help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Khorram, O.
Right arrow Articles by Yen, S. S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Khorram, O.
Right arrow Articles by Yen, S. S. C.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Seniors' Health
The Journal of Clinical Endocrinology & Metabolism Vol. 82, No. 11 3590-3596
Copyright © 1997 by The Endocrine Society


From the Clinical Research Centers

Effects of [Norleucine27]Growth Hormone-Releasing Hormone (GHRH) (1–29)-NH2 Administration on the Immune System of Aging Men and Women1

O. Khorram2, M. Yeung, L. Vu and S. S. C. Yen3

Department of Reproductive Medicine (O.K., M.Y., L.V., S.S.C.Y.), University of California-San Diego, School of Medicine, La Jolla, California 92093-0633; and Department of Pediatrics (M.Y.), University of California, San Francisco

Address all correspondence (no reprints available) to: S. S. C. Yen, Department of Reproductive Medicine, University of California-San Diego, School of Medicine, La Jolla, California 92093-0633.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Aging in humans is associated with the decline of functional activities of the GH-insulin-like growth factor I (IGF-I) axis and the immune system. Because lymphocytes express GH-IGF-I, as well as GHRH and their respective receptors, restoration of this axis in age-advanced individuals, by the administration of GHRH, may enhance immune cell function. This hypothesis was tested by a single blind randomized placebo-controlled trial of 5 months duration, in which healthy elderly subjects (10 women, 9 men) self-administered sc nightly placebo for 4 weeks, followed by 16 weeks of [norleucine27]GHRH (1–29)-NH2 at a dose of 10 µg/kg. Fasting (0800 h–0900 h) blood samples were obtained for immune studies and for measurements of serum concentrations of IGF-I and soluble interleukin (IL)-2 receptor. GH pulsatility was determined in blood samples obtained at 10-min intervals for 12 h (2000 h–0800 h). Freshly isolated peripheral lymphocytes were analyzed by flow cytometric analysis for determination of lymphocyte subsets and monocytes. Mitogen stimulation responses, natural killer cell number and cytotoxicity, basal and stimulated IL-2 secretion from cultured lymphocytes, and IL-2 and IL-2R messenger RNA expression were measured. These studies were conducted at baseline, after placebo, and during GHRH analog administration at 4 and 16 weeks.

Treatment with GHRH analog resulted in a significant increase (107 and 70% in men and women, respectively) in the 12-h integrated GH secretion (P < .05) and serum IGF-I levels (28%) (P < .001) in both men and women by 4 weeks and lasted 12 weeks for IGF-I and 16 weeks for GH. Activation of the immune system occurred in both sexes within 4 weeks. A 30% increase (P < .001) in lymphocytes expressing the transferrin receptor (CD71) and in monocytes (CD14) (P < .05) occurred within 4 weeks. By 16 weeks, there was a significant increase (30%) in B cells (CD20) (P < .01), in cells expressing the T cell receptor {alpha} (20%) (P < .01), and T cell receptor {gamma}/{delta} (40%) (P < .0001). There were no changes in the number of T cells (CD3), T cell subsets (CD4, CD8), or natural killer cell (CD57) over the treatment period. The increase in B cell number was associated with enhanced responsiveness (50%) to the B cell mitogens: pokeweed mitogen (P < .01 or better) and Staphylococus aureus cells (P < .001), and a transient increase at 4 weeks in circulating IgG (P < .0001), IgM, and IgA (P < .001). T cells were functionally activated, as evidenced by a 50% increase in responsiveness to phytohemagglutinin (P < .01 or better), 70% increase in the number of lymphocytes expressing the IL-2 receptor (IL-2R) (CD25) (P < .001), and enhanced IL-2R messenger RNA expression and basal IL-2 secretion (50%) (P < .05) at 16 weeks of treatment. Furthermore, circulating soluble IL-2 receptor rose significantly (15%) (P < .05) within 4 weeks of treatment and remained elevated for the duration of the study. There were no sex differences in the immune response to GHRH analog and no adverse effects. These results indicate that GHRH analog administration has profound immune-enhancing effects and may be of therapeutic benefit in states of compromised immune function.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE AGING process is associated with a significant reduction of GH/insulin-like growth factor I (IGF-I) secretion (1) and a concomitant decline in immune function (2). Although the link of these two age-related events has not been established, observations in experimental animals and humans support this concept (for review, see Refs. 3–6). In rats, the age-related involution of the thymus gland can be restored by the administration of GH (7, 8). Similarly, treatment of aging rats with GH stimulated mitogen-induced lymphocyte proliferation (9), and treatment of hypophysectomized rats with recombinant human (rh)IGF-I, as well as rhGH, increased the weight of the thymus and spleen (10). In humans, GH and IGF-I and their receptors are expressed in lymphoid cells and organs and exhibit stimulatory effects on immune function (3, 4, 5, 6). Thus immune cells are not only a potential target for somatotropic hormones of pituitary origin, but locally generated hormones may serve important functions as autocrine or paracrine regulators of lymphocyte proliferation and function. The regulation of secretion of these hormones from the immune compartment has not been well delineated. Hattori et al. have presented data showing that GHRH, SRIH, and IGF-I do not affect GH secretion from peripheral lymphocytes, whereas GH up-regulated its own secretion (see Refs. 12 and 13). Other investigators have shown that the mitogenic effects of GH in the immune system are mediated via IGF-I, which seems to be regulated by GH (see Refs. 14 and 15).

By contrast to GH and IGF-I, relatively little is known about the function of GHRH in the immune system (for review, see Ref.16). Immunoreactive GHRH, its messenger RNA (mRNA), and binding of GHRH have been reported in rodent lymphocytes (17, 18, 19). Human lymphocytes have been shown to synthesize and release a biologically active GHRH peptide capable of stimulating GH release from both the pituitary and lymphocytes (20). Northern blot analysis detected two GHRH mRNA transcripts in lymphocytes, one similar in size to the hypothalamic species of 0.75 Kb and a larger transcript of approximately 10 Kb (20). Though the action of lymphocyte-derived GHRH is currently unknown, supraphysiologic concentrations significantly inhibited the chemotactic response of human peripheral lymphocytes (21) and natural killer (NK) cell activity in vitro (22). Different forms and doses of GHRH have different biological properties; GHRH (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29), but not GHRH (1–44), at low concentrations stimulated, whereas high concentrations inhibited phytohemagglutinin (PHA)-induced lymphoproliferation, interleukin (IL)-2 secretion, and IL-2 receptor expression on activated human peripheral lymphocytes (23).

Information on the in vivo effects of somatotrophic peptide on human and primate immune function is scant. GH replacement in GH-deficient children resulted in increased responsiveness to mitogen-induced cell proliferation (24), and long-term therapy was found to be either without an effect (25) or to decrease the number of B lymphocytes without altering serum Igs (26). Other investigators found that in GH deficient children, rhGH therapy increased the number of peripheral transferrin receptors CD3+ and CD8+ cells, while decreasing the number of CD4+ cells and IgM production in vitro (27). Crist et al. found that hGH administration activated NK cell function in postmenopausal women (28). Kiess et al. reported that 3 weeks of treatment with GHRH (1–44) did not restore the decreased NK cell activity of GH-deficient children (29, 30). Most recently, LeRoith et al. reported that GH and IGF-I administration in aged female monkeys elicited a marked activation of the immune system, as determined by histologic assessments of spleen and lymph nodes and an enhanced in vivo response to tetanus toxoid (31). However, it was not determined whether the GH effects were IGF-I mediated (31). To date, there is no data on the immune effects of GHRH administration in age-advanced humans.

Because both GH and IGF-I have mitogenic effects in the immune system, we hypothesized that restoration of the GH-IGF-I axis in aging men, through the administration of GHRH, would elicit immune activation. In this report, we present findings on the in vivo effects of the GHRH analog [Nle27]GHRH (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29)-NH2 on immune cell function in aging men and women.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Subjects

Twenty volunteers (10 women, 9 men) participated in this study. One subject dropped out of the study for reasons unrelated to the effects of GHRH analog. Men had a mean age of 66.9 yr (range 61–71) and body mass index of 24.5 kg/m2 (range 20–28), and women had a mean age of 64.6 yr (range 55–70) and body mass index of 24.3 kg/m2 (range 17–31). Subjects were healthy, nonsmokers, and on no medications other than daily hormone replacement therapy in 8 of 10 women (Premarin, 0.625 mg; Provera, 2.5 mg). Medical illness was excluded by history, physical examination, complete blood count, and chemistry profile. All subjects took the Beck depression test before commencing the study. The protocol was approved by the Human Subjects Committee of the University of California-San Diego. Subjects gave oral and written consent.

Study design

The study design was a single-blind placebo-controlled trial of 5 months duration. At 2100 h, subjects self-injected (sc, into their thighs) placebo (saline) for the first 4 weeks, followed by 16 weeks of [Nle27]GHRH (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29)-NH2, at a dose of 10 µg/kg BW. The GHRH analog (kindly provided by Dr. J. Rivier, Salk Institute, La Jolla, CA) has been shown to have full biologic activity, in terms of stimulating pituitary GH secretion (32). A solution of GHRH analog in 5-mL vials was provided to the subjects monthly at a dose of 2 mg/mL. Vials were stored frozen until dispensed to the subjects, then kept at 4 C for 10 days. HPLC analysis showed the peptide was stable at 4 C for at least 2 weeks.

Study protocol

Subjects were seen and interviewed, regarding potential side effects, on a twice-a-month or monthly basis. Fasting blood samples were obtained between 0800 and 0900 h for immune studies, hormone measurements, and safety laboratory tests (complete blood count and chemistry profile). Subjects were admitted to the CRC for assessment of 12-h GH pulsatility at baseline, after 4 weeks of placebo treatment, and at the end of GHRH analog treatment at 0700 h after an overnight fast. At 1800 h, an iv line was inserted, and blood samples were obtained at 10-min intervals for 12 h, beginning at 2000 h, for GH determination. At 2100 h, subjects received an sc injection of placebo (saline) during their first admission and GHRH analog at weeks 4 and 16. Blood pressure and body weight were monitored at each visit.

Hormone measurements

Serum GH concentrations were determined using an RIA with an interassay CV of 6% at 1.4 µg/L and 6.0 µg/L, 8% at 1.0 µg/L, and 2.5% at 4.2 µg/L, and a sensitivity of 0.9 µg/L. IGF-I was measured after acid-ethanol extraction using a Corning Nichols Institute RIA kit with an intraassay CV of 6% and sensitivity of 135 ng/mL.

GHRH antibodies

Sera from all subjects, before and after 4 months of treatment with GHRH analog, were tested for the presence of antibodies to GHRH by a competitive binding assay using I-125 GHRH (1–44) with initial dilution of 1:5 and 1:50 (Peninsula Labs, Belmont, CA).

Immune studies

Lymphocytes were isolated from freshly drawn blood by Ficoll-Hypaque (Sigma, St. Louis, MO) centrifugation (33). Cells were then washed three times with PBS buffer, counted in a hemocytometer, and suspended in the appropriate concentration in RPMI-1640 containing 1% glutamine, 1% penicillin-streptomycin, and 10% FCS.

Mitogen assays. Lymphocytes were incubated at a concentration of 1 x 106 cells/mL, in the presence of PHA (Murex Diagnostics, Norcross, GA) at 0.1 and 2 µg/mL, pokeweed mitogen (PWM; Gibco, Gettysburg, PA) at 0.5 and 5 µg/mL, and Staphylococus aureus cells (SAC; Calbiochem, La Jolla, CA) at a dilution of 1:1000 for 6 days in 5% CO2 and 37 C, at which time 0.2 µCi of 3H-thymidine was added. Cells were harvested 18 h later onto filters and counted in a liquid scintillation counter. Control wells contained only buffer. Results were expressed in terms of stimulation index determined as follows: cpm in mitogen containing wells/cpm in control wells.

Flow cytometry. Cells (2 x 105) were incubated with monoclonal antibodies (Beckton-Dickinson, Mountain View, CA) against various cell surface antigens. After 20 min of incubation at 4 C, the cells were washed two times and fixed with 2% paraformaldehyde (33). Cells were then analyzed in a FACS scan flow cytometer (Beckton-Dickinson Immunocytometry Systems, San Jose, CA) using two gates: one specifically for lymphocytes excluding monocytes; and a larger gate that included both monocytes and lymphocytes. Data were analyzed by Lysys II software.

NK cell cytotoxicity assay was done, as previously described (33), with minor modifications. Briefly, target K-562 cells were incubated with chromium-51 for 2 h in 5% CO2 and 37 C, after which, cells were washed two times with PBS and adjusted to a concentration of 105 cells per mL in RPMI-1640 with 10% FCS. Target cells were then incubated with lymphocytes from the subjects at effector-to-target ratios of 50:1 and 100:1 for 4 h in 5% CO2 and 37 C, at which time, 100 µL of the well contents were counted in a {gamma} counter. Target cells were incubated with and without 3% SDS, for measurement of spontaneous and maximum release. The specific lysis was determined as follows: (experimental release)-(spontaneous release)/(maximum release)-(spontaneous release).

Cytokine secretion/Igs. Next, 1 x 106 cells/mL were incubated with and without PHA (20 µg/mL) for 48 h in 5% CO2 at 37 C. After 48 h, the cell-free contents were stored at -70 C, for subsequent measurement of IL-2 by an enzyme-linked immunosorbent assay (ELISA) kit (Biosource, Camarillo, CA) with a sensitivity of 8.7 pg/mL. Soluble IL-2 receptor (IL-2R) was measured by ELISA (Genzyme, Boston, MA) with a sensitivity of 100 pg/mL. Igs were measured by radial immunodiffusion (The Binding Site, La Jolla, CA).

Cytokine gene expression. Total RNA was extracted from frozen cells according to the method of Chomczynski (34). The OD260/280 ratio of extracted RNA from peripheral lymphocytes was routinely at or greater than 1.8. RT-PCR was performed as follows: In a 20 µL reaction, 1 µg total RNA and 100 ng Random Primers (Promega, Madison, WI) were heated at 95 C for 1 min and cooled briefly on ice before adding 5x reverse transcription buffer (250 mmol/L Tris-HCl, pH 8.3; 375 mmol/L KCl; 15 mmol/L MgCl2; 50 mmol/L DTT), deoxy-ribonucleoside triphosphate (1.5 mmol/L final concentration), 8 units RNAguard (Pharmacia LKB Biotechnology, Piscataway, NJ), and 200 units Moloney murine leukemia virus RT (Promega). After 1 h at 37 C, the reaction was terminated by heating at 95 C for 5 min before cooling on ice. Amplification of the reverse-transcribed complementary DNA (cDNA) was accomplished by subjecting up to 5 µL of the cDNA to a 100-µL PCR reaction containing 50 mmol/L KCl, 10 mmol/L Tris-HCl (pH 9) at 25 C, 0.1% Triton X-100, 2 mmol/L MgCl2, 0.2 mmol/L of each of the deoxy-ribonucleoside triphosphates, 50 pmol of each primer, 2.5 units Tag DNA polymerase (Promega), and 100 µL light mineral oil in a thermal cycler (Coy Corporation, Grass Lake, MI). The PCR reaction was allowed to proceed for 30 cycles (95 C for 1 min, 55 C for 2 min, and 72 C for 3 min) before arresting the reaction in its logarithmic phase by rapid cooling at 4 C. PCR primers for IL-2 and IL-2R were purchased from Stratagene (La Jolla, CA). For the IL-2 message, the upstream and downstream primers for generating a 457-bp PCR product were 5' ATGTACAGGATGCAACTCCTGTCTT 3' and 5'GTCAGTGTTGAGATGATGATGCTTTGAC 3', respectively. For the IL-2R message, the primer set for a 391-bp PCR product was: 5' GACGATGACCCGCCA 3' (upstream) and 5' CCTCGACGCACTGATAAT 3' (downstream). As an internal control, the primer set (upstream) 5' CAAAAGGGTCATCATCTCTG 3', (downstream) 5' CCTGCTTCACCA CCTTCTTG 3' for generating a 446-bp PCR product specific for the glyceraldehyde-3-phosphate dehydrogenase message, as previously described (35), was included in each PCR reaction. To confirm the identity of the PCR products and to further quantitate them, an aliquot of each PCR reaction was run in a 0.7% agarose gel in TE buffer. The electrophoresed gel was then blotted onto a Magna Charge nylon membrane (Micron Seperations Inc, Westborough, MA) according to Southern (36). Hybridization and washing were performed, as described by Church and Gilbert (37), using 32P-random primed probes (38) specific for each message under investigation (cDNA probes were obtained from the American Type Culture Collection, Rockville, MD). The membrane was exposed for autoradiography to a XAR-5 film (Eastman Kodak, Rochester, NY). Radioactive message bands on the membrane were cut out and the amount of radioactivity determined by scintillation counting. The radioactivity count for the glyceraldehyde-3-phosphate dehydrogenase was used to normalize those for the IL-2 and IL-2R messages. Under these conditions, the amounts of PCR products detectable were proportional to input DNA templates in control PCR experiments.

Statistics

All data were analyzed by two-factor ANOVA with repeated measures. Post hoc testing compared responses to GHRH analog and placebo by the Fischer’s exact test. Data are presented as the mean SE), and P < 0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Treatment with placebo did not affect any of the immune parameters measured, and therefore, comparisons of the effects of GHRH analog were made with postplacebo, rather than baseline, values. The immune data from men and women were combined, because no sex differences in response to GHRH analog were found.

GH/IGF-I

Data related to GH/IGF-I response to GHRH analog administration have been reported elsewhere (39). Briefly, there was a significant increase in the integrated 12-h GH level in response to GHRH in both men (107%) (P < .05) and women (70%) (P < .01). Desensitization to the GH-releasing effect of GHRH did not occur after 4 months of treatment. As a result of activation of GH secretion, serum IGF-I rose significantly (28 and 27% in men and women, respectively) (P < .001) by 4 weeks; and by 16 weeks, the levels returned to baseline in both genders (Table 1Go).


View this table:
[in this window]
[in a new window]
 
Table 1. GH area under the curve (µg/L) (2000–8000 h) (top) and fasting serum IGF-1 (ng/mL) (bottom) in response to placebo before and after GHRH analog treatment

 
Immune studies. The effect of GHRH analog treatment on lymphocyte subsets is shown in Table 2Go. When compared with placebo, GHRH analog treatment induced, within 4 weeks, an increase (P < .05) in cells expressing CD71, a marker of cellular proliferation. By 16 weeks, a highly significant rise (P < .001) in CD54+ (intercellular adhesion molecule-1) cells, another indicator of immune activation, was observed. A rise in the number of monocytes (CD14) occurred within 4 weeks of GHRH analog treatment (P < .05) with a further increase by 16 weeks (P < .0001). The percentage of B lymphocytes (CD20) showed a significant (P < .01) increase by 16 weeks of treatment. There were no effects on the percentage of NK cells (CD57), total T lymphocytes (CD3), T cell subsets (CD4, CD8), or the CD4/CD8 ratio. A significant increase in cells expressing the T cell receptor {alpha}/ß (P < .01), and T cell receptor {gamma}/{delta} (P < .0001) occurred at 16 weeks.


View this table:
[in this window]
[in a new window]
 
Table 2. Results of flow cytometric analyses as indicator of immune response at baseline and after placebo and to GHRH analog treatments

 
Concomitant with the rise in B cell population (CD20), an enhanced responsiveness to the mitogenic effects of B cell-specific mitogens, PWM (P < .01 or better) and SAC (P < .001), was evident at 16 weeks (Fig. 1Go). A rise in serum IgG, IgA, and IgM (P < .001 or better) occurred after 4 weeks of GHRH analog treatment, with levels returning to baseline by 16 weeks (Table 3Go). NK cell (CD57) number (Table 2Go) or cytotoxicity (Table 3Go) was not altered by GHRH treatment.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 1. Response of lymphocytes in subjects after placebo (P) and GHRH treatment to the B cell-specific mitogens: PWM (0.5 and 5 µg/mL) and SAC (1:1000 dilution). **, P < .01; ***, P < .001 vs. P.

 

View this table:
[in this window]
[in a new window]
 
Table 3. Effect of GHRH treatment on the in vitro secretion of basal and PHA-induced IL-2 secretion from cultured lymphocytes, serum immunoglobulins, and NK cell cytotoxicity

 
Although there was no change in T cell population, a dose-related increase (P < .01 or better) in the proliferative response of peripheral lymphocytes to the T cell specific mitogen PHA occurred at 16 weeks of GHRH analog treatment (Fig. 2Go). The basal, but not PHA-stimulated, secretion of IL-2 increased significantly (P < .05) after 16 weeks of GHRH analog treatment (Table 3Go). Importantly, a highly significant rise (P < .001) in cells expressing the IL-2R (CD25) was demonstrated by 16 weeks (Fig. 3Go). The enhanced cellular expression of the IL-2R was accompanied by an increase in circulating sIL2-R (P < .05) within 4 weeks of GHRH analog treatment, which persisted for the duration of the treatment (Fig. 3Go). Furthermore, an increase in IL-2 receptor transcript also was evident by 16 weeks of GHRH analog treatment (Fig. 4Go). In this experiment, lymphocytes from nine subjects (five men, four women), obtained before and after GHRH analog treatment, revealed an increase in the expression of IL-2R mRNA, but not IL-2, in six out of nine subjects tested.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 2. Response of lymphocytes in subjects after placebo (P) and GHRH analog treatment to the T cell-specific mitogen: PHA (0.1 and 10 µg/mL). **, P < .01; ***, P < .001 vs. P.

 


View larger version (13K):
[in this window]
[in a new window]
 
Figure 3. sIL-2R, as determined by ELISA, and percent lymphocytes expressing the IL-2R (CD25), as determined by flow cytometry, after placebo and GHRH analog treatment. *, P < .05; ****, P < .0001 vs. P.

 


View larger version (29K):
[in this window]
[in a new window]
 
Figure 4. Steady-state IL-2R mRNA, before and after GHRH treatment, in two subjects. Lanes 1 and 2, respectively, represent IL-2R mRNA expression, before and after treatment, in a female subject; and lanes 3 and 4, respectively, in a male subject. Lanes 5–8 represent duplicate RT-PCR experiments corresponding to lanes 1–4, except that the amount of cDNA used was one third of that used in lanes 1–4.

 
There were no correlations between age and immune response to GHRH. Furthermore, our results suggest that the steroid milieu does not alter the immune response to GHRH analog, because there were no correlations between serum testosterone levels and immune function in men and no sex difference in immune response to GHRH analog.

The nightly administration of GHRH analog was well tolerated without adverse effects. The long-term administration of GHRH analog did not result in formation of circulating antibodies to the GHRH analog in all subjects tested, before and after 4 months of treatment with GHRH analog.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study demonstrates, for the first time, that the administration of GHRH analog to elderly subjects results in activation of the immune system. This activation occurred in both sexes at 4 weeks, with an increase in immune cell proliferation, as indicated by increase in the percent of cells expressing the transferrin receptor. The relative number of B cells and monocytes increased with no changes in T or NK cell populations. Both T and B cell functionality were enhanced, as evidenced by increased responsiveness to mitogens and an increase in circulating Igs and lymphocytes expressing the IL-2 receptor, with no changes in NK cell cytotoxicity. This immune enhancement by GHRH analog treatment occurred in the absence of apparent adverse effects and without formation of antibodies against GHRH analog. The latter finding was consistent with the report that treatment of monkeys with GHRH analog for 6 months resulted in antibodies production in 1 of 6 animals tested, and these antibodies were biologically nonneutralizing (40).

The in vivo data presented here, using GHRH (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29) analog, are in agreement with the in vitro findings of Valtorta et al. (23). They found that low doses of GHRH (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29), but not GHRH (1–44), stimulated PHA-induced lymphocyte proliferation, whereas high doses inhibited IL-2 production, IL-2R mRNA expression, and lymphocyte proliferation. These findings suggest a direct action of GHRH analog on immune cells and raise the intriguing possibility that distinct sequences within the GHRH molecule may have opposing effects on immune function.

The GH-IGF-I axis was activated in response to the GHRH analog administration. Both GH and IGF-I are known to enhance immune function and influence peripheral lymphocytes by yet undetermined mechanisms (3, 6). The lack of correlation between the time course of changes in GH-IGF-I levels and immune function seen in our study, together with reports on the in vivo effects of rhGH on peripheral lymphocyte subsets (24, 25, 26, 27) and NK cell function (28), are different from those induced by GHRH analog treatment. Further, although data on the effects of IGF-I on human immune function are not available, IGF-I administration in aging monkeys increased the number of CD8+ T cells (T suppressor) in the peripheral blood (31). This finding also differs from our results, showing no effect on T cell number in response to GHRH analog, although the dose and mode of administration of these hormones could potentially influence the results. Differences in the immune response evoked by GH and IGF-I, as compared with GHRH analog, suggest that the immune effects of this analog can not satisfactorily be explained by the modest rise in serum IGF-I and GH levels.

Our data indicate that all components of the peripheral immune system seem to be activated by GHRH analog administration. It is proposed that T cells potentially play a key role in orchestrating the immune response to GHRH. Because immune cells express GHRH/GH/IGF-I and their respective receptors (3, 6), GHRH might trigger its mitogenic effect by sequentially activating the IL-2 receptor gene expression, thereby inducing proliferation and activation of T cells at physiological concentrations of IL-2 (41). As T cells are activated, a portion of the cell surface IL-2 receptor would be shed into the circulation and bind IL-2, thereby neutralizing its effect. An autofeedback system may be postulated to include the up-regulation of IL-2 receptor, and IL-2 action with modulation by sIL-2R (41). Activation of IL-2 and its receptor also may be instrumental for B cell production of Igs and functional activation of monocytes (41, 42, 43). The lack of effect of GHRH analog on NK cells is to be expected, because these cells express only the IL-2R{alpha} (41), which does not seem to be a target of GHRH. The importance of GHRH in regulating T cell function has been demonstrated in a study of transgenic mice harboring the human GHRH promoter fused to the coding sequences from the virus. These mice were found to have severe thymic hyperplasia, primarily involving the epithelial component of the gland (44). In another study, transgenic mice producing human GHRH were found to have increased splenic progenitor cell colony formation and DNA synthesis in vivo and in vitro (45). These observations collectively support the proposition that GHRH analog may act directly on the immune cells.

One of the limitations of our study was the use of peripheral lymphocytes to provide insight into the whole immune system. Westermann and Pabst (46) have raised concerns about use of peripheral lymphocytes as an experimental window on the lymphoid system. They have argued that blood represents only about 2% of the total lymphocyte pool in the adult human, and these cells are affected by various factors such as time of sampling, stress, drugs, and various diseases. Thus, the effects of GHRH analog described here may not be truly representative of the immune status of the subjects. The second limitation was that a control group of young individuals was not used, and therefore, it is difficult to conclude that a rejuvenation of the immune system occurred as a result of GHRH analog administration. However, the immunoscenecent phenotype, characterized primarily by a decline in T cell function and decreased IL-2R expression (2), was restored by GHRH analog treatment (findings resemble the youthful phenotype). Nonetheless, the manner in which activation of the peripheral immune compartment translates to the ability to mount an immune response to a foreign antigen remains to be elucidated.

In summary, we have demonstrated that the administration of GHRH analog in humans has profound stimulatory effects on the immune system in vivo. T cell activation may be the initial inciting event that leads to activation of monocytes and B lymphocytes through yet unidentified cytokine pathways. The immune-enhancing effects of GHRH analog may have potential benefits in immunodeficient states, particularly those associated with depressed T cell function. Studies to address this issue are underway.


    Acknowledgments
 
We wish to thank Dr. Jean Rivier for his generous gift of GHRH, S. Petze for technical assistance, and G. A. Laughlin and D. Nye for editorial and secretarial assistance.


    Footnotes
 
1 This work was supported by NIH RO1–1AG-10979–03, HD-12303–19, General Clinical Research Center USPHA Grant MO1-RR-00827, and by an American College of Obstetrics and Gynecology Ortho fellowship (to O.K.) and by NIH Training Grant T32 HD07203-19. Back

2 Former Fellow in Reproductive Endocrinology. Current address: Department of Obstetrics and Gynecology, University of Wisconsin Medical School, Madison, Wisconsin. Back

3 Clayton Foundation Investigator. Back

Received May 23, 1997.

Revised July 8, 1997.

Accepted July 14, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Corpas E, Harman SM, Blackman MR. 1993 Human growth hormone and human aging. Endocr Rev. 14:20–39.[Abstract/Free Full Text]
  2. Miller RA. 1991 Aging and immune function. Int Rev Cytol. 124:187–215.3.[Medline]
  3. Clark R. 1997 The somatogenic hormones and insulin-like growth factor-I: stimulators of lymphopoiesis and immune function. Endocr Rev. 18:157–179.[Abstract/Free Full Text]
  4. Kelly KW. 1991 The role of growth hormone in modulation of the immune response. Ann NY Acad Sci. 95–103.
  5. Gala RR. 1991 Prolactin and growth hormone in the regulation of the immune system. Proc Soc Exp Biol Med. 198:513–527.[CrossRef][Medline]
  6. Auernhammer CJ, Strasburger CJ. 1995 Effect of growth hormone and insulin-like growth factor I on the immune system. Eur J Endocrinol. 133:635–645.[Abstract/Free Full Text]
  7. Kelly KW, Brief S, Westly HJ, et al. 1986 GH3 pituitary adenoma cells can reverse thymic aging in rats. Proc Natl Acad Sci USA. 83:5663–5667.[Abstract/Free Full Text]
  8. Monroe WE, Roth JA, Grier RL, Arp LH, Naylor PH. 1987 Effects of growth hormone on the adult canine thymus. Thymus. 9:173–187.[Medline]
  9. Davila DR, Brief S, Sun J, Hammer RE, Brinster RL, Kelley KW. 1987 Role of growth hormone in regulating T-dependent immune events in aged, nude, and transgenic rodents. J Neurosci Res. 18:108–116.[CrossRef][Medline]
  10. Guler H, Zapf J, Scheiwiller E, Froesch E. 1988 Recombinant human insulin-like growth factor I stimulates growth and has distinct effects on organ size in hypophysectomized rats. Proc Natl Acad Sci USA. 85:4889–4893.[Abstract/Free Full Text]
  11. Wu H, Devi R, Malarkey WB. 1996 Localization of growth hormone messenger ribonucleic acid in the human immune system—a clinical research center study. J Clin Endocrinol Metab. 81:1278–1282.[Abstract]
  12. Hattori N, Ikekubo K, Ishihara T, Moridera K, Hino M, Kurahachi N. 1994 Spontaneous growth hormone (GH) secretion by unstimulated human lymphocytes and the effects of GH-releasing hormone and somatostatin. J Clin Endocrinol Metab. 79:1678–1680.[Abstract]
  13. Hattori N, Shimomura K, Ishihara T. 1993 Growth hormone (GH) secretion from human lymphocytes is up-regulated by GH, but not affected by insulin-like growth factor-I. J Clin Endocrinol Metab. 76:937–939.[Abstract]
  14. Sabharwal P, Varma S. 1996 Growth hormone synthesized and secreted by human thymocytes acts via insulin-like growth factor I as an autocrine and paracrine growth factor. J Clin Endocrinol Metab. 81:2663–2669.[Abstract]
  15. Baxter JB, Blalock JE, Weigent DA. 1991 Characterization of immunoreactive insulin-like growth factor-I from leukocytes and its regulation by growth hormone. Endocrinology. 129:1727–1734.[Abstract/Free Full Text]
  16. Campbell RM, Scanes CG. 1995 Endocrine peptides "moonlighting" as immune modulators; roles for somatostatin and GH-releasing factor. J Endocrinol. 147:383–396.[Abstract/Free Full Text]
  17. Weigent DA, Blalock JE. 1990 Immunoreactive growth-hormone releasing hormone in rat lymphocytes. J Neuroimmunol. 29:1–13.[CrossRef][Medline]
  18. Guarcello V, Weigent DA, Blalock JE. 1991 Growth hormone releasing hormone receptors on thymocytes and splenocytes from rats. Cell Immunol. 135:29–32.[CrossRef]
  19. Weigent DA, Riley JA, Galin FS, LeBoeuf RD, Blalock JE. 1991 Detection of growth hormone and growth-hormone releasing hormone-related messenger RNA in rat leukocytes by the polymerase chain reaction. Proc Soc Exp Biol Med. 198:643–648.[Medline]
  20. Stephanou A, Knight RA, Lightman SL. 1991 Production of growth-hormone-releasing hormone-like peptide and its mRNA by human lymphocytes. Neuroendocrinology. 53:628–633.[Medline]
  21. Zelazowski P, Dohler KD, Stepien H, Pavlikowski M. 1989 Effect of growth-hormone releasing hormone on human peripheral blood leukocyte chemotaxis and migration in normal subjects. Neuroendocrinology. 50:236–239.[CrossRef][Medline]
  22. Siriani MC, Annibale B, Tagliaferi F, et al. 1992 Modulation of human natural killer activity by vasoactive intestinal polypeptide (VIP) family. VIP, glucagon, and GHRF specifically inhibit NK activity. Regul Pept. 38:79–87.[CrossRef][Medline]
  23. Valtorta A, Maretta A, Maccario A, Bozzola M, Severi F. 1991 Influence of growth hormone-releasing hormone (GHRH) on phytohemagglutinin-induced lymphocyte activation; comparison of two synthetic forms. Thymus. 18:51–59.[Medline]
  24. Abbassi B, Bellonti JA. 1985 Hormonal and cell-mediated immunity in growth hormone-deficient children: effect of therapy with human growth hormone. Pediatr Res. 19:299–301.[Medline]
  25. Rapaport R, Oleske J, Ahdieh H, et al. 1987 Effects of human growth hormone on immune function:in vitro studies on cells of normal and growth-deficient children. Life Sci. 41:2319–2324.[CrossRef][Medline]
  26. Spadoni GL, Rossi P, Ragno W, et al. 1991 Immune function in growth hormone-deficient children treated with biosythetic growth hormone. Acta Paediatr. 80:75–79.[CrossRef]
  27. Bozzola M, Cisernino M, Valtorta A, et al. 1989 Effect of biosynthetic methionyl growth hormone (GH) therapy on the immune function in GH-deficient children. Horm Res. 31:153–156.[Medline]
  28. Crist DM, Peake GT, Mackinnoa LT, Sibbitt WL, Kramer JC. 1989 Exogenous growth hormone treatment alters body composition and increases natural killer cell activity in women with impaired endogenous growth hormone secretion. Metabolism. 36:1115–1119.
  29. Kiess W, Doerr H, Butenandt O, Belohradsky O. 1986 Lymphocyte subsets and natural-killer activity in growth hormone deficiency. New Engl J Med. 314:321.[Medline]
  30. Kiess W, Malozowski S, Gelato M, et al. 1988 Lymphocyte subset distribution and natural killer activity in growth hormone deficiency before and during short-term treatment with growth hormone releasing hormone. Clin Immunol Immunopathol. 48:85–94.[CrossRef][Medline]
  31. LeRoith D, Yanowski J, Kaldjian EP, et al. 1996 The effects of growth hormone and insulin-like growth factor I on the immune system of aged female monkeys. Endocrinology. 137:1071–1079.[Abstract]
  32. Vance ML, Evans WS, Kaiser DL, et al. 1986 The effect of intravenous, subcutaneous, and intramural GHRH analog, [Nle27]GHRH(1–29)NH2 on growth hormone secretion in normal men: dose-response relationships. Clin Pharmacol Ther. 10:627–633.
  33. Coligan JE, Kruisbect AM, Margulies DM, Shevach EM, Strober W, eds. 1992 Current protocols in immunity. New York: Greene Publishing Associates and Wiley Intersciences.
  34. Chomczynski P, Sacchi N. 1987 Single-step method of RNA isolation by acid guanidinium thymocyte-pheno-chloroform extraction. Anal Biochem. 162:156–159.[Medline]
  35. Yeung MC, Pulliam L, Lau AS. 1995 The HIV membrane gp120 is toxic to human brain cell cultures through the induction of interleukin-6 and tumor necrosis factor-alpha. AIDS. 9:137–143.[Medline]
  36. Southern EM. 1975 Detection of specific sequences among DNA fragment separated by gel electrophoresis. J Mol Biol. 98:503–517.[CrossRef][Medline]
  37. Church GM, Gilbert W. 1984 Genomic sequencing. Proc Natl Acad Sci USA. 81:1991–1995.[Abstract/Free Full Text]
  38. Sambrook I, Fritsch EF, Maniatis T. 1989 Molecular cloning. Cold Spring Harbor: Cold Spring Harbor Laboratory Press; 1014.
  39. Khorram O, Laughlin G, Yen SSC. 1997 Endocrine and metabolic effects of long-term administration of [Nle27] growth hormone-releasing hormone (GHRH)(1–29)NH2 in age-advanced men and women. J Clin Endocrinol Metab. 82:1472–1479.[Abstract/Free Full Text]
  40. Mowles TF, Stricker P, Felix AM, Soike KF, Campbell RM. 1991 Effect of human growth hormone-releasing factor and a potent analog on antibody formation in African Green Monkey. Horm Metab Res. 23:530–534.[Medline]
  41. Abbas AK, Lichtman AH, Pober JS, eds. 1994 Cellular and molecular immunology. New York: W. B. Saunders; 136.
  42. Espinoza-Delgado T, Bosco MC, Musso T, Guselli GL, Longo DL, Veresco L. 1995 Interleukin-2 and human monocyte activation. J Leukoc Biol. 57:13–19.[Abstract]
  43. Kimata H, Yoshida A. 1994 Effect of growth hormone and insulin-like growth factor I on immunoglobulin production and growth of human B cells. J Clin Endocrinol Metab. 78:635–641.[Abstract]
  44. Botteri FM, Van der Putten H, Wong DF, Sauvage CA, Evans RM. 1987 Unexpected thymic hyperplasia in transgenic mice harboring a neuronal promoter fused with simian virus 40 large T antigen. Mol Cell Biol. 7:3178–3184.[Abstract/Free Full Text]
  45. Blazar BR, Brennan CA, Broxmeyer HE, Schultz LD, Vallera DA. 1995 Transgenic mice expressing either bovine growth hormone (bGH) or human GH releasing hormone (hGRH) have increased splenic progenitor cell colony formation and DNA synthesis in vitro and in vivo. Exp Hematol. 22:1397–1406.
  46. Westermann J, Pabst R. 1990 Lymphocyte subsets in the blood: a diagnostic window on the lymphoid system? Immunol Today. 11:406–410.[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
M. Ionescu and L. A. Frohman
Pulsatile Secretion of Growth Hormone (GH) Persists during Continuous Stimulation by CJC-1295, a Long-Acting GH-Releasing Hormone Analog
J. Clin. Endocrinol. Metab., December 1, 2006; 91(12): 4792 - 4797.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
E. L. Thacker, D. J. Holtkamp, A. S. Khan, P. A. Brown, and R. Draghia-Akli
Plasmid-mediated growth hormone-releasing hormone efficacy in reducing disease associated with Mycoplasma hyopneumoniae and porcine reproductive and respiratory syndrome virus infection
J Anim Sci, March 1, 2006; 84(3): 733 - 742.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
O. Khorram, M. Garthwaite, and T. Golos
The Influence of Aging and Sex Hormones on Expression of Growth Hormone-Releasing Hormone in the Human Immune System
J. Clin. Endocrinol. Metab., July 1, 2001; 86(7): 3157 - 3161.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. C. Koo, C. Huang, R. Camacho, C. Trainor, J. T. Blake, A. Sirotina-Meisher, K. D. Schleim, T.-J. Wu, K. Cheng, R. Nargund, et al.
Immune Enhancing Effect of a Growth Hormone Secretagogue
J. Immunol., March 15, 2001; 166(6): 4195 - 4201.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. B. Solerte, M. Fioravanti, G. Vignati, A. Giustina, L. Cravello, and E. Ferrari
Dehydroepiandrosterone Sulfate Enhances Natural Killer Cell Cytotoxicity in Humans Via Locally Generated Immunoreactive Insulin-Like Growth Factor I
J. Clin. Endocrinol. Metab., September 1, 1999; 84(9): 3260 - 3267.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Khorram, O.
Right arrow Articles by Yen, S. S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Khorram, O.
Right arrow Articles by Yen, S. S. C.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Seniors' Health


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals