Studies to address this issue are underway.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Former Fellow in Reproductive Endocrinology. Current address:
Department of Obstetrics and Gynecology, University of Wisconsin
Medical School, Madison, Wisconsin. ![]()
3 Clayton Foundation Investigator. ![]()
Received May 23, 1997.
Revised July 8, 1997.
Accepted July 14, 1997.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Ionescu and L. A. Frohman Pulsatile Secretion of Growth Hormone (GH) Persists during Continuous Stimulation by CJC-1295, a Long-Acting GH-Releasing Hormone Analog J. Clin. Endocrinol. Metab., December 1, 2006; 91(12): 4792 - 4797. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Thacker, D. J. Holtkamp, A. S. Khan, P. A. Brown, and R. Draghia-Akli Plasmid-mediated growth hormone-releasing hormone efficacy in reducing disease associated with Mycoplasma hyopneumoniae and porcine reproductive and respiratory syndrome virus infection J Anim Sci, March 1, 2006; 84(3): 733 - 742. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Khorram, M. Garthwaite, and T. Golos The Influence of Aging and Sex Hormones on Expression of Growth Hormone-Releasing Hormone in the Human Immune System J. Clin. Endocrinol. Metab., July 1, 2001; 86(7): 3157 - 3161. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Koo, C. Huang, R. Camacho, C. Trainor, J. T. Blake, A. Sirotina-Meisher, K. D. Schleim, T.-J. Wu, K. Cheng, R. Nargund, et al. Immune Enhancing Effect of a Growth Hormone Secretagogue J. Immunol., March 15, 2001; 166(6): 4195 - 4201. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Solerte, M. Fioravanti, G. Vignati, A. Giustina, L. Cravello, and E. Ferrari Dehydroepiandrosterone Sulfate Enhances Natural Killer Cell Cytotoxicity in Humans Via Locally Generated Immunoreactive Insulin-Like Growth Factor I J. Clin. Endocrinol. Metab., September 1, 1999; 84(9): 3260 - 3267. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |